U.S. patents available from 1976 to present.
U.S. patent applications available from 2005 to present.

Thermophilic micro-organisms for ethanol production

Patent 8143038 Issued on March 27, 2012. Estimated Expiration Date: Icon_subject July 26, 2031. Estimated Expiration Date is calculated based on simple USPTO term provisions. It does not account for terminal disclaimers, term adjustments, failure to pay maintenance fees, or other factors which might affect the term of a patent.
Abstract Claims Description Full Text

Patent References

Molecular cloning and expression in industrial Bacillus species
Patent #: 5238833
Issued on: 08/24/1993
Inventor: Sanders, et al.

Cells homozygous for disrupted target loci
Patent #: 5589369
Issued on: 12/31/1996
Inventor: Seidman, et al.

Modification of bacteria
Patent #: 6664076
Issued on: 12/16/2003
Inventor: Green ,   et al.

Ethanol production Patent #: 7691620
Issued on: 04/06/2010
Inventor: Green, et al.

Inventors

Assignee

Application

No. 13191056 filed on 07/26/2011

US Classes:

435/161Ethanol

Examiners

Primary: Saidha, Tekchand

Attorney, Agent or Firm

Foreign Patent References

  • 0124076 EP 11/01/1984
  • 0351717 EP 01/01/1990
  • 0 937 774 EP 08/01/1999
  • 2 477 572 FR 09/01/1981
  • 2 074 188 GB 08/01/1981
  • 2171703 GB 09/01/1986
  • 2005-261239 JP 09/01/2005
  • WO 98/45425 WO 10/01/1998
  • WO 88/09379 WO 12/01/1998
  • WO 01/49865 WO 07/01/2001
  • WO 01/83784 WO 11/01/2001
  • WO 02/29030 WO 04/01/2002
  • WO 2006/117536 WO 11/01/2006
  • WO 2006/131734 WO 12/01/2006
  • WO 2007/039753 WO 04/01/2007
  • WO 2008/038019 WO 04/01/2008
  • WO 2009/022158 WO 02/01/2009
  • WO 2010/052499 WO 05/01/2010

International Classes

C12P 7/06
C12N 1/20

Description

>FIELD OF THE INVENTION


This invention relates to the production of micro-organisms suitable for the production of ethanol. In particular, the invention relates to the modification of micro-organisms to enable the utilisation of starch as a fermentation substrate.

BACKGROUND TO THE INVENTION

Bacterial metabolism can occur through various different mechanisms depending on the bacterial species and environmental conditions. Heterotrophic bacteria, which include all pathogens, obtain energy from oxidation of organic compounds, withcarbohydrates (particularly glucose), lipids and protein being the most commonly oxidised compounds. Biological oxidation of these organic compounds by bacteria results in synthesis of ATP, a chemical energy source. The process also permits generationof more simple organic compounds (precursor molecules) which are required by the bacterial cell for biosynthetic reactions.

Starch is a naturally abundant carbohydrate and is the principal glucose storage complex in plants. Starch molecules consist of two polysaccharides called amylose and amylopectin. Amylose is a linear polymer of 500 to 20,000 D-glucosesubunits, which are linked together via a-1,4 glucosidic bonds to form a helical structure. The additional presence of a-1,6 glucosidic bonds results in amylopectin, which has a branched structure. Starch generally comprises 20-30% amylose and 70-80%amylopectin. In plant cells, insoluble starch is packed into solid granules in which amylopectin is clustered in crystalline regions and amylose is distributed throughout. Starch solubility increases with temperature; amylopectin crystals becomegelatinous and granules eventually dissolve.

Amylase is a calcium-dependant glycoside hydrolase metalloenzyme. There are three forms of amylase (α, β and γ) which vary according to the specific bonds they hydrolyse. Alpha-amylase catalyses the random hydrolysis ofinternal a-D-1,4 glucosidic bonds, releasing simple fermentation sugars including glucose, maltose (disaccharides formed by two glucose units). Dextrins (short, low molecular weight a-1,4-linked D-glucose polymers) are released by amylopectin hydrolysisand maltotriose and maltose are released by amylase hydrolysis. Beta-amylase acts from the non-reducing end of the starch chain, catalysing the hydrolysis of the second a-1,4 glucosidic bond to cleave two glucose units (maltose). Gamma-amylase has thecapacity to cleave a-1,6 linkages in amylopectin. Alpha-amylase is widely synthesized in nature since many organisms can digest starch. In human physiology a-amylase is most prominent in saliva and pancreatic secretions. Microbial a-amylases areclassified as either liquefying (randomly cleaves the polysaccharide to form shorter chains) or saccharifying (produces mono-, di-, or trisaccharide units), depending on the points of hydrolysis of the glucose polymer chain.

The general process by which bacteria metabolise suitable substrates is glycolysis, which is a sequence of reactions that converts glucose into pyruvate with the generation of ATP. The fate of pyruvate in the generation of metabolic energyvaries depending on the micro-organism and the environmental conditions. The four principal reactions of pyruvate are illustrated in FIG. 1.

First, under aerobic conditions, many micro-organisms will generate energy using the citric acid cycle and the conversion of pyruvate into acetyl coenzyme A, catalysed by pyruvate dehydrogenase (PDH).

Second, under anaerobic conditions, certain ethanologenic organisms can carry out alcoholic fermentation by the decarboxylation of pyruvate into acetaldehyde, catalysed by pyruvate decarboxylase (PDC) and the subsequent reduction of acetaldehydeinto ethanol by NADH, catalysed by alcohol dehydrogenase (ADH).

A third reaction, which also occurs in anaerobic conditions, is the conversion of pyruvate to acetyl CoA, catalysed by pyruvate formate lyase (PFL). Acetyl CoA is subsequently converted into acetaldehyde by the enzyme acetaldehyde dehydrogenase(AcDH) and ethanol is produced by the reduction of acetaldehyde catalysed by ADH.

A fourth process is the conversion of pyruvate into lactate which occurs through catalysis by lactate dehydrogenase (LDH).

