Patent References
Methods of preparing carboxy-terminally truncated recombinant flavivirus
envelope glycoproteins employing drosophila melanogaster expression
systems
Genetic induction of anti-viral immune response and genetic vaccine for
filovirus
Marburg virus vaccines
Adenovirus vector with multiple expression cassettes
Composition and method for stimulating immune response to pathogen using complex adenoviral vector
Ebola virion proteins expressed from venezuelan equine encephalitis (VEE) virus replicons
Venezuelan equine encephalitis virus replicon encoding marburg virus proteins
Development of a preventive vaccine for filovirus infection in primates
peptides and immunogenic compositions containing same
Patent #: 7267823
Inventors
Assignee
ApplicationNo. 11545093 filed on 10/05/2006
US Classes:424/204.1 Virus or component thereof
ExaminersPrimary: Parkin, Jeffrey S
Attorney, Agent or Firm
Foreign Patent References
International ClassesA61K 39/12C12P 21/04
Description>INCORPORATION OF SEQUENCE LISTINGA sequence listing file in ST.25 format on CD-ROM is appended to this application and fully incorporated herein by reference. The sequence listing information recorded in computer readable form is identical to the written sequence listingherein (per WIPO ST.25 para. 39, the information recorded on the form is identical to the written sequence listing). With respect to the appended CD-ROM, the format is ISO 9660; the operating system compatibility is MS-Windows; the single filecontained on the CD-ROM is named "EBO.ADJ.03.ST25.txt" and is a text file produced by PatentIn 3.3 software; the file size in bytes is 63 KB; and the date of file creation is 2 Oct. 2006. BACKGROUND OF THE INVENTION 1. Technical Field The invention relates to protection against Filovirus induced hemorrhagic fevers using recombinant proteins. The invention, more specifically, concerns several recombinant Filovirus structural proteins produced from eukaryotic cells. In theinvention, proteins are post-translationally modified and are purified so that native structure is retained, thereby providing material for use as immunogens to elicit protection against virally induced disease. "Subunit protein" is defined here as any protein derived or expressed independently from the complete organism that it is derived from. Furthermore, a subunit protein may represent a full length native protein sequence or any fraction of thefull length native protein sequence. Additionally, a subunit protein may contain in addition to the full length or partial protein sequence, one or more sequences, which may contain sequences that are homologous or heterologous to the organism fromwhich the primary sequence was derived. This definition is significantly broader than the concept of a subunit protein as a single protein molecule that co-assembles with other protein molecules to form a multimeric or oligomeric protein. The subunitproteins of the invention are produced in a cellular production system by means of recombinant DNA methods and, after purification, are formulated in a vaccine. 2. Related Art Ebola and Marburg viruses are the only two members of the Filovirus family. They are enveloped, negative strand RNA viruses. The viral RNAs have a length of approximately 19 kb and their genome structure is 3'-NP-VP35-VP40-GP-VP30-VP24-L-5'. Upon entry into the cytoplasm of host cells, individual subgenomic, viral mRNA species are transcribed by viral RNA polymerase (RdRp). While the host cell synthesizes viral proteins in the cytoplasm, RNA dependent RNA polymerase (L) in complex with VP35replicates the complete Filovirus RNA. Viral RNA together with nucleoprotein NP and VP30 forms the nuclear core complex. The nuclear core is inserted into Filovirus envelopes formed by the viral matrix protein VP40 in combination with VP24 and matureviral surface glycoprotein (GP) anchored into the host cell membrane. A schematic diagram of a mature Filovirus particle is shown in FIG. 1. Marburg virus was first identified in an outbreak that occurred during 1967 in Marburg, Germany. The first human cases were animal handlers, and it was established that the source of infection were monkeys imported from Africa. For the next 9years there were no reported outbreaks of Filovirus induced hemorrhagic fevers. In 1976, the Zaire subtype of Ebola virus first appeared in an outbreak in the Democratic Republic of Congo (known then as Zaire). A second outbreak occurred in the sameyear in Sudan caused by the Sudan subtype which showed lower fatality rates. Later two more subtypes were identified, Ebola Ivory-Coast and Ebola Reston. To date a total of 18 Ebola virus outbreaks have caused 1860 cases of human disease and resultedin 1296 deaths. Six Marburg virus outbreaks have to date caused 613 human infections and were fatal in 494 cases (source: WHO). Case fatality rates are dependent on the specific subtype of Filovirus causing the disease and generally vary between50-90%, with Ebola Zaire and Marburg viruses showing the highest mortality rates. Primates are the only confirmed natural hosts for Filoviruses and human outbreaks can usually be traced back to contact with infected primates. Even though bats couldserve as a potential Marburg and Ebola virus reservoir based on observations and laboratory experiments (Swanepoel et al. 1996, Leroy et al. 2005), no natural reservoir has been confirmed to date (Feldmann et al 2004). Despite relatively few outbreaks, Ebola and Marburg viruses are well known due to their extreme virulence. Both viruses cause fulminant hemorrhagic fevers and death in up to 90% of human infections depending on the infecting strain and route ofinfection. Although the viruses are endemic only to certain parts of central Africa and the Philippines, the threat of a bioterrorist attack using Ebola virus has raised concern about the virus worldwide. Intentional exposure of non-human primates withaerosolized Ebola virus (Johnson et al. 1995) has demonstrated that a bioterrorist attack using Ebola or Marburg virus is feasible and could affect thousands of people. In outbreaks, it is believed that human-to-human spread only occurs upon directcontact with bodily fluids of an infected patient. However, it has been documented that an unintentional animal to animal infection was possible even without direct body contact of the individually caged rhesus monkeys (Jaax et al. 1995). In addition,recent revelations related to the efforts to produce weaponized Marburg virus in the former Soviet Union (Alibek 1999) reinforced the need to prioritize Ebola/Marburg viruses as a biodefense target. While state of the art medical treatment increases thechances of survival for patients, there are currently no antiviral therapies available to cure the disease, nor a vaccine that protects healthy individuals from infection. Supportive treatment is costly and resource demanding due to the need for strictcontainment. An Ebola or Marburg virus outbreak, especially in a densely populated urban area, whether caused by natural transmission or terrorist attack, could lead to many casualties and have a dramatic impact on public health systems. A safe andeffective vaccine or antiviral treatment that could be used to protect healthcare workers, other at-risk persons, and travelers is therefore highly desirable. The nucleotide sequence analysis of gene 4 of Marburg virus revealed the basic features of Filovirus surface glycoproteins (singular, "GP"; plural, "GPs") (Will et al. 1993). Filovirus GPs typically possess a hydrophobic signal peptide at theN-terminus, a hydrophilic external domain, a hydrophobic transmembrane anchor and a small hydrophilic cytoplasmic tail. The signal peptide is removed during the maturation of the glycoproteins and the external domain is heavily glycosylated, withcarbohydrates accounting for approximately 50% of the molecular weight of the mature protein. Most research on the biology of Filoviruses focuses on GP, a type I transmembrane glycoprotein. GP is involved in cell entry and is therefore presumed to be akey target for virus neutralization. The Filovirus glycoproteins, on the genomic as well as on the protein level, show strain specific features; Filoviruses can therefore be differentiated and identified based on GP structure. Further analysis of theproteins expressed in Ebola and Marburg virus-infected cells revealed that in addition to the mature GP, Ebola, but not Marburg, viruses express a soluble glycoprotein (sGP). This product results from early translation termination and lacks the majorityof the C-terminal region of mature GP (Volchkov et al. 1998). Since it lacks the transmembrane domain it is secreted as dimers into the extracellular space. GP and sGP are synthesized from the same gene. While sGP is synthesized from the direct mRNAtranscript, it was shown that the expression of mature GP requires post-transcriptional editing of the mRNA. Expression of the edited GP gene in mammalian cells results in trimerization and the formation of characteristic spikes on the cell surface. Incontrast, sGP is secreted as antiparallel-oriented homodimers stabilized by intermolecular disulfide bonds (Volchkova et al. 1998). An Ebola virus mutant was generated from cDNA that included the edited form of the GP gene (expressing mature GP only). This mutant showed a much higher cytotoxicity in comparison to wild-type Ebola virus, which is most likely linked to the much higher concentration of GP present in infected cells (Volchkov et al. 2001). The focus of the current application is onexpression of the native mature GP which is expected to form trimeric structures. Immune responses targeting the native structure are more likely to protect individuals from disease than responses targeting non-native (e.g., sGP) structures. After translation of the post-transcriptionally edited mRNA into the native (non-mutant) polypeptide, preGPer, in the endoplasmatic reticulum, the preGPer polypeptide is heavily glycosylated to form preGP. Furin cleavage separatespreGP into two mature subunits, GP1 and GP2, which are linked by an intermolecular disulfide bond (Volchkov et al. 1998). Mutational analysis revealed that inter- and intramolecular disulfide bonding is highly conserved and important for virus entry. Jeffers et al. (2002) suggest that disulfide bonds play a more important role in formation of functional glycoprotein than the presence of N-linked glycosylations. A similar post-translational cleavage into GP1 and GP2 is also observed on Marburg virusGP (Volchkov et al. 2000). A summary of the different pathways of Filovirus GP synthesis can be found in Feldmann et al. 2001. The surface glycoproteins, i.e., the GPs, may contribute to the cytopathic effects observed in Filovirus infections via a variety of direct and indirect mechanisms. It has been shown that mature Ebola GP alone induces cellular detachment incell cultures without inducing cell death (Chan et al. 2000). This is in contrast to sGP or GP1 which do not induce cellular detachment. Interestingly, Marburg virus GP does not induce similar detachment. Further characterization of the cytopathicityof GP identified that cell detachment was dependent on dynamin (Sullivan et al., 2005). It has also been shown that native mature GP can trigger activation of primary human macrophages resulting in production of proinflammatory cytokines (Wahl-Jensen etal. 2005). As Filovirus disease is often associated with overproduction of cytokines, this represents a possible mechanism for direct cytopathic effect (see further discussion of pathogenesis of Filovirus disease below). Again, this activity wasassociated with native, mature GP (trimeric form) and not GP1 and sGP. Furthermore, GP may contribute to the severe pathogenicity of Filovirus infection via indirect mechanisms (e.g., by inhibiting a potent protective immune response to the virus). Ithas been demonstrated that GP can decrease cell surface expression of MHC class I molecules (Sullivan et al., 2005). This may result in decreased immune responses upon infection. In addition, secretion of sGP as well as shedding of GP1 from virusinfected cells (Dolnik et al. 2004) may diminish the activity of neutralizing antibodies. The Filovirus surface glycoprotein is the only viral protein that is exclusively localized on the surface of the virus particles and possesses structural features to facilitate cell binding and fusion with the cell membrane. It was demonstratedthat Ebola GP binds to the cell surface exposed lectins DC-SIGN and DC-SIGNR (Simmons et al. 2003). These lectins are exposed on early infection target cells such as dendritic and other antigen presenting cells and binding of these molecules mayfacilitate fusion efficiency by changing GP's conformation. Work by Takada et al. (2004) further confirmed the enhancement of Filovirus cell entry caused by galactose- and N-acetylgalactosamine specific C-type lectins (hMGL) present on these earlytarget cells. The role of GP1 in cell surface receptor-binding has been suggested. Extensive mutational analysis has identified the N-terminal third of GP1 as the region most important for this first step of viral entry (Manicassamy et al. 2005). Sequence analysis of GP2 revealed the presence of a putative fusion domain (Volchkov et al. 1992). Ruiz-Arguello et al. (1998) demonstrated in vitro that the putative fusion peptide possesses liposome-binding capability. Mutational analysis usingpseudotyped vesicular stomatitis viruses confirmed these findings, suggesting that the fusion process of Ebola virus might mirror that of influenza or human immunodeficiency viruses (Ito et al. 1999). A model was developed based on the hydrophobicity ofthe fusion peptide and tested in vitro; the testing confirmed that the fusion peptide spans residues 25 to 35 of the GP2 protein (Adam et al. 2004). Gomara et al. (2004) demonstrated further that an internal proline residue in the fusion peptide isresponsible for the necessary membrane destabilization to initiate the fusion process. GP2 assembles into a rod-like trimeric structure which resembles that of other viral membrane-fusion proteins such as HIV gp41 or influenza HA2 (Weissenhorn et al.1998). The crystal structure revealed that an internal GP2 fragment forms a trimer with a central three-stranded coiled coil structure surrounded by shorter C-terminal helices packed in an antiparallel conformation into hydrophobic grooves on thesurface of the coiled coils (Malashkevich et al. 1999). Further functional analysis of the coiled-coil interactions revealed their importance in facilitating the entry of Ebola virus into host cells and demonstrated that inhibitors of this interactioncould act as efficient antiviral compounds. Thus, in a mature, wild-type GP, the GP2 portion of GP is likely involved in trimerization and fusion, while the GP1 portion is likely involved in binding to the cellular receptors and facilitating entry intotarget cells. To date no effective antiviral treatment against Filoviruses is available. Bray (2003) provides a comprehensive review of methods to defend against the use of Filoviruses as biological weapons. In another publication, Geisbert and Jahrling(2004) report the current status of progress towards protection against viral hemorrhagic fevers in general. In addition to immunotherapeutics and antivirals, the publication discusses several potentially supportive interventions targeting the hostimmune system. Potent antiviral compounds could either target virus proteins or host proteins required for appropriate virus protein processing during the viral lifecycle. The surface glycoprotein GP is a prime antiviral target because of itsinvolvement in host cell entry. DC-SIGN binding can effectively be inhibited with hyperbranched dendritic polymers functionalized with mannose (Rojo and Delgado 2004). Another potential antiviral drug, cyanovirin-N, also exploits the DC-SIGN bindingactivity of GP and shows activity inhibiting GP-pseudotyped lentivirus entry into HeLa cells (Barrientos et al. 2004c). Another study demonstrated that monomeric as well as dimeric cyanovirin-N show approximately the same antiviral activity (Barrientoset al. 2004b). The importance of endosomal proteolysis by cathepsin B and L for Ebola virus entry was demonstrated by Chandran et al. (2005) and further confirmed by Schornberg et al. (2006). This suggests that cathepsin inhibitors may show activity asanti-Ebola virus drugs. Filovirus matrix proteins (VP40) possess the general characteristic functionality of virus matrix proteins, although they show only 2-7% sequence identity to matrix proteins of other virus families (Paramyxoviridae, Rhabdoviridae, Bornaviridae). The late domain sequences important for virus budding are some of the few structurally conserved features present on the proteins of different virus families (Timmins et al. 2004). The crystal structure of a truncated Ebola virus VP40 protein (Dessen etal. 2000) revealed that it consists of two domains with unique folds connected by a flexible linker. At the beginning of the second domain is a trypsin-cleavage site after amino acid 212. The N-terminal cleavage fragment shows spontaneoushexamerization in vitro (Ruigrok et al. 2000). The N-terminal domain of VP40 is involved in the protein-protein interactions required for oligomerization while the C-terminal part is responsible for membrane-binding properties. Denaturing conditions(such as 4M urea) or membrane association induce hexamer formation of full-length VP40 (Scianimanico et al. 2000). VP40-hexamers formed from three antiparallel homodimers line the inside of Filovirus particles. On electron micrographs of Ebola virusVP40 oligomers hexameric and octameric structures were identified (Timmins et al. 2003). The disc-shaped octamers are formed in association with RNA by four antiparallel homodimers of Ebola VP40. The crystal structure revealed that the interaction withRNA induces two conformational changes of the protein (Gomis-Ruth et al. 2003). In contrast to Ebola virus VP40, the Marburg virus matrix protein forms oligomers that stack up to form complex polymeric structures. Therefore the oligomeric status couldnot be determined by electron microscopy. In addition to the in vitro characterization of VP40, the cellular mechanisms involved in Filovirus budding from mammalian cells have been studied. Timmins et al. (2001) demonstrated that full-length Ebola VP40, but not the C-terminallytruncated protein, is released into the culture supernatant of mammalian cells and that the matrix protein seems to be released inside vesicles. The expression of VP40 alone leads to secretion of few Filovirus-like particles, but co-expression with GPincreases the formation of these structures (Noda et al. 2002, Kolesnikova et al. 2004b). Panchal et al. 2003 demonstrated in vivo that oligomers of full length Ebola VP40 are formed only in association with membranes. These oligomers seem to betransported via lipid rafts to the site of assembly. It was also shown that VP40 recruits the cellular protein Tsg101 via specific interaction with an intrinsic late budding domain (PTAP) (Licata et al. 2003). Tsg101 is involved in the vacuolar sortingpathway of mammalian cells and is important for efficient budding of numerous viruses. In addition, hexamers of VP40 can bind to the WW domain of human Nedd4, another protein involved in the late endosomal pathway necessary for efficient virus budding(Timmins et al. 2003). It was demonstrated by Yasuda et al. (2003) that Nedd4 regulates the egress of