There has been much interest in using micro-organisms for the production of ethanol using either micro-organisms that undergo anaerobic fermentation naturally or through the use of recombinant micro-organisms which incorporate the pyruvatedecarboxylase and alcohol dehydrogenase genes. The use of such micro-organisms, modified to enhance utilisation of starch as a metabolic substrate, would enable efficient production of ethanol from cheap, abundant, un-refined plant material.

Thermophilic bacteria have been proposed for ethanol production, and their use has the advantage that fermentation can be carried out at elevated temperatures which allows the possibility that the ethanol produced can be removed as vapour attemperatures above 50° C.; this also permits fermentation to be carried out using high substrate concentrations. However, there is a need for improved micro-organisms for ethanol production from starch-based culture media.

SUMMARY OF THE INVENTION

According to a first aspect of the present invention, a thermophilic micro-organism is modified to increase amylase gene expression compared to wild-type, wherein a first modification is the insertion of a heterologous amylase gene under thecontrol of a suitable promoter, or a series of different promoters.

The micro-organism may be further modified to permit increased production of ethanol, via up-regulation of the native pyruvate dehydrogenase gene and inactivation of the native pyruvate formate lyase and lactate dehydrogenase genes.

The micro-organism of the invention shows increased starch hydrolysis and increased ethanol production compared to wild-type.

According to a second aspect of the present invention, a method for the production of ethanol comprises culturing a micro-organism according to the definition provided above under suitable conditions in the presence of starch.

DESCRIPTION OF THE DRAWINGS

The present invention is described with reference to the accompanying figures, wherein:

FIG. 1 illustrates schematically the metabolic pathway of glycolysis;

FIG. 2 illustrates the pGEM-T Easy.RTM. Vector;

FIG. 3 illustrates the hypothetical promoter regions and genes of the PDH complex;

FIG. 4 illustrates the use of pTMO111 for integration of the amylase gene, amyS;

FIG. 5 is the nucleic acid coding sequence (SEQ ID NO. 1) of amyS;

FIG. 6 is a graph showing the batch fermentation results for strain TM304 in a 5% w/v soluble starch culture; and

FIG. 7 is a graph showing the batch fermentation results for strain TM333 in a 5% w/v soluble starch culture.

DESCRIPTION OF THE INVENTION

The present invention is based on the modification of a thermophilic micro-organism to enable enhanced amylase gene expression.

Increasing expression of the amylase gene enables the micro-organism to hydrolyse starch into glucose monomer units which can then be utilised as glycolytic substrates for the formation of pyruvate and subsequently ethanol. Methods ofincreasing amylase expression and enzyme activity preferably include the use of strong up-stream promoters to regulate transcription of the gene and incorporation of additional amylase genes that are expressed at a higher frequency than the nativeamylase gene.

The thermophilic micro-organism of the invention may be further modified to disrupt the expression of the native lactate dehydrogenase gene and to up-regulate the PDH gene.

Inactivating the lactate dehydrogenase gene helps to prevent the breakdown of pyruvate into lactate, and therefore promotes (under appropriate conditions) the breakdown of pyruvate into ethanol using pyruvate decarboxylase and alcoholdehydrogenase. It is preferred if the lactate dehydrogenase gene is disrupted by a deletion within or of the gene.

Up-regulating the PDH gene promotes the conversion of pyruvate into acetyl CoA, which can then be used, under appropriate conditions, to produce acetaldehyde and eventually ethanol using acetaldehyde dehydrogenase. A further advantage ofup-regulating PDH is that pyruvate levels, which have an inhibitory effect on glucose uptake and glycolysis, are reduced. This further promotes ethanol production.

The term "strong promoter" is defined herein as a promoter that expresses the corresponding protein to a level greater than 0.5% of the soluble protein in a cell.

The micro-organism may be any thermophilic micro-organism, but it is preferred if the micro-organism is of the Bacillus species. In particular, it is preferred if the micro-organism is a wild-type micro-organism of the Geobacillus species, inparticular Geobacillus thermoglucosidasius.

In a preferred embodiment, the micro-organisms selected for modification are said to be "wild-type", i.e. they are not laboratory-produced mutants. The micro-organisms may be isolated from environmental samples expected to contain thermophiles. Isolated wild-type micro-organisms may have limited amylase activity, but insufficient to enable ethanol production when cultured in a media comprising starch as the main carbon source. Isolated wild-type micro-organisms will have the ability to produceethanol from pyruvate but, unmodified, lactate is likely to be the major fermentation product.

It is preferable that the micro-organism of the invention has certain desirable characteristics which permit the micro-organism to be used in a fermentation process. The micro-organism should preferably have no restriction system, therebyavoiding the need for in vivo methylation. It is preferable if the micro-organism is transformable at a high frequency. Furthermore, the micro-Organism should be stable to at least 3% w/v ethanol, preferably at least 5-10% w/v ethanol. Themicro-organism should have a growth rate in continuous culture to support dilution rates of 0.3 h-1 and above.

The micro-organism will be a thermophile and will grow in the temperature range of 40° C.-85° C. Preferably, the micro-organism will grow within the temperature range 50° C.-70° C. In addition, it is desirablethat the micro-organism grows in conditions of pH 7.2 or below, in particular pH 4.5-pH 6.9.

The culture media may preferably comprise at least 1% w/v starch, preferably at least 10% w/v starch, and most preferably at least 20% w/v starch. The starch may be soluble or insoluble (e.g. grain starch). Other preferred components of theculture media may include, but are not limited to those listed in Table 1.

TABLE-US-00001 TABLE 1 Final Chemical Vol./L Concentration NaH2PO.sub.4●2H.sub.2O 10 ml 20 mM K2SO.sub.4 20 ml 10 mM Citric acid●H2O 8 ml 8 mM MgSO4●7H.sub.2O 20 ml 5 mM CaCl2●2H.sub.2O 4 ml 0.08mM Sulphate Trace Elements Stock Solution 5 ml See Table 2 Na2MoO.sub.4●2H.sub.2O 0.1 ml 1.65 μM (NH4)2SO.sub.4 12.5 ml 25 μM 1% Biotin* 0.3 ml 12 μM 40% Glucose** 3 × 25 ml 3% w/v Antifoam 2.5 ml *Prepared bydissolving 0.1g biotin per 10 ml DMSO **Final glucose concentration preferably between 1 and 4% w/v

Components of sulphate trace elements stock solution are shown in Table 2.