Ebola virus-like particles from mammalian cells. Despite only 29% sequence homology to the Ebola matrix protein, Marburg virus VP40 protein alsoassociates with membranes of the late endosomal compartment both in virus-infected cells as well as in recombinant expression in mammalian cells (Kolesnikova et al. 2002, Kolesnikova et al. 2004a). While the Tsg101-binding PTAP motif is absent fromMarburg virus VP40, the PPXY motif for binding of Nedd4 (Yasuda et al., 2003) is found in Marburg virus and may also to be important for efficient budding. Ebola virus VP40 shows the properties of a microtubule-associate protein (MAP) because of itsbinding to tubulin. It enhances tubulin polymerization in vitro (Ruthel et al. 2005). It further stabilizes microtubules against depolymerization and could therefore play a role in directed transport of virus particles to the site of budding Reviews describing the current knowledge of the impact of VP40 on molecular mechanisms involved in Filovirus cellular trafficking (Aman et al 2003) and the current understanding of the process of Filovirus budding (Jasenosky and Kawaoka 2004)have been published. The nucleoprotein (NP) of Marburg virus self-assembles tubule-like structures when recombinantly expressed in mammalian cells. These aggregates resemble structures observed in sections of viral inclusions of Marburg virus infected cells(Kolesnikova et al. 2000). In association with cellular RNA (when expressed in Sf21 cells), Marburg virus NP forms regularly structured loose coils (Mavrakis et al. 2002). High salt treatment tightens the coiling. Ebola virus NP expressedrecombinantly in mammalian cells forms intact nucleocapsids only if expressed in combination with Ebola VP35 and VP24 (Huang et al. 2002). Other virus proteins are not necessary for nucleocapsid formation, but post-translational O-glycosylation of NP isrequired to facilitate VP35-binding. NP increases the release of Ebola virus-like particles if co-expressed with VP40 in mammalian cells. Further addition of Ebola GP potentiates this effect (Licata et al. 2004). The structure and function of the minor matrix protein VP24 are not fully understood. While co-expression of VP24 and VP40 in mammalian cells does not increase VLP release, co-expression of VP40, NP and VP24 in mammalian cells yields a higheramount of Ebola VLPs than co-expression of VP40 and NP alone, suggesting that VP24 may interact with NP (Licata et al. 2004). In cells infected with Ebola virus, as well as upon recombinant expression, VP24 appears to be concentrated in the perinuclearregion (Han et al. 2003). VP24 from virus infected mammalian cells is not glycosylated via N-linked sugar residues and appears to tetramerize. Studies have further shown that VP24 strongly interacts with lipid bilayers and is potentially located withinlipid rafts. Recent studies have shown that VP24 is essential for the formation of a functional ribonucleoprotein complex (Hoenen et al. 2006). In addition, it has been shown that VP24 seems to block proper IFN signaling giving another potentialexplanation of how Filoviruses evade the host immune responses (Reid et al. 2006). The two small proteins contained in the nucleocapsid complex have different functions. VP35 is an essential part of the Filovirus nucleocapsid (Huang et al. 2002, Muhlberger et al. 1998) but the exact role in capsid assembly has not been shownyet. VP35 is a type I IFN antagonist and therefore a major contributor to Filovirus pathogenicity (Basler et al. 2003, Hartman et al. 2004). The role of the phosphoprotein VP30 is linked to transcription activation of the nucleocapsid complex. It wasshown that phosphorylation on two serine residues (40 and 42) is essential for binding to NP and therefore inclusion into the nuclear core complex (Modrof et al. 2001). Phosphorylation negatively regulates transcription activation mediated by VP30 andphosphorylase inhibition can therefore inhibit Ebola virus growth (Modrof et al. 2002). It was further shown that the effect of VP30 seems to be directed at a very early step in transcription initiation (Weik et al. 2002). VP30 oligomerizes due to aninternal cluster of hydrophobic residues (containing four leucine residues). Mutation of the leucine residues or application of a peptide binding to this region abolishes VP30-dependent Ebola virus transcription activation (Hartlieb et al. 2003). The pathogenesis of Ebola virus infection is still not fully understood, even though progress towards understanding the mechanisms has been made in recent years. One finding with most hemorrhagic fever cases caused by Filoviruses is thatlesions caused by the viral infection are not severe enough to account for terminal shock and death of the host. Yet this is the most common cause of death in viral hemorrhagic fevers. This suggests the involvement of inflammatory mediators as animportant part in the pathogenic pathways. A simplified primate model (Sullivan et al. 2003b) suggests that initial host immune responses as well as cell damage due to infection of monocytes and macrophages causes the release of pro-inflammatorycytokines. Infection of endothelial cells causes damage to the endothelial barrier which in combination with effects of the cytokines leads to loss in vascular integrity resulting in hemorrhage and vasomotor collapse (primary cause of death in Ebolapatients). Another model further elaborates on the detailed chain of events (Geisbert and Jahrling. 2004). The authors suggest that cytokines released by initially infected monocytes and macrophages recruit further macrophages to the sites ofinfection. This makes more target cells available for viral exploitation and further amplifies the dysregulated host response, leading to loss of lymphocytes by apoptosis. Ebola virus enhances expression of tissue factor, resulting in activation of theclotting pathway and formation of fibrin in the vasculature. These coagulation disorders are complemented by infection of hepatocytes and adrenal cortical cells resulting in impaired synthesis of important clotting factors. Studies of human Ebola Sudanpatients showed leucopenia and unresponsive PBMC's, high viral loads in infected monocytes and elevated nitric oxide levels to be associated with a fatal outcome of the disease (Sanchez et al. 2004). Primates are the only animals known to develop disease following natural infection with Filoviruses. However, in order to research virus biology, several animal models of disease have been developed, including a non-human primate model, guineapig models, and a mouse model for Ebola virus infection using a mouse-adapted Ebola Zaire virus. Fisher-Hoch and McCormick (1999) describe several of these animal models and a publication by Ryabchikova et al. (1999) reviews animal pathology ofFiloviral infections in more detail. Animal models have been used to develop the current pathogenesis model based on in vitro experiments using primate monocyte/macrophage cultures (Feldmann et al. 1996, Stroher et al. 2001) as well as in vivoexperiments comparing the coagulation changes in mice, guinea pigs, and monkeys (Bray et al. 2001). While small animal models can provide insight into the virus life cycle and pathogenicity and help as an economical choice for vaccine and antiviral drugdevelopment, only non-human primates show a disease progression similar to human disease (Geisbert et al. 2002). Pathogenesis in the cynomolgus macaque model of Ebola Hemorrhagic Fever has been described in detail by Geisbert et al. (2003). Since there is no treatment to cure Filovirus induced hemorrhagic fevers, the majority of patients succumb to the disease. However, between 10 to 50% (depending on virus strain and medical support available) of infected humans survive thedisease. Following the large 1995 outbreak of Ebola Zaire in the Democratic Republic of Congo, sera of patients were analyzed. It was found that while IgM and IgG antibodies appeared at approximately the same time after onset of disease, high IgMtiters persisted for a much shorter time in survivors in comparison to fatal cases (Ksiazek et al. 1999). IgG titers in survivors were detectable for at least two years following recovery. Ebola virus patients receiving convalescent sera during theirillness have been reported to show a higher survival rate (Mupapa et al. 1999). Based on this observation, immune mouse sera from mice receiving sub-lethal doses of Ebola virus were transferred to naive immunodeficient mice. Dose-dependent protectionagainst virus challenge was observed in recipients of immune sera (Gupta et al 2001). Recombinant human monoclonal antibodies were constructed via phage display from bone marrow RNA of two Ebola survivors (Maruyama et al. 1999) and in vitro virusneutralization was demonstrated with one of these antibodies (Maruyama et al. 1999b). The same human monoclonal antibody was able to provide pre- and post-exposure prophylaxis in the guinea pig model of Ebola hemorrhagic fever (Parren et al. 2002). Similarly, mouse monoclonal antibodies to Ebola GP applied pre- or post-exposure were successful to protect mice against lethal Ebola virus challenge (Wilson et al. 2000). Another route to provide antibody-based protection against viral diseases is thepreparation of hyperimmune serum in non-susceptible animals. Sera prepared in sheep and goats tested successfully for protection in the guinea pig model of Ebola virus (Kudoyarova-Zubavichene et al. 1999). A similarly prepared equine anti-Ebola Zaireserum was tested for protection in baboons, mice and guinea pigs. Results were inconsistent and showed low levels of protection in mice and monkeys, while all guinea pigs were protected against a lethal dose of Ebola virus. While viremia and diseaseonset in cynomolgus monkeys treated with