TABLE-US-00002 TABLE 2 Final Medium Chemical gl-1 (ml) Concentration Conc. H2SO.sub.4 5.000 Zn SO4●7H.sub.2O 1.440 25 μM Fe SO4●7H.sub.2O 5.560 100 μM Mn SO4●H.sub.2O 1.690 50 μM CuSO4●5H.sub.2O 0.250 5 μM Co SO4●7H.sub.2O 0.562 10 μM Ni SO4●6H.sub.2O 0.886 16.85 μM H3BO.sub.3 0.080 Deionised H2O (final vol.) 1000 ml

In a preferred embodiment, a heterologous amylase gene encodes α-amylase (α-1,4-glucan-4-glucanohydrolase, EC 3.2.1.1). It is preferred that the amylase gene is derived from the Geobacillus species, in particular Geobacillusstearothermophilus.

The coding sequence of α-amylase has been elucidated and the techniques enabling isolation and amplification of the gene are well known in the art. In order to enable the micro-organism of the invention to exhibit increased amylaseexpression compared to wild-type, it is preferred that the amylase gene is placed under the control of a strong promoter, which operates in low-aeration or anaerobic conditions that favour ethanol production by thermophilic micro-organisms. The promoteris preferably an Idh promoter and may be autologous, but is preferably heterologous, and is most preferably derived from the same species as the amylase gene. Examples of suitable promoters include, but are not limited to, P_Idh from G.stearothermophilus NCA1503, P_ferrA from G. stearothermophilus DSM13240 and P_pfl from B. cereus ATCC14579.

In another embodiment of the invention, a series of different strong promoters are placed upstream of the amylase gene in order to further enhance expression. Examples of suitable strong promoters include, but are not limited to, theglyceraldehyde-3-phosphate promoter (P_GAPDH) and amylase promoter from G. stearothermophilus NCA 1503.

The nucleic acid sequence of P_Idh is also known and techniques for cloning and assembling the promoter sequence upstream of the amylase gene are known to the skilled person.

The promoter/amylase sequence can be cloned into a suitable plasmid or expression vector containing multiple restriction sites. There are numerous suitable expression vectors which are commercially available, such as the pGEM.RTM.-T Easy Vector(FIG. 2). Restriction enzymes can be used to excise the P_Idh/amylase construct as a specific fragment which can be ligated into the corresponding restriction site in a temperature-sensitive plasmid such as pUC19 (New England Biolabs). It is preferableto use a pyruvate formate lysate knock-out plasmid. The plasmid construct comprising the amylase gene/Idh promoter can then be electroporated into the micro-organism of the invention and achieves homologous recombination with genomic DNA. Chromosomalintegrants can be selected for on the basis of their resistance to antibacterial agents, such as ampicillin or kanamycin. Amylase activity can also be visualised as zones of starch clearing, for example on plate assays.

In a preferred embodiment, the micro-organism of the invention is further modified by inactivation of the lactate dehydrogenase gene. The nucleic acid sequence for lactate dehydrogenase is now known. Using this sequence, it is possible for theskilled person to target the lactate dehydrogenase gene to achieve inactivation of the gene through different mechanisms. It is possible to inactivate the lactate dehydrogenase gene by the insertion of a transposon. However, it is preferred if thelactate dehydrogenase gene is inactivated by the deletion of the gene sequence or a portion of the gene sequence. Deletion is preferred as this avoids the difficulty of reactivation of the gene sequence which is often experienced when transposoninactivation is used. In a preferred embodiment, the lactate dehydrogenase gene is inactivated by the integration of a temperature-sensitive plasmid (for example plasmid pUB190-Idh as disclosed in PCT/GB06/01586), which achieves natural homologousrecombination or integration between the plasmid and the micro-organism's chromosome. Chromosomal integrants can be selected for on the basis of their resistance to antibacterial agents. The integration into the lactate dehydrogenase gene may occur bya single cross-over recombination event or by a double (or more) cross-over recombination event.

In a further preferred embodiment, the micro-organism is further modified to up-regulate PDH. PDH is a large enzyme complex, containing three units--E1: pyruvate decarboxylase (EC 1.2.4.1, not EC 4.1.1.1), E2: dihydrolipoamide transacetylase,and E3: dihydrolipoamide dehydrogenase. The complex requires several cofactors, including NAD, FAD, coenzyme A lipoic acid and thiamine pyrophosphate (TPP). Four genes code for the complex, as the E1 unit is a heterodimer of α and β subunits, and are often described as pdhA, pdhB, pdhC and pdhD (E1α, E1β, E2 and E3 respectively). The E1 unit of PDH requires TPP in the same way that PDC (EC 4.1.1.1) requires TPP and catalyses a similar decarboxylation reaction, but in thepresence of coenzyme A and lipoic acid--carried by other enzyme units--the product is acetyl CoA rather than acetaldehyde. However, PDC activity of the E1 unit has been measured when it has not been complexed with other units in PDH (Lessard & Perham;The Journal of Biological Chemistry; 1994, 269:14, 10378-10383; Tomar et al; Applied Microbiology and Biotechnology; 2003, 62, 76-82; Frank et al; Science; 2004, 306: October 29, 872-876, supplementary data). Accordingly, PDC activity of EC 1.2.4.1 maybe enhanced by the up-regulation of PDH so that acetaldehyde is produced over and above acetyl CoA. Enhanced PDH activity is also sought to remove the pyruvate bottleneck observed in LDH inactivated strains to allow more ethanol to be produced with lessacetate and formate as side products.

To this end, the PDH genes and surrounding sequence was isolated using standard "genome walking" techniques. Approximately 8.8 kb of DNA was isolated, sequenced and found to contain the following genes shown in FIG. 3 and Table 3.