the equine hyperimmune serum challenged with Ebola virus was delayed, all animals succumbed to the disease when protective antibodies had been depleted (Jahrling et al. 1996, Jahrling et al. 1999). One potentialreason for the failure of passive immunizations in non-human primates could be antibody-dependent enhancement of infection (as demonstrated in vitro by Takada et al. 2003b). A further hurdle for the prophylactic or therapeutic use of neutralizingantibodies could be strain specificity. Out of five different neutralizing epitopes that have been identified on Ebola Zaire GP, none seems to have neutralizing activity against glycoproteins from the Sudan, Ivory Coast or Reston strains of Ebola virusor against the glycoprotein of Marburg virus (Takada et al. 2003). In contrast to the mostly dramatic symptomatic cases of Filovirus infections, asymptomatic cases have been reported (Leroy et al. 2000). In only a few of these cases, specific antibody responses against Ebola virus proteins could be detected. Interestingly, the responses were directed against NP as well as VP40, and not against Filovirus glycoprotein, which is thought to be the main protective antigen and the target for virus neutralizing antibodies. The asymptomatic individuals furthermoreshowed early and strong inflammatory responses with high levels of circulating cytokines. These clinical parameters emphasize the importance of proper humoral and cell-mediated immunity in protection against Filovirus infection. Induction of cytotoxicT cells directed against GP was observed upon immunization of mice with liposome-encapsulated irradiated Ebola virus particles (Rao et al. 1999). Responses seem to be dependent on proper delivery of antigen to antigen presenting cells (APC). It wasfurther demonstrated that the liposome-encapsulated virus particles can induce T cell help necessary to protect mice against lethal challenge (Rao et al. 2002). However, the same vaccine did not provide good protection in a primate model. Another studyreports the generation of protective cytotoxic T lymphocytes after 2 or 3 immunizations with recombinant VEE replicons expressing Ebola NP (Wilson and Hart 2001). Even though the cellular response achieved did not yield 100% protection in the mousemodel, it provides evidence that proper cellular responses will aid in protection. Identification of CTL epitopes on the nucleoprotein may lead to the discovery of potential defense mechanisms (Simmons et al. 2004). Another experiment in the mousemodel demonstrated that cytotoxic memory T cells alone can protect against death, but that a persistent infection can develop if mice are deficient in helper T-cells or mount an insufficient humoral response (Gupta et al. 2004). This suggests apotential mechanism for development of a natural reservoir host animal for Filoviruses. One of the characteristic features of Filovirus disease in infected primates is the rapid decline in the number of circulating lymphocytes. It was shown that Ebola virus induces apoptosis in natural killer cell populations by day twopost-infection (Reed et al. 2004). It may therefore inhibit activation of lymphocytes by eliminating the subsets that are most likely to be capable of mounting an effective response to the virus. The viral component responsible for this has not beenidentified yet, although Ebola virus immune suppression seems to be linked to a domain of the surface glycoprotein and/or the VP35 protein. Studies with Ebola and Marburg virus-like particles containing GP and VP40 (Bosio et al. 2004) demonstratedactivation of human myeloid dendritic cells. In contrast, administration of live or inactivated Ebola virus does not induce dendritic cell maturation. Other virus proteins not contained in the recombinant particles may be responsible for preventingthis early immune response. Particles containing only the viral matrix protein VP40 were able to specifically activate natural killer cells and induce an early protective immunity against Ebola virus infection 1-3 days after immunization (Warfield etal. 2004). It was shown that the protection was mediated by perforin-mediated lysis of target cells by NK cells. This highlights another pathway that may be critical to provide successful protection against Filovirus infection. Conventional vaccine approaches against Filovirus infection, such as attenuated or killed Filovirus particles are not generally considered feasible due to the high safety risks involved. Demonstration of proper attenuation of live viral strainsin humans would be much too risky to consider and the risk of reversion would further complicate this approach. For example, a serendipitously acquired virus strain which had proven to be nonlethal to strain 13 guinea pigs proved to be lethal to Hartleyguinea pigs (Hevey et al. 2002). Production of large quantities of virus to generate a killed vaccine would likewise be unacceptable from a safety point of view. Instead, several modem vaccine approaches have been the major area of research. Approaches evaluated or under evaluation include DNA vaccines, adeno-, alpha- or vesicular stomatitis virus vectored vaccines, and recombinantly produced proteins. Summarizing overviews of the advances in developing vaccines to protect against Filovirusinduced hemorrhagic fevers were published in several review papers (Enserink 2003, Hart 2003, Geisbert and Jahrling 2004). Xu et al. (1998) reported successful protection of guinea pigs against Ebola virus infection after injecting animals with 3 doses of DNA vaccines expressing either Ebola surface glycoprotein, the soluble glycoprotein sGP, or the nucleoprotein. A similar approach (Vanderzanden et al. 1998) reported successful protection of mice against Ebola virus infection after gene gun application of 4 or 5 doses of DNA vaccines encoding Ebola GP or NP. Protection of non-human primates against Ebola virusinfection has been demonstrated after immunization with three doses of a combination of DNA vaccines followed by a boost utilizing a recombinant adenovirus vector expressing Ebola Zaire GP (Sullivan et al. 2000). The Vaccine Research Center at NIH iscurrently developing a prime-boost vaccine for human use based on this approach. It has further been shown that a single dose of the recombinant adenovirus can elicit a protective response against Ebola virus challenge four weeks after immunization(Sullivan et al. 2003). Data provided by these immunological studies strongly suggest the importance of Ebola GP in development and persistence of vaccine protection (Sullivan et al. 2003b). DNA vaccines need to be applied many times in order to raiseeffective immune responses. They could potentially lead to the development of autoimmune diseases and the use of strong promoters contained in the used plasmids may present a safety risk in human application. Recombinant adenoviruses may not beefficacious as vaccines on individuals with pre-existing immunity to adenoviruses and can for the same reason only be applied once. Due to safety concerns, development of adenoviral vectors for gene therapy and vaccine development has slowed in pastyears. In a clinical trial using adenovirus vectors for gene therapy, a patient died due to complications associated with the use of Ad5 virus (Raper et al. 2003). Another approach for vaccine development focused on the use of alphavirus (VEE) replicons. Using vectors expressing several Marburg virus structural proteins, Hevey et al. (1998) were able to demonstrate that guinea pigs developed high specificserum antibody titers and could be protected if Marburg GP, NP or VP35 proteins were applied. Marburg virus VP40, VP30 or VP24 did not protect against viral challenge. Analogous vectors expressing Ebola virus GP, NP, VP24, VP30 or VP40 (Wilson et al2001, Pushko et al. 2001) showed a significant level of protection against homologous challenge in vaccinated mice and guinea pigs. Passive transfer of immune sera was unsuccessful in providing protection against disease. Recently a new vaccine approach has been tested utilizing replication-competent vesicular stomatitis virus vectors expressing surface and secreted glycoproteins of Ebola Zaire and Marburg viruses. A VSV vector expressing Ebola surface GPprotected mice against lethal challenge (Garbutt et al. 2004). Further studies showed protection against homologous (but not heterologous) Filovirus challenge in guinea pigs and cynomolgus monkeys (Jones et al. 2005). Daddario-DiCaprio et al. (2006)showed that this vaccine may even provide post-exposure protection if administered at a high dose within 20-30 minutes after infection. Virus-like particles based on recombinant proteins expressed in mammalian cell lines have been evaluated for their potential as protective vaccines against Filovirus infections. Particles containing Ebola GP and VP40 have shown to be moresuccessful in protecting mice against lethal Ebola virus challenge than inactivated virus particles (Warfield et al. 2003). This indicates that virus inactivation may destroy necessary native structural features on the contained virus proteins. It wasfurther demonstrated that Marburg virus-like particles constructed using Marburg virus GP and VP40 successfully induced protection against Marburg virus infection in guinea pigs, while Ebola VLPs were not protective against Marburg virus challenge(Warfield et al. 2004). Only a vaccine containing both Marburg and Ebola virus-like particles was able elicit protection against challenge with both types of Filoviruses in the guinea pig model (Swenson et al. 2005) demonstrating a lack ofcross-protection between Filoviruses. Marburg virus GP was expressed by baculovirus recombinants in Sf9 and Trichoplusia ni cells as full-length or truncated version without the transmembrane region. Culture supernatants formulated with Ribi adjuvant (Jennings, V. M. Review ofSelected Adjuvants Used in Antibody Production. ILARJ 37:119-125. 1995) were utilized to immunize guinea pigs. Protection was achieved only against the homologous Marburg virus strain (Hevey et al. 1997). It was furthermore demonstrated that passivetransfer of immune sera conferred protection to naive guinea pigs. Baculovirus expressed full length or truncated Ebola GP was administered to guinea pigs alone (2 doses) or in a prime-boost scheme following one dose of a DNA vaccine. Prime-boost andthe protein-only vaccines (applied with adjuvant) induced protective immunity in less than 50% of the animals (Mellquist-Riemenschneider et al. 2003). An article published by Hevey et al. 2002 compared the protection in guinea pigs provided by several Marburg virus GP-based vaccine strategies. Approaches included a DNA vaccine, VEE-replicons, baculovirus expressed recombinant GP or aprime-boost approach combining DNA vaccine and recombinant protein. The study suggested that DNA vaccines and replicon-based vaccines were particularly interesting. Hart (2003) cautions that it may be dangerous to focus a vaccine approach solely on thesurface glycoproteins. Certain individuals may not develop the desired T-cell responses to GP and may therefore not be protected. Adjuvants are materials that increase the immune response to a given antigen. Since the first report of such an enhanced immunogenic effect by materials added to an antigen (Ramon, G., Bull. Soc. Centr. Med. Vet. (1925) 101:227-234), alarge number of adjuvants have been developed, but only calcium and aluminum salts are currently licensed in the United States for use in human vaccine products. Numerous studies have demonstrated that other adjuvants are significantly more efficaciousfor inducing both humoral and cellular immune responses. However, most of these have significant toxicities or side-effects which make them unacceptable for human and veterinary vaccines. In fact, even aluminum hydroxide has recently been associatedwith the development of injection site granulomas in animals, raising safety concerns about its use. Because of these problems, significant efforts have been invested in developing highly potent, but relatively non-toxic adjuvants. A number of suchadjuvant formulations have been developed and show significant promise (Cox, J. C. and Coulter, A. R., Vaccine (1997) 15:248-256; Gupta, R. K. and Siber, G. R., Vaccine (1995) 13:1263-1276), especially in combination with recombinant products. Severalof these modern adjuvants are being tested in preclinical and clinical trials designed to examine both efficacy and safety. The main modes of action of adjuvants include (i) a depot effect, (ii) direct immunomodulation through interaction with receptors, etc., on the surface of immune cells and (iii) targeting antigens for delivery into specific antigen-presentingcell populations (e.g., through the formation of liposomes or virosomes). The depot effect results from either the adsorption of protein antigens onto aluminum gels or the emulsification of aqueous antigens in emulsions. In either case this results inthe subsequent slow release of these antigens into the circulation from local sites of deposition. This prevents the rapid loss of most of the antigen that would occur by passage of the circulating antigen through the liver. Immunomodulation involvesstimulation of the "innate" immune system through interaction of particular adjuvants with cells such as monocytes/macrophages or natural killer (NK) cells. These cells become activated and elaborate proinflammatory cytokines such as TNF-α andIFN-γ, which in turn stimulate T lymphocytes and activate the "adaptive" immune system. Bacterial cell products, such as lipopolysaccharides, cell wall derived material, DNA, or oligonucleotides often function in this manner (Krieg, A. M. et al.,Nature (1995) 374:546; Ballas, Z, J, et al., J. of Immunology (2001) 167:4878-4886; Chu, R. S., et al., J. Exp. Med. (1997) 186:1623; Hartmann, G. and Krieg, A., J. Immunol. (2000) 164:944-952; Hartmann, G., et al., J. of Immunol. (2000)164:1617-1624; Weeratna, R. D. et al., Vaccine (2000) 18:1755-1762; U.S. Pat. Nos. 5,663,153; 5,723,335; 6,194,388; 6,207,646; 6,214,806; 6,218,371; 6,239,116; 6,339,068; 6,406,705; 6,429,199). Targeting of antigens to (and within) antigen presentingcells is accomplished through the delivery and fusion of antigen bearing vehicles (e.g., liposomes or virosomes) with antigen presenting cells, thereby delivering the antigen into the intracellular pathways necessary for presentation of antigen in thecontext of MHC Class I and/or II molecules (Leserman, L., J. Liposome Res. (2004) 14:175-89; Bungener et al., Vaccine (2005) 23:1232-41). In addition to these more traditional adjuvants, various new technologies are under development. One of them includes the use of dipeptidyl peptidases, which have shown promising results in human cancer therapy. The biological activity ofdipeptidyl peptidases may reflect adjuvant-like properties (e.g. generating cytokine and chemokine production), as shown in preclinical animal models in response to their administration. These responses are believed to enhance both antigen-presentationto naive T-cells and the co-stimulation of antigen-specific T-cells. The use of adjuvants in combination with recombinant antigens is widely known in the art and can result in vaccines with better efficacy. Thus, there is an unmet need for vaccines against Filoviruses. A key technical problem to be solved is the efficient production of conformationally relevant Filovirus surface glycoproteins, as well as additional structural proteins, that serveas potent immunogens in vaccinated subjects. Related technical problems are the production and formulation of effective vaccines that have improved costs of production and distribution. SUMMARY OF THE INVENTION The inventors have identified unique combinations of antigens and adjuvants that induce relevant protective immune responses and have shown an acceptable safety profile in vaccinated individuals. These unique formulations depend upon severalnovel, properly folded recombinant subunit proteins (Filovirus GP, VP40, VP24 or NP) combined with one or more adjuvants, such as saponins, emulsions, and alum-based formulations. These antigen/adjuvant combinations (1) induce or enhance relevant,protective immune responses, such as protein specific antibody and cell mediated responses, and (2) maintain an acceptable safety profile. The disclosed invention provides immunogenic compositions containing as active ingredients recombinantly-producedFilovirus glycoprotein(s), and optionally, additional structural virus proteins. A preferred embodiment of the disclosed invention comprises the recombinant truncated surface glycoprotein of one or more Ebola or Marburg viruses as active ingredients. Apreferred embodiment of the disclosed invention alternatively includes a full-length Filovirus surface glycoprotein and/or several other structural Filovirus proteins. A preferred embodiment of the disclosed invention also includes an adjuvant, such asa saponin or a saponin-like material (e.g., GPI-0100, ISCOMATRIX.RTM.), alum-based formulations (e.g., Alhydrogel.RTM.), or emulsion-based formulations (e.g., ISA-51, Co-Vaccine HT, Ribi R-700), either alone or in combination with other immunostimulantsand adjuvants, as a component of the immunogenic formulations described herein. Typically, the disclosed immunogenic formulations are capable of eliciting the production of antibodies against Filoviruses, for example Ebola Zaire, and stimulatingcell-mediated immune responses. Other aspects of this invention include use of a therapeutically effective amount of the immunogenic composition in an acceptable carrier for use as an immunoprophylactic against Filovirus infection and a therapeutically effective amount of theimmunogenic composition in an acceptable carrier as a pharmaceutical composition. BRIEF DESCRIPTION OF THE DRAWINGS FIG. 1 shows a schematic structure of Ebola virus particle. FIG. 2 shows a Sodium Dodecyl Sulfate Polyacrylamide Gel electrophoresis (SDS-PAGE) panel demonstrating expression and secretion of Ebola Zaire GP95, VP40 and VP24 proteins. Loading of gel: Lanes 1, 6 and 11--prestained broad range proteinmarker showing molecular weights in kDa (NEB); Lanes 2-4--each loaded with 10 μl of 3 different culture supernatants from a VP40 expression line (reducing sample buffer); Lanes 7-9--each loaded with 10 μl of 3 different culture supernatants from aVP24 expression line (non reducing); lanes 13-15--each loaded with 10 μl of 3 different culture supernatants from GP95 expression line (non reducing conditions). FIG. 3 shows an SDS-PAGE panel demonstrating Immunoaffinity Chromatography (IAC) purified Ebola Zaire GP95 under reducing and non-reducing conditions. Sample loading on 10% Coomassie stained SDS-PAGE gel: (1) prestained broad range molecularweight marker with molecular weights in kDa (NEB; www.neb.com); (2) 1 μg GP95, reducing conditions; (3+9) 1 μg GP95, PNGase treated to remove N-linked glycosylations, reducing conditions; (4+10) 1 μg GP95, fully deglycosylated, reducingconditions; (5 and 6) fetuin as control to verify proper enzymatic deglycosylation; (8) 1 μg GP95, non-reducing conditions. A: identifies band of GP95, B: shows GP1 region, C: identifies location of deglycosylated GP1, D: GP2 (2 or more bands), E:deglycosylated GP2. FIG. 4 shows an SDS-PAGE panel demonstrating IAC purified Ebola Zaire VP40 under reducing and non-reducing Conditions. Sample loading on silver-stained 12% SDS-PAGE gel (1 μg VP40 loaded per lane): (1) Mark12 (Invitrogen Corp.)