TABLE-US-00003 TABLE 3 Position Frame (aa's at 5' Size Gene (bp) Proposed function and 3') (aa) pdf2 746-192 Peptide deformylase -3 (MIT - IER) 184 orf2 868-1497 Unknown- +1 (MQR - IWK) 209 Hypothetical protein pdhA(α) 1875-2984α-subunit of pyruvate +3 (MGA - ESK) 369 hydrogenase pdhA(β) 3003-3965 β-subunit of pyruvate +3 (MIQ - INF) 320 dehydrogenase pdhB 4058-5368 Dihydrolipoamide +2 (VAP - MEA) 436 transacetylase lpd 5373-6785 Lipoamide +3 (MVV - ISK) 470dehydrogenase orf7 7432-6833 Unknown- -1 (MNK - CTE) 199 Hypothetical protein orf8 7964-8647 Transposase +2 (MDL - SPP) 227

The hypothetical promoter regions are shown in FIG. 3 (arrows)--one upstream from the start of pdhA and a possible second promoter ahead of pdhB. A previous example of a secondary promoter in the PDH cluster was reported for Bacillus subtilis(Gao et al; Journal of Bacteriology, 2002, 184:10, 2780-2788), but most described PDH gene clusters have just one promoter upstream of the cluster (Neveling et al; Biochimica Acta; 1998 1385, 367-372. The upregulation can be carried out using techniquesknown in the art. In particular, upregulation can be carried out by introducing a suitable promoter or enhancer sequence upstream of the PDH complex.

The enzyme complex is known to work under both aerobic and anaerobic conditions (Carlsson et al; Infection and Immunity; 1985, 49:3, 674-678) but it is generally considered to be an aerobic enzyme (Ch 15; Principles of Biochemistry; Lehninger,Nelson & Cox; 2nd Ed, Worth Publishers, New York, 1993, p 447) with pyruvate formate lyase (PFL) its anaerobic counterpart. Both enzymes convert pyruvate, formed in glycolysis, to acetyl CoA to feed into the TCA cycle but the cycle only workscompletely under aerobic conditions. However, as it is desirable to use anaerobic conditions, promoters that operate in anaerobic conditions are preferred for use in the invention. Thus promoters for enzymes believed to work under anaerobicconditions--examples being the LDH promoter (P_Idh from G. stearothermophilus NCA1503), the PFL promoters (P_pfl from B. cereus ATCC14579, and G. thermoglucosidasius NCIMB11955) and ferredoxin promoters (P_ferrA from G. stearothermophilus DSM13240)--canbe used, as in PCT/GB2007/03699 which is incorporated herein by reference.

In a preferred embodiment, a further modification is introduced to enhance the PDC activity, thereby promoting the conversion of pyruvate to acetaldehyde. This can be carried out by inactivating E2; dihydrolipoamide transacetylase (EC2.3.1.12). Inactivation can be carried out in a manner similar to the inactivation of LDH, but with the E2 gene as the target for disruption.

In a further embodiment, a micro-organism of the invention comprises a modification to inactivate the pyruvate formate lyase gene, thereby preventing/reducing the conversion of pyruvate to acetyl CoA and formate. Pyruvate formate lyase (PFL) isthe "anaerobic counterpart" to pyruvate dehydrogenase (PDH) and converts pyruvate to acetyl CoA and formate (see FIG. 1). While acetyl CoA can be converted to ethanol via acetaldehyde dehydrogenase (AcHD), formate is an undesired side product which hasthe potential to inhibit growth in ethanolgenic organisms.

PFL was chosen as a target for knockout in order to promote the metabolic flux towards ethanol production and to improve the redox balance of the remaining pathway to ethanol synthesis. An additional advantage of this work was the eliminationof formate production. PFL activity can be inactivated via transposon insertion, gene deletion or partial gene deletion to produce a mutant which does not rely on antibiotic selection for the continuation of the altered phenotype. In this embodiment,it is preferred that the micro-organism comprises both the lactate dehydrogenase inactivation and the up-regulation of the pyruvate dehydrogenase, so that, under anaerobic conditions, ethanol production is increased.

In a further preferred embodiment, the micro-organism will also comprise heterologous pyruvate decaroboxylase and alcohol dehydrogenase genes. The expression of these heterologous genes results in the production of enzymes which redirect themetabolism so that ethanol is the primary fermentation product. The genes may be obtained from micro-organisms that typically undergo anaerobic fermentation, including Zymomonas species, including Zymomonas mobilis.

Methods for the preparation and incorporation of the gene into micro-organisms are known, for example in Ingram et al, Biotech & BioEng, 1998; 58 (2+3): 204-214 and U.S. Pat. No. 5,916,787, the content of each being incorporated herein byreference. The gene may be introduced in a plasmid or integrated into the chromosome, as will be appreciated by the skilled person.

The micro-organisms of the invention are cultured using soluble starch as part of the feedstock. The temperature, pH and other growth conditions can be selected based on known culture requirements.

An embodiment of the present invention will now be described, with reference to the accompanying drawings, in the following example. Two approaches for generating integrants of the G. stearothermophilus DSM22 α-amylase gene in the genomeof G. thermoglucosidasius NCIMB 11955 are outlined below. The present invention is exemplified, but not limited, by these methods.

EXAMPLE

Integration of the Amylase Gene

Approach 1: Fast-Track Strategy Using a NotI Fragment from the Existing Clone, pGEM-LA

Using techniques well known in the art, the α-amylase sequence (amyS) was generated by PCR and joined to the Idh promoter (P_Idh) from 11955. This construct was cloned into the commercially available pGEM-T Easy.RTM. expression vector,generating pGEM-LA. As shown in FIG. 2, the ligation site in the pGEM-T Easy vector is flanked by multiple restriction sites. It is therefore possible to excise the inserted P_Idh/amylase sequences on a NotI/NotI fragment.

The NotI fragment from pGEM-LA was ligated into the NotI site of the pfl knock-out plasmid construct pTMO111 to generate two sibling plasmid constructs, pTMO139 and pTMO140. These were introduced via electroporation into TM242, a stablePFL-negative 11955 strain. Presumptive integrants were selected at 68° C.