--molecularweights in kDa, (2) VP40 (lot #588-161) reduced, (3) VP40 (lot #609-73) reduced, (4) VP40 (lot #619-23) reduced, (5) VP40 (lot #588-161) not reduced, (6) VP40 (lot #609-73) not reduced, (7) VP40 (lot #169-23) not reduced. FIG. 5 shows an SDS-PAGE panel demonstrating IAC purified Ebola Zaire VP24 under reducing and non-reducing conditions. VP24 is expressed by S2 cells in three glycoforms (mono-, di- and tri-glycosylated) which co-purify on the IAC column. Thelanes have been loaded with Mark12 (protein marker from Invitrogen Corp.)--molecular weights in kDa, (1)=1.0 μg final purified VP24 and (2)=0.1 μg final purified VP24. FIG. 6 shows an SDS-PAGE panel demonstrating reactivity of individual recombinant Ebola Zaire virus proteins with Ebola specific hyperimmune mouse ascites fluid (HMAF). FIG. 6 is a Western blot of 12% SDS-PAGE gel with following loadingpattern: Lane 1--prestained broad range protein marker (NEB)--molecular weights in kDa; Lanes 2, 4, 5--each loaded with 10 μl of 3 different culture supernatants from VP40 expression line (reducing conditions), lane 3: PNGase treated supernatant fromVP40 expression line (reducing conditions); Lane 6: loaded with 10 μl of culture supernatant from GP95 expression line (non reducing conditions); Lane 7: loaded with 10 μl of PNGase treated supernatant from GP95 expression line (reducingconditions); Lanes 8, 9, 10: each loaded with 10 μl of 3 different culture supernatants from GP95 expression line (non reducing), lanes 11, 13 and 14--each loaded with 10 μl of 3 different culture supernatants from VP24 expression line, lane 12:PNGase treated supernatant from VP24 expression line (non reducing conditions). Western blot was probed with anti-Ebola HMAF (reactive against ZEBOV, SEBOV, REBOV). FIG. 7 shows an SDS-PAGE panel demonstrating the reactivity of individual recombinant proteins with a VP40-specific monoclonal antibody. FIG. 7 is a Western blot of 12% SDS-PAGE gel with identical loading to FIG. 6, but probed with A10A (bindsto ZEBOV VP40)--which antibody binds to glycosylated and non-glycosylated proteins, and also reacts with VP40 dimers. FIG. 8 shows an SDS-PAGE panel demonstrating the reactivity of individual recombinant proteins with a GP-specific monoclonal antibody. FIG. 8 is a Western blot of 12% SDS-PAGE gel with identical loading to FIG. 6, but probed with theconformationally sensitive antibody 13C6 (reactive against ZEBOV GP). The antibody does not bind to the deglycosylated GP95 protein (see lane 7). FIG. 9 shows an SDS-PAGE panel demonstrating the reactivity of individual recombinant proteins with a VP24-specific monoclonal antibody. FIG. 9 is a Western blot of 12% SDS-PAGE gel with identical loading to FIG. 6, but probed with BG11(reactive against ZEBOV VP24)--which antibody binds to the three glycoforms as well as deglycosylated forms. FIG. 10 is a histograph showing induction of B Cell Memory in Balb/c Mice with recombinant Ebola Zaire GP95 and VP40. DESCRIPTION OF THE PREFERRED EMBODIMENTS The invention described herein provides subunit Filovirus immunogenic formulations that are produced using a recombinant expression system; the formulations typically include one or more adjuvants. The disclosed immunogenic formulations areeffective in inducing strong antibody responses directed against individual Filovirus proteins and intact Filovirus particles as well as stimulating cell-mediated immune responses to the viruses (see Examples 3 and 4). The inventors and their colleagues have successfully developed a method of expression in insect cell culture systems that produce recombinant structural proteins from Filoviruses such as Ebola Zaire, Ebola Sudan or Marburg virus. The surfaceglycoprotein is either expressed full length or in a truncated form, removing about 5% of the mature protein. The scope of the truncated proteins used in the invention includes any surface glycoprotein subunit secretable by the expression system. Thepreferred truncation deletes the membrane spanning portion (situated within the GP2 region, entailing approximately the carboxy-terminal 30 amino acids, thus allowing it to efficiently be secreted into the extracellular medium, facilitating recovery). "Expression" and "to express" are synonymous with "secretion" and "to secrete" as used herein. Cloning and expressing full length Filovirus GP is possible, but secretion is less efficient due to the membrane anchor. However, the membrane spanningdomain does not contain any known antigenic epitopes and inclusion of the membrane spanning domain reduces yields; therefore the membrane spanning domain and the cytosolic tail portions of GP are not included in the preferred antigen, a subunit, surfaceglycoprotein of Filoviruses described below and called "GP95". "Secretable" means able to be secreted, and typically secreted, from the transformed cells in the expression system. Furthermore, the expressed proteins have been shown to be properlyglycosylated and achieve native conformation as determined by reactivity with the conformationally sensitive monoclonal antibody, 13C6-1-1 ("13C6"; Wilson et al., 2000) (Example 2). The proteins are potent immunogens when administered in combinationwith modern adjuvants (Examples 3 and 4) and have been shown to induce protective efficacy in a small animal model for Ebola Hemorrhagic Fever (see Example 5 below). Thus the inventors have found a novel solution to a key technical problem: theefficient production of conformationally relevant Filovirus surface glycoproteins that serve as potent immunogens in vaccinated subjects. The invention also provides for the use of adjuvants as components in an immunogenic composition compatible with the purified proteins to boost the immune response resulting from vaccination. One or more preferred adjuvants are selected fromthe group comprising saponins (e.g., GPI-0100 (Hawaii Biotech, Inc., Aiea, Hawaii), ISCOMATRIX.RTM. (CSL Limited, Parkville, Victoria, Australia)) (saponin, saponin-derivative, and saponin-like substances are collectively referred to herein as"saponin-based"), alum-based adjuvants (e.g., Alhydrogel (Superfos Export Co., 15 Amaliegade, Copenhagen, Denmark), or emulsion-based adjuvants (e.g., Co-Vaccine HT (Co-Vaccine BV, Lelystad, Flevoland, Netherlands), Ribi R-700 (GlaxoSmithKline,Philadelphia, Pa.), Montanide ISA-51 (Seppic, Paris, France). Aluminum-based adjuvants (collectively, "alum" or "alum-based adjuvants") are aluminum hydroxide, aluminum phosphate, or a mixture thereof. Aluminum hydroxide (commercially available as"Alhydrogel.RTM.") was used as alum in the Examples. The antigens used in the disclosed immunogenic compositions typically comprise one or more truncated Filovirus surface glycoprotein subunits and may further contain additional structural virus protein subunits. For example, a preferredimmunogenic composition comprises one or more surface glycoprotein subunits (preferably GP95) expressed and secreted from insect cells, preferably Drosophila S2 cells. The surface glycoprotein subunit (i.e., truncated, secretable GP95 protein) from theEbola Zaire virus ("ZEBOV") is used in the prototype vaccine composition. Surface glycoproteins subunits from other Filoviruses, such as Marburg virus ("MARV"), e.g. of the Musoke, Angola or Popp strains, Ebola Sudan Virus ("SEBOV"), Ebola Ivory-CoastVirus ("ICEBOV") or Ebola Reston Virus ("REBOV") can be used as replacement or additional antigens in the disclosed invention. One or more optional recombinant Filovirus structural protein subunits can be included in the disclosed immunogenic composition. For example, one or more insect cell, preferably Drosophila Schneider 2 cell-expressed, structural protein subunits(preferably VP40, VP24, or NP), preferably from the homologous Filovirus, are included in some embodiments of the disclosed immunogenic compositions. Inclusion of such structural protein subunits typically results in exceptionally potent vaccineformulations. The combination of one or more viral subunit GP95, with or without other structural protein subunits, and optionally with one or more adjuvants, induces very high titer antibodies in mice. For example, certain combinations of a saponin-basedadjuvant, preferably GPI-0100, with a given recombinant antigen, yield a high titer of antibodies and cell-mediated immune responses. Examples illustrating the immunogenicity and protective efficacy of such novel combinations are disclosed below(Examples 3, 4 and 5). For C-terminally truncated protein subunits of the invention, the C-terminal truncation point can be varied up to plus or minus 2% of the length of the specified sequence length of a given protein so long as such variation does not affectsecretion of the protein and conformation of the epitopes of the secreted subunit protein. For instance, the specified length of the ZEBOV GP95 protein subunit is 617 residues, but the actual truncation point may range from approximately 605 residues to629 residues so long as such variation does not affect secretion of ZEBOV GP95 and conformation of the epitopes of the secreted ZEBOV GP95. Surface Glycoprotein Subunits (GP95) In a preferred embodiment of the invention, the recombinant protein subunits of the Filovirus vaccine formulations described herein are produced by a eukaryotic expression system, Drosophila melanogaster Schneider 2 ("Drosophila S2" or simply"S2") cells (Johansen, H. et al., Genes Dev. (1989) 3:882-889; Ivey-Hoyle, M., Curr. Opin. Biotechnol. (1991) 2:704-707; Culp, J. S., et al., Biotechnology (NY) (1991) 9:173-177). This method of expression successfully produces recombinant surfaceglycoproteins from Filoviruses, such as Ebola Zaire (ZEBOV). These proteins are truncated at the C-terminus, leaving approximately 95% of the mature surface glycoprotein (GP95) sequence. The