The primary transformants (autonomous plasmids) and primary integrants were tested for amylase production by growth as patches on TGP+0.4% soluble starch plates for 3 days at 60° C., followed by flooding with Gram's iodine solution. Large zones of clearing (starch hydrolysis) were seen around these strains, comparable to a DSM22 control. TM242 gave a trace of activity in this test, much less than DSM22, indicating some background activity. Sub-culture of primary integrants inliquid media in the absence of kanamycin followed by replication of colonies to TGP_kanamycin was used to identify potential double cross-over mutants (DCOs). A total of 32 kanamycin sensitive colonies were tested for amylase activity on TGP+0.4%soluble starch (3 ml in the wells of 12-well Costar plates, 3 days at 60° C.). None gave large zones, except for the positive control, DSM22. The majority of strains gave traces of clearing, similar to the TM242 control, but 5 showed modest yetsignificant zones of clearing. Diagnostic PCR was carried out on genomic preparations from 2 of these strains, TM319 and TM320, using degenerate primers bamr66a and bamr72, which were designed based on sequence homology between known Bacillus PFLsequences. For both strains, a single PCR product of approximately 3.1 kb was obtained, which on digestion with NotI gave a double bank of approximately 0.6 kb and a band of approximately 2.0 kb. This is consistent with the expected genereplacement/insertion. The controls gave the expected results, approximately 1.7 kb product from 11955 (wild-type) which did not cut with NotI and an approximately 1.3 kb product from TM242 which gave a double bank of approximately 0.6 kb on digestionwith NotI. It therefore appears that these strains (TM319 and TM320) represent integration of the amylase construct at the pfl locus.

Approach 2: Generating Amylase Constructs with the P_Idh(NCA) Promoter

The strategy used to place the amylase coding sequence from DSM22 under the control of P_Idh(NCA) is outlined in FIG. 4. pTMO31 is a plasmid vector comprising ECOR1/SnaB1 pUB110 fragment inserted into the multiple cloning site (mcs) of pUC19(NEB).

The amylase coding sequence was amplified, via PCR, as an NdeI/NotI fragment, using the pGEM-LA construct as template. P_Idh(NCA) was amplified as a NdeI/NotI fragment using pTMO49 (produced by cloning P_Idh(NCA 1503) into pTMO23) as atemplate, and the products were cloned and assembled in pTMO23 (pUC19 with NdeI site removed) to generate the insertion (gene replacement) constructs pTMO146 and pTMO147 (sibling plasmids). Table 4 details the PCR components for generation ofP_Idh(NCA)/amyS constructs for insertion into 11955.

TABLE-US-00004 TABLE 4 PCR fragment Template Primers Size (bp) AmyS cds NdeI/NotI pGEM-LA Bamr87 1657 + primers Bamr88 P_Idh(NCA) NotI/NdeI pTMO49 Bamr89 180 + primers Bamr38

Sequencing of Amylase Clones

The cloned PCR product for the amylase coding sequence generated using the bamr87 and bamr88 oligos (see Table 4) was sequenced to check integrity. Two independent clones were sequenced. Each showed a different single base-pair mutation, whichwas presumably introduced by PCR. The clone chosen for progression was pTMO135 (PCR product blunt-end ligated into the SmaI site of pTMO23). The PCR-induced mutation in this clone represents a silent mutation, giving the same amino acid and similarcodon usage, as judged by the published codon usage for G. kaustophilus. The amylase coding sequence from pTMO135 (omitting the start codon) is shown in FIG. 5. Nucleotides corresponding to discrepancies between this sequence and the published DSM22amyS sequence (accession number M57457) are underlined. There are 9 differences between the pTMO135 sequence (covering 15 bp) and the published DSM22 amyS sequence (M57457). The mismatch at 1449 represents the PCR-induced mutation in pTMO135.

Sequencing of the amylase insert in pTMO139, which has the NotI fragment from pGEM-LA, showed perfect agreement with pTMO135 (except for the 1449bp mutation). The amylase coding sequence was then amplified by PCR directly from G.stearothermophilus DSM22 genomic DNA (the strain was obtained from the DSMZ collection). The PCR product obtained (using the bamr87 and 88 oligos as before) was cloned into pTMO23 (to give pTMO145) and sequenced. The sequence was identical to pTMO135(except for the 1449 mutation) and pTMO139, with the exception of bp904. In both pTMO135 and pTMO139 bp904 is "A", but in pTMO145 it is "G". This introduces an aspartic acid to asparagine mutation at this position. This codon (GAC for aspartic acid)proved to be conserved in all Geobacillus amylase sequences examined, so it is probably a mutation introduced by PCR cloning of the amylase sequence from DSM22. The other discrepancies in the sequence must be assumed to be errors in the publishedsequence; alignment with other Geobacillus amylase sequences indicates that the sequence (i.e. in pTMO135 and pTMO145) is far closer to the consensus than the published sequence (M57457).

Experimental work continued with the pTMO145 and pTMO146 constructs, despite the 904 mutation, as it was clear that the cloned NotI fragment from pGEM-LA did give substantial amylase activity on starch plates.

Generation and Characterisation of DCOs for pTMO145 and pTMO146 (P_Idh(NCA)/amyS)

pTMO145 and pTMO146 were introduced into TM242 by electroporation and presumptive double cross-over (DCO) mutants were selected as outlined previously. A total of 48 presumptive DCOs (kanamycin-sensitive) were tested in plate assays for amylaseactivity. 18 gave very strong amylase activity (the others looked similar to the TM242 control). When patched to larger sector plates, they gave zones of clearing at least as large as the DSM22 control. Four of these strains, TM304, TM305, TM311 andTM315, were selected for further work. Genomic DNA was prepared and used in diagnostic PCR. All four gave results indicating insertion of the amyS gene at the pfl locus. Two amylase mutant strains, TM304 and TM305, were tested for ethanol productionin ASYE (0.5%) first with glucose as carbon source, and then with soluble starch. Testing was conducted in law and high aeration conditions. The results are shown in Table 5. TM304 and TM305 produce approximately as much ethanol from soluble starch asfrom glucose in both high and low aeration models. TM242 produces notably lower levels of ethanol on starch compared to glucose, but this effect is considerably less marked in higher aeration conditions. TM304 and TM305 produce similar amounts ofethanol to the TM242 when cultured with glucose, however when the three strains are incubated in the presence of starch it is clear that the superior amylase function of TM304 and TM305 allows the micro-organisms to convert substantially all of thestarch into ethanol. In low aeration conditions this is almost to the same level as with glucose, whilst TM242's ability to produce ethanol from starch is approximately a third of its ability to convert glucose to ethanol.

TABLE-US-00005 TABLE 5 Strain Carbon source O2 Glucose Ethanol Acetate Starch* TM304 2% glucose Low 15.9 144.6 3.1 TM305 2% glucose Low 14.3 141.8 3.4 TM242 2% glucose Low 8.7 142.7 3.8 TM304 2% soluble starch Low 3.8 138.4 4.1 TM305 2%soluble starch Low 4.6 135.9 3.8 TM242 2% soluble starch Low 0.0 52.5 7.6 Yes TM304 2% glucose High 18.2 113.4 19.7 TM305 2% glucose High 10.4 119.8 20.8 TM242 2% glucose High 7.9 127.8 17.3 TM304 2% soluble starch High 16.8 98.9 20.7 TM305 2% solublestarch High 6.7 117.9 25.2 TM242 2% soluble starch High 6.5 78.0 23.5 Yes *test for residual starch; 0.5 ml culture plus 0.2 ml Gram's iodine. All negative except those marked. Inoculum; 100 ul of frozen stock Seed; 10 ml 2TY in 50 ml conical,52° C. O/N, 250 rpm, 1 ml transfer (10%) Production; 10 ml ASYE (0.5%) plus C source in 15 or 50 ml falcon, 60° C., 250 rpm, 24 hrs

The batch fermentation results for strain TM304 cultured in 5% w/v soluble starch are shown in FIG. 6. A simple test with Gram's iodine indicated that the DCOs, unlike TM242, hydrolyzed all the starch. The results clearly support the utilityof the inserted heterologous amylase under the P_Idh(NCA) promoter for starch utilization in low aeration conditions.

Generation and Characterisation of DCOs for pTMO150 and pTMO151 (P_Idh(NCA)/amyS--No Mutation)

New amyS PCR product from DSM22 genomic DNA was used to generate "clean" DCO constructs, termed pTMO150 and pTMO151. These two plasmids have P_Idh(NCA) inserted into the pfl gene in opposite orientations. pTMO150 is in the same direction oftranscription as pfl. pTMO151 is in the opposite direction, as is P_Idh(NCA) in pTMO146 and pTMO147. DCOs were generated from both plasmids and two mutants from each were verified by PCR (TM328 and 329 from pTMO150 and TM333 and 335 from pTMO151). Twoamylase mutant strains, TM304 and TM305, were tested. All four mutant strains, together with TM304, TM305 and TM242 were tested for ethanol production in low aeration conditions in ASYE (0.5%), first with 2% w/v glucose as carbon source, and then with2% w/v soluble starch and finally 3% w/v soluble starch.

The results, which are shown in Table 6, show that all mutant strains performed similarly well in 2% w/v soluble starch, producing over twice as much ethanol as the parent strain TM242. In 3% w/v starch, TM333 produces more ethanol and producesa greater area of clearing on starch plates than the other mutants, indicating that TM333 may be a superior ethanol producer over TM304.

TABLE-US-00006 TABLE 6 Strain C source Glucose (mM) EtOH (mM) Starch Area TM328 2% glucose 25.1 128.6 852 TM329 2% glucose 26.7 121.3 871 TM333 2% glucose 12.7 135.4 871 TM335 2% glucose 37.5 102.8 860 TM304 2% glucose 3.9 149.8 882 TM305 2%glucose 9.5 151.5 886 TM242 2% glucose 20.4 130.8 879 TM328 2% starch 5.0 127.5 1817 TM329 2% starch 4.8 132.2 1816 TM333 2% starch 4.8 133.3 1626 TM335 2% starch 12.0 124.8 1836 TM304 2% starch 6.7 135.0 1727 TM305 2% starch 6.6 136.1 1716 TM242 2%starch 0.0 62.2 3803 TM328 3% starch 13.9 139.3 2817 TM329 3% starch 14.1 137.4 2824 TM333 3% starch 30.6 151.3 2333 TM335 3% starch 16.9 121.4 2991 TM304 3% starch 31.0 141.2 2440 TM305 3% starch 30.0 140.1 2510 TM242 3% starch 0.0 75.6 6306

These results are supported by the results of batch fermentation of TM333 (carried out under the same conditions as the fermentation of strain TM304 (FIG. 6)), which are illustrated in FIG. 7 and suggest that TM333 is able to utilise all theglucose released from starch.

Comparative testing was carried out to ensure that the mutant strains TM304 and TM333 performed in a similar fashion to the parent strain TM242 and had not developed any unexpected mutations. The results are shown in Tables 7A and 7B.

TABLE-US-00007 TABLE 7A Hrs to Glucose Aeration complete sugar remaining/ Pyruvate/ Lactate/ Strain switch consumption OD mM mM mM TM304 3 hr/OD 5.9 6.2 10.1 0 1 8 TM333 3 hr/OD 5.5 7.4 9.1 0 1 10 TM242 2.5 hr/OD 5.6 7.5 9.8 0 1 10

TABLE-US-00008 TABLE 7B Ethanol Overall yield post ethanol Formate/ Acetate/ Ethanol/ anaerobic yield: peak Strain mM mM mM switch g/g ethanol TM304 0 12 336 0.41 0.40 TM333 0 16 293 0.44 0.38 TM242 0 13 314 0.44 0.42