truncation deletes the membrane spanning region of theprotein, thus allowing it to be efficiently secreted into the extracellular medium using a homologous or heterologous secretion signal, facilitating recovery. Alternatively, full-length GP (GP-FL) may be expressed using a homologous or heterologoussecretion signal. The expressed proteins (GP95 and GP-FL) have been shown to be properly glycosylated and to maintain native conformation as determined by reactivity with a conformationally sensitive monoclonal antibody (13C6, see Example 2). The aminoacid sequence listing of ZEBOV GP95 is SEQ ID: 1. The nucleotide sequence listing, including leading and trailing nucleotides (collectively, "bookends") used in cloning, that encodes ZEBOV GP95 is SEQ ID: 2. The nucleotide sequence listing, without"bookends" used in cloning, that encodes ZEBOV GP95 is SEQ ID: 3. The amino acid sequence listing of SEBOV GP95 is SEQ ID: 4. The nucleotide sequence listing, including leading and trailing nucleotides (collectively, "bookends") used in cloning, thatencodes SEBOV GP95 is SEQ ID: 5. The nucleotide sequence listing, without "bookends" used in cloning, that encodes SEBOV GP95 is SEQ ID: 6. The amino acid sequence listing of MARV GP95 is SEQ ID: 7. The nucleotide sequence listing, including leadingand trailing nucleotides (collectively, "bookends") used in cloning, that encodes MARV GP95 is SEQ ID: 8. The nucleotide sequence listing, without "bookends" used in cloning, that encodes MARV GP95 is SEQ ID: 9. The amino acid sequence listing of ZEBOVGP-FL is SEQ ID: 10. The nucleotide sequence listing, including leading and trailing nucleotides (collectively, "bookends") used in cloning, that encodes ZEBOV GP-FL is SEQ ID: 11. The nucleotide sequence listing, without "bookends" used in cloning,that encodes ZEBOV GP-FL is SEQ ID: 12. In another embodiment of the invention, GP95 is defined more broadly as a truncated surface glycoprotein that comprises two subunits (GP1 and GP2-95) that are linked via a disulfide bridge, wherein the polypeptide has been secreted as arecombinant protein from Drosophila cells, and wherein the polypeptide generates antibody responses to a homologous strain of a species of Filovirus. In another preferred embodiment, the surface glycoprotein subunit further comprises a hydrophilicity profile characteristic of at least a homologous 95% portion of a surface glycoprotein (GP) starting from the first amino acid at the N-terminusof the mature surface glycoprotein of a strain of a species of Filovirus. In other words, amino acids can be substituted in the sequence comprising GP-FL or GP95 so long as the hydrophilicity profile and immunogenicity are unchanged. The immunogenicity and protective efficacy of such GP proteins have also been demonstrated in an animal model (see Examples 3-5). "GP95" in one instance refers to a polypeptide that spans a Filovirus surface glycoprotein, preferably one starting from the N-terminal amino acid of the mature surface glycoprotein and ending at an amino acid in the range of the 647th to648th amino acid, for example, such GP95 can be the polypeptide comprising amino acids 33 to 647 of ZEBOV or SEBOV or amino acids 19 to 648 of MARV. "GP-FL" in one instance refers to a polypeptide that spans a Filovirus surface glycoprotein, preferably one starting from the N-terminal amino acid of the mature surface glycoprotein and ending at an amino acid in the range of the 676th to681st amino acid, for example, such GP-FL can be the polypeptide comprising amino acids 33 to 676 of ZEBOV or SEBOV or amino acids 19 to 681 of MARV. Preferably, the ZEBOV surface glycoprotein subunit is a portion of the ZEBOV surface glycoprotein that comprises approximately 95% of its length starting from amino acid residue 1 at its N-terminus and which portion has been recombinantlyproduced and secreted from Drosophila cells. In another embodiment, GP95 is at least 80%, or 85%, or 90%, or 95% homologous over the entire sequence relative to native Filovirus GP, or alternatively relative to the sequence listings disclosed in SEQ IDNOS: 1, 4, and 7, as the case may be, so long as such variation from native Filovirus GP, or SEQ ID NOS:1, 4, and 7, respectively, does not affect secretion of the GP95 subunit and conformation of the epitopes of the secreted GP95 subunit. In another embodiment, GP-FL is at least 80%, or 85%, or 90%, or 95% homologous over the entire sequence relative to native Filovirus GP, or alternatively relative to the sequence listing disclosed in SEQ ID NO:10, so long as such variation fromnative Filovirus GP, or SEQ ID NO:10, respectively, does not affect secretion of the GP-FL subunit and conformation of the epitopes of the secreted GP-FL subunit. More preferably, GP is derived from homologs or variants as described above, e.g., all Ebola Zaire strains as well as any serotypes of: Ebola Sudan virus (SEBOV), Ebola Ivory-Coast and Marburg virus (MARV). The GP95 and GP-FL proteinspreferably are produced from vectors containing the DNA encoding the Filovirus GP fused to a heterologous secretion signal (e.g. BiP (Kirkpatrick et al., 1995) or TPA (Culp et al., 1991)). The proteins are processed by cellular signalases to release themature GP95 or GP-FL proteins. In one embodiment, the immunogenic composition comprises the surface glycoprotein subunit derived from Ebola Zaire virus. Preferably, the GP95 subunit from Ebola Zaire virus is purified by immunoaffinity chromatography (IAC) using a monoclonalantibody (e.g. 13C6; Wilson et al., 2000) as described in Example 2. Alternatively, the GP95 subunit from Ebola Zaire virus is purified by conventional chromatography methods or alternative affinity purification methods (e.g., wheat germ lectinchromatography (Dolnik et al. 2004)), which are known to one skilled in the art. In one embodiment, the immunogenic composition comprises the surface glycoprotein subunit derived from Ebola Sudan virus. Preferably, the GP95 subunit from Ebola Sudan virus is purified by immunoaffinity chromatography (IAC) using a monoclonalantibody (e.g., 13C6) as described in Example 2. Alternatively, the GP95 subunit from Ebola Sudan virus is purified by conventional chromatography methods or alternative affinity purification methods (e.g., wheat germ lectin chromatography (Dolnik etal. 2004)) which are known to one skilled in the art. In one embodiment, the immunogenic composition comprises the surface glycoprotein subunit derived from Marburg virus. Preferably, the GP95 subunit from Marburg virus is purified by immunoaffinity chromatography (IAC) using a monoclonal antibodyas described for Ebola Zaire GP95 in Example 2. Alternatively, the GP95 subunit from Marburg virus is purified by conventional chromatography methods or alternative affinity purification methods (e.g., wheat germ lectin chromatography (Dolnik et al.2004)), which are known to one skilled in the art. Trimeric GP95 Numerous studies have demonstrated that immunogenicity is directly related both to the size of the immunogen and to the antigenic complexity of the immunogen. Thus, in general, larger antigens make better immunogens. The native form of GPfound on the surface of the Filovirus virion is a homotrimer (Volchkov et al. 1998b). The majority of the recombinant GP95 protein prepared using the method of production disclosed herein is present in solution as trimers and dimers in addition to asmaller portion of monomer. Trimers of GP may be stabilized by protein cross-linking agents (e.g., formaldehyde, EGS) after purification. In a preferred embodiment, the surface glycoproteins from ZEBOV, SEBOV or MARV are prepared as trimeric antigens. Matrix Protein (VP40) In addition to the Filovirus surface glycoproteins discussed above, the immunogenic formulations of the described invention optionally include the Filovirus matrix protein VP40. The recombinant protein components of the Filovirus vaccineformulations described herein are produced by a eukaryotic expression system, Drosophila melanogaster Schneider 2 (S2) cells (see references above). This method of expression successfully produces recombinant matrix proteins from Filoviruses, such asEbola Zaire (ZEBOV). These proteins are expressed full length and may be expressed as a fusion with a eukaryotic secretion signal (e.g., from BiP or TPA) thus allowing it to be efficiently secreted into the extracellular medium, facilitating recovery. Furthermore, the secreted protein has been shown to be glycosylated, while the non-secreted protein is not. The secreted V40 was shown to maintain native conformation as determined by reactivity with a VP40-specific monoclonal antibody M-HD06-A10A("A10A") produced by United States Army Medical Research Institute for Infectious Diseases ("USAMRIID"), as shown in Example 2. The amino acid sequence listing of ZEBOV VP40 is SEQ ID: 13. The nucleotide sequence listing, including leading and trailingnucleotides (collectively, "bookends") used in cloning, that encodes ZEBOV VP40 is SEQ ID: 14. The nucleotide sequence listing, without "bookends" used in cloning, that encodes ZEBOV VP40 is SEQ ID: 15. In another embodiment of the invention, VP40 is defined more broadly as a full length matrix protein that comprises one or more N-linked glycosylations, wherein the polypeptide has been secreted with or without the use of an eukaryotic secretionsignal as a recombinant protein from Drosophila cells, and wherein the polypeptide generates antibody responses to a homologous or heterologous strain of a species of Filovirus. In another preferred embodiment, the matrix protein further comprises a hydrophilicity profile characteristic of a homologous matrix protein (VP40) starting from the first amino acid at the N-terminus of the matrix protein of a strain of aspecies