>

NAGeobacillus stearothermophilus tttc accgcatcat tcgaaaagga tggatgttcc tgctcgcgtt tttgctcact 6ctgt tctgcccaac cggacagccc gccaaggctg ccgcaccgtt taacggcacc tgcagt attttgaatg gtacttgccg gatgatggca cgttatggac caaagtggccaagcca acaacttatc cagccttggc atcaccgctc tttggctgcc gcccgcttat 24acaa gccgcagcga cgtagggtac ggagtatacg acttgtatga cctcggtgaa 3tcaaa aaggggccgt ccgcacaaaa tacggaacaa aagctcaata tcttcaagcc 36gccg cccacgccgc tggaatgcaa gtgtacgccgatgtcgtgtt cgaccataaa 42gccg acggcacgga atgggtggac gccgtcgaag tcaatccgtc cgaccgcaac 48atct cgggcaccta tcaaatccaa gcatggacga aatttgattt tcccgggcgg 54acct actccagctt taagtggcgc tggtaccatt ttgatggcgt tgattgggac 6ccgaa aattgagccgcatttacaaa ttccgcggca tcggcaaagc gtgggattgg 66gaca cggaaaacgg aaactatgac tacttaatgt atgccgacct tgatatggat 72gaag tcgtgactga gctgaaaagc tgggggaaat ggtatgtcaa cacaacgaac 78gggt tccggcttga tgccgtcaag catattaagt tcagtttttt tcctgattgg84tatg tgcgttctca gactggcaag ccgctattta ccgttgggga atattggagc 9catca acaagttgca caattacatt atgaaaacaa acggaacgat gtctttgttt 96ccgt tacacaacaa attttatacc gcttccaaat cagggggcac atttgatatg acgttaa tgaccaatac tctcatgaaa gatcaaccaacattggccgt caccttcgtt aatcatg acaccgaacc cggccaagcg ctgcagtcat gggtcgaccc atggttcaaa ttggctt acgcctttat tctaactcgg caggaaggat acccgtgcgt cttttatggt tattatg gcattccaca atataacatt ccttcgctga aaagcaaaat cgatccgctc atcgcgcgcagggatta tgcttacgga acgcaacatg attatcttga tcactccgac atcgggt ggacaaggga aggggtcact gaaaaaccag gatccggact ggccgcattg accgatg ggccgggagg aagcaaatgg atgtacgttg gcaaacaaca cgccggaaaa ttctacg accttaccgg caaccggagt gacaccgtca ccatcaacagtgatggatgg gaattca aagtcaatgg cggttcggtt tcggtttggg ttcctagaaa aacgaccgtc actatcg cttggtcgat cacaacccga ccgtggactg atgaattcgt ccgttggacc ccacggt tggtggcatg gccttgatgc ctgc R>

Other References

  • Office Action dated Sep. 23, 2011 in U.S. Appl. No. 12/376,826, filed May 22, 2009.
  • Office Action dated Sep. 15, 2011 in U.S. Appl. No. 13/127,927, filed May 13, 2011.
  • Rowe-Magnus, D.A. et al. “Identification of a Second Region of the Spo0A Response Regulator of Bacillus subtilis Required for Transcription Activation” J. Bacteriol., Aug. 2000, 182(15):4352-4355.
  • Nakajima, R. et al. “Nucleotide Sequence of the Bacillus stearothermophilus α-Amylase Gene” J. Bacteriol., Jul. 1985, 163(1):401-406.
  • Lewis, R.J. et al. “Domain Swapping in the Sporulation Response Regulator Spo0A” J. Mol. Biol., Mar. 31, 2000, 297(3):757-770.
  • Lapierre, L. et al. “D-Lactate Dehydrogenase Gene (IdhD) Inactivation and Resulting Metabolic Effects in the Lactobacillus johnsonii Strains La1 and N312” Appl. Environ. Microbiol., Sep. 1999, 65(9):4002-4007.
  • De Graef, M.R. et al. “The Steady-State Internal Redox State (NADH/NAD) Reflects the External Redox State and Is Correlated with Catabolic Adaptation in Escherichia coli” J. Bacteriol., Apr. 1999, 181(8):2351-2357.
  • Office Action dated Feb. 18, 2011 in U.S. Appl. No. 12/066,526, filed Jun. 29, 2008.
  • Office Action dated Mar. 7, 2011 in U.S. Appl. No. 12/376,826, filed May 22, 2009.
  • Office Action dated Jun. 16, 2011 in U.S. Appl. No. 12/066,526, filed Jun. 29, 2008.
  • Office Action dated Jun. 25, 2010 in U.S. Appl. No. 11/913,480, filed Apr. 17, 2008.
  • Office Action dated Nov. 17, 2009 in U.S. Appl. No. 11/913,480, filed Apr. 17, 2008.
  • Office Action dated Nov. 15, 2010 in U.S. Appl. No. 11/915,930, filed Sep. 29, 2008.
  • Office Action dated May 5, 2010 in U.S. Appl. No. 11/915,930, filed Sep. 29, 2008.
  • Yomano, L.P. et al. “Isolation and characterization of ethanol-tolerant mutants of Escherichia coli KO11 for fuel ethanol production” Journal of Industrial Microbiology & Biotechnology, Feb. 1998, 20(2):132-138.
  • Witzmann, S. et al. “The pyruvate dehydrogenase complex from the thermophilic organisms: thermal stability and re-association from the enzyme components” Biochemica et Biophysica Acta, 1998, 13885:341-352.
  • Wendisch, V.F. et al. “Metabolic engineering of Escherichia coli and Corynebacterium glutamicum for biotechnological production of organic acids and amino acids” Current Opinion in Microbiology, 2006, 9:268-274.
  • Tomar, A. et al. “The effect of acetate pathway mutations on the production of pyruvate in Escherichia coli” Appl Microbiol Biotechnol, 2003, 62:76-82.
  • Stephenson, K. et al. “Molecular insights into the initiation of sporulation in Gram-positive bacteria: new technologies for an old phenomenon” FEMS Microbiology Reviews, 2005, 29:281-301.
  • Siegert, P. et al. “Exchanging the substrate specificities of pyruvate decarboxylase from Zymomonas mobilis and benzoylformate decarboxylase from Pseudomonas putida” Protein Engineering, Design & Selection, 2005, 18(7):345-357.
  • Schütz, A. et al. “Studies on structure-function relationships of indolepyruvate decarboxylase from Enterobacter cloacae, a key enzyme of the indole acetic acid pathway” Eur. J. Biochem., 2003, 270:2322-2331.
  • Schütz, A. et al. “Crystal structure of thiamindiphosphate-dependent indolepyruvate decarboxylase from Enterobacter cloacae, an enzyme involved in the biosynthesis of the plant hormone indole-3-acetic acid” Eur. J. Biochem., 2003, 270:2312-2321.
  • San Martin, R. et al., “Pathways of ethanol production from sucrose by a mutant thermophilic Bacillus in continuous culture,” Journal of General Microbiology, Jan. 5, 1993, 139:1033-1040, Great Britain.
  • San Martin, R. et al., “Development of a synthetic medium for continuous anaerobic growth and ethanol production with a lactate dehydrogenase mutant of Bacillus stearothermophilus,” Journal of General Microbiology, Feb. 3, 1992, 138:987-996, Great Britain.
  • Payton, M.A. “Production of ethanol by thermophilic bacteria,” Trends in Biotechnology, 1984, 2(6):153-158, Elsevier, Amsterdam, NL, XP000999007.
  • Niu, X.D. et al. “Cloning and nucleotide sequence of the gene for dihydrolipoamide acetyltransferase from Saccharomyces cerevisiae” Proc. Natl. Acad. Sci. USA, Oct. 1988, 85:7546-7550.
  • Nichols, N.N. et al. “Engineering lactic acid bacteria with pyruvate decarboxylase and alcohol dehydrogenase genes for ethanol production from Zymomonas mobilis” J Ind Microbiol Biotechnol, 2003, 30:315-321.
  • Neveling, U. et al. “Gene and subunit organization of bacterial pyruvate dehydrogenase complexes” Biochemica et Biophysica Acta, 1998, 1385:367-372.
  • Molle, V. et al. “The Spo0A regulon of Bacillus subtilis” Molecular Microbiology, 2003, 50(5):1683-1701.
  • Lynd, L.R. et al. “Thermophilic Ethanol Production: Investigation of Ethanol Yield and Tolerance in Continuous Culture” Applied Biochemistry and Biotechnology, 1991, 28/29:549-570.
  • Lessard, I.A.D. et al. “Expression in Escherichia coli of Genes Encoding the E1α and E1β Subunits of the Pyruvate Dehydrogenase Complex of Bacillus stearothermophilis and Assembly of a Functional E1 Component (α1β2) in Vitro” The Journal of Biological Chemistry, 1994, 269(14):10378-10383.
  • Lee, D.H. et al. “Ethanol Fermentation of Corn Starch by a Recombinant Saccharomyces cerevisiae Having Glucoamylase and α-Amylase Activities” J. Food Sci. Nutr., 2001, 6(4):206-210.
  • Larsen, L. et al. “Thermoanaerobacter mathranii sp. Nov., an ethanol-producing, extremely thermophilic anaerobic bacterium from a hot spring in Iceland” Arch Microbiol, 1997, 168:114-119.
  • Kuisiene, N. et al, “Phylogenetic, Inter, and Intraspecific Sequence Analysis of spo0A Gene of the Genus Geobacillus” Curr Microbiol, 2009, 58:547-553.
  • Jimenez, J. et al. “Selection of Ethanol-Tolerant Yeast Hybrids in pH-Regulated Continuous Culture” Applied and Environmental Microbiology, Apr. 1988, 54(4):917-922.
  • Hollmann, R. et al. “Pyruvate formation and suppression in recombinant Bacillus megaterium cultivation” Journal of Biotechnology, 2004, 111:89-96.
  • Hartley, B.S. et al. (May 1983) “Development and Economics of a Novel Thermophilic Ethanol Fermentation” Presentations from Biotech '83 London, May 4-6, 1983 First World Conference, Biotech, Northwood, Online Conf. LTD, GB, pp. 895-905.
  • Germain, P. et al. “Ethanol production by anaerobic thermophilic bacteria: regulation of lactate dehydrogenase activity in Clostridium thermohydrosulfuricum” Appl Microbiol Biotechnol, 1986, 24:300-305.
  • Geobacillus thermoglucosidasius. NCBI Databases, pp. 1-3, printed from the internet on Oct. 29, 2010.
  • Gao, H. et al. “The E1β and E2 Subunits of the Bacillus subtilis Pyruvate Dehydrogenase Complex Are Involved in Regulation of Sporulation” Journal of Bacteriology, May 2002, 184(10):2780-2788.
  • Fortina, M.G. et al. “Reclassification of Saccharococcus caldoxylosilyticus as Geobacillus caldoxylosilyticus (Ahmad et al. 2000) comb nov” International Journal of Systematic and Evolutionary Microbiology, 2001, 51:2063-2071.
  • Fong, J.C.N. et al., “Isolation and characterization of two novel ethanol-tolerant facultative-anaerobic thermophilic bacteria strains from waste compost” Extremophiles, 2006, 10:363-372.
  • Desai, S.G. et al., “Cloning of L-lactate dehydrogenase and elimination of lactic acid production via gene knockout in Thermoanaerobacterium saccharolyticum JW/SL-YS485,” Applied Microbiology and Biotechnology, Oct. 2004, 65(5):600-605, XP002393736.
  • Database WPI Week 200567, Thomson Scientific, AN 2005-653380, XP002487167 & JP2005-261239A, Sep. 29, 2005.
  • Carlsson, J. et al. “Pyruvate Dehydrogenase Activity in Streptococcus mutans” Infection and Immunity, 1985, 49(3):674-678.
  • Breuer, M. et al. “High-throughput assay of (R)-phenylacetylcarbinol synthesized by pyruvate decarboxylase” Anal Bioanal Chem, 2002, 374:1069-1073.
  • Biswas, I. et al., “High-Efficiency Gene Inactivation and Replacement System for Gram-Positive Bacteria,” Journal of Bacteriology, Jun. 1, 1993, pp. 175(11):3628-3635, Washington, DC, US, XP000563688.
  • Barstow, D.A. et al. “Cloning, expression and complete nucleotide sequence of the Bacillus stearothermophilus L-lactate dehydrogenase gene” Gene, 1986, 46:47-55, abstract.
  • U.S. Appl. No. 13/127,927, filed May 13, 2011, Atkinson et al.
PatentsPlus Images
Enhanced PDF formats
loading...
PatentsPlus: add to cart
PatentsPlus: add to cartSearch-enhanced full patent PDF image
$9.95more info
 
Sign InRegister
Username  
Password   
forgot password?