of Filovirus. In other words, amino acids can be substituted in the sequence comprising VP40 so long as the hydrophilicity profile and immunogenicity are unchanged. The immunogenicity of such VP40 proteins have also been demonstrated in an animal model (see Examples 3-5). "VP40" in one instance refers to a polypeptide that spans the entire Filovirus matrix protein, preferably one starting from the N-terminal amino acid of the mature matrix protein and ending at an amino acid in the range of the 303rd to326th amino acid, for example, such VP40 can be the polypeptide comprising amino acids 1 to 326 of the ZEBOV protein. Preferably, the ZEBOV matrix protein is a portion of the ZEBOV matrix protein that comprises up to 100% of its length starting from amino acid residue 1 at its N-terminus and which portion has been recombinantly produced and secreted with orwithout a heterologous secretion signal from Drosophila cells. In another embodiment, VP40 is at least 80%, or 85%, or 90% or 95% homologous over the entire sequence relative to native Filovirus VP40, or alternatively relative to the sequence listingdisclosed in SEQ ID NO:13, so long as such variation from native Filovirus, or SEQ ID NO:13, respectively, VP40 does not affect secretion of the VP40 subunit and conformation of the epitopes of the secreted VP40 subunit. More preferably, VP40 is derivedfrom homologs or variants as described above, e.g., all Ebola virus variants as well as any serotypes of Marburg virus (MARV). The VP40 proteins preferably are produced from vectors containing the DNA encoding the VP40 proteins fused at the N-terminusto a heterologous secretion signal (e.g., BiP or TPA). The proteins are processed by cellular signalases to release the mature and glycosylated VP40 proteins. The VP40 proteins alternatively are produced without secretion signal from vectors containingthe DNA encoding the VP40 proteins. The proteins are released at similar expression levels via alternative pathways into the culture supernatant mimicking the protein shedding observed from Filovirus infected cells. In one embodiment, the immunogenic composition comprises the VP40 matrix protein derived from Ebola Zaire virus. Preferably, recombinant VP40 from Ebola Zaire virus is purified by immunoaffinity chromatography (IAC) using a monoclonal antibody(e.g., A10A) as described in Example 2. Alternatively, the recombinant VP40 from Ebola Zaire virus is purified by conventional chromatography methods which are known to one skilled in the art. Minor Matrix Protein (VP24) In addition to the Filovirus surface glycoproteins discussed above, the immunogenic formulations of the described invention optionally include the Filovirus minor matrix protein VP24. The Filovirus vaccine formulations described herein areproduced by a eukaryotic expression system, Drosophila melanogaster Schneider 2 (S2) cells (see references above). This method of expression successfully produces recombinant minor matrix proteins from Filoviruses, such as Ebola Zaire (ZEBOV). Theproteins are expressed full length and are expressed as a fusion with a eukaryotic secretion signal (e.g., BiP or TPA) thus allowing it to be efficiently secreted into the extracellular medium, facilitating recovery. Furthermore, the secreted proteinhas been shown to be glycosylated (Example 2). It was shown to maintain native conformation as determined by reactivity with a VP24-specific monoclonal antibody (BG11, see Example 2). The amino acid sequence listing of ZEBOV VP24 is SEQ ID: 16. Thenucleotide sequence listing, including leading and trailing nucleotides (collectively, "bookends") used in cloning, that encodes ZEBOV VP24 is SEQ ID: 17. The nucleotide sequence listing, without "bookends" used in cloning, that encodes ZEBOV VP24 isSEQ ID: 18. In another embodiment of the invention, VP24 is defined more broadly as a full-length, minor matrix protein, wherein the polypeptide has been secreted as a recombinant protein from Drosophila cells which may or may not be glycosylated, andwherein the polypeptide generates antibody responses to a homologous or heterologous strain of a species of Filovirus. In another preferred embodiment, the minor matrix protein further comprises a hydrophilicity profile characteristic of a homologous portion of a minor matrix protein (VP24) starting from the first amino acid at the N-terminus of the minor matrixprotein of a strain of a species of Filovirus. In other words, amino acids can be substituted in the sequence comprising VP24 so long as the hydrophilicity profile and immunogenicity are unchanged. The immunogenicity and protective efficacy of such glycosylated VP24 proteins have also been demonstrated in an animal model (see Examples 3-5). "VP24" in one instance refers to a polypeptide that spans a Filovirus minor matrix protein, preferably one starting from the N-terminal amino acid of the mature minor matrix protein and ending at an amino acid in the range of the 251st to253rd amino acid, for example, such VP24 can be the polypeptide comprising amino acids 1 to 251 of ZEBOV virus. Preferably, the ZEBOV minor matrix protein VP24 is a portion of the ZEBOV minor matrix protein that comprises up to 100% of its length starting from amino acid residue 1 at its N-terminus and which protein has been recombinantly produced andsecreted with a heterologous secretion signal from Drosophila cells. In another embodiment, VP24 is at least 80%, or 85%, or 90% or 95% homologous over the entire sequence relative to native Filovirus VP24, or alternatively relative to the sequencelisting disclosed in SEQ ID NO:16, so long as such variation from native Filovirus VP24 does not affect secretion of the VP24 subunit and conformation of the epitopes of the secreted VP24 subunit. More preferably, VP24 is derived from homologs orvariants as described above, e.g., all Ebola virus variants as well as any serotypes of Marburg virus (MARV). The VP24 proteins preferably are produced from vectors containing the DNA encoding the VP24 proteins fused at the N-terminus to a heterologoussecretion signal (e.g., BiP or TPA). The proteins are processed by cellular signalases to release the mature and glycosylated VP24 proteins. In one embodiment, the immunogenic composition comprises the minor matrix protein derived from Ebola Zaire virus. Preferably, recombinant VP24 from Ebola Zaire virus is purified by immunoaffinity chromatography (IAC) using a monoclonalantibody, for example Z-AC01-BG11-01 ("BG11"; Wilson et al., 2001), as described in Example 2. Alternatively, the recombinant VP24 from Ebola Zaire virus is purified by conventional chromatography methods, which are known to one skilled in the art. Nucleoprotein Subunits (NP) In addition to the Filovirus glycoproteins discussed above, the immunogenic formulations of the described invention optionally include the Filovirus nucleoprotein NP. The Filovirus vaccine formulations described herein are produced by aeukaryotic expression system, Drosophila melanogaster Schneider 2 (S2) cells (see references above). This method of expression successfully produces recombinant nucleoproteins from Filoviruses, such as Ebola Zaire (ZEBOV). These proteins are expressedfull length or as truncated subunits and may be expressed as a fusion with a eukaryotic secretion signal (e.g., from BiP or TPA) thus allowing it to be secreted into the extracellular medium, facilitating recovery. Furthermore, the expressed protein hasbeen shown to be glycosylated. It was shown to maintain native conformation as determined by reactivity with two monoclonal antibodies (D04-AE8 and FB03-BE08, see Example 2). The amino acid sequence listing of ZEBOV NP is SEQ ID: 19. The nucleotidesequence listing, including leading and trailing nucleotides (collectively, "bookends") used in cloning, that encodes ZEBOV NP is SEQ ID: 20. The nucleotide sequence listing, without "bookends" used in cloning, that encodes ZEBOV NP is SEQ ID: 21. In another embodiment of the invention, NP is defined more broadly as a full length nucleoprotein that may comprise one or more N-linked glycosylations, wherein the polypeptide may have been secreted with the use of an eukaryotic secretionsignal as a recombinant protein from Drosophila cells, and wherein the polypeptide generates antibody responses to a homologous or heterologous strain of a species of Filovirus. In another preferred embodiment, the nucleoprotein further comprises a hydrophilicity profile characteristic of a homologous nucleoprotein (NP) starting from the first amino acid at the N-terminus of the nucleoprotein of a strain of a species ofFilovirus. In other words, amino acids can be substituted in the sequence comprising NP so long as the hydrophilicity profile and immunogenicity are unchanged. "NP" in one instance refers to a polypeptide that spans the nucleoprotein, preferably one starting from the N-terminal amino acid of the mature nucleoprotein and ending at an amino acid in the range of the 692nd to 739th amino acid,for example, such NP can be the polypeptide comprising amino acids 1 to 739 of ZEBOV virus. Preferably, the ZEBOV nucleoprotein NP is a portion of the ZEBOV nucleoprotein that comprises up to 100% of its length starting from amino acid residue 1 at its N-terminus and which portion has been recombinantly produced with or without aheterologous secretion signal from Drosophila cells. In another embodiment, NP is at least 80%, or 85%, or 90% or 95% homologous over the entire sequence relative to native Filovirus NP, or alternatively relative to the sequence listing disclosed in SEQID NO:19, so long as such variation from native Filovirus NP or SEQ ID NO:19, respectively, does not affect secretion of the NP subunit and conformation of the epitopes of the secreted NP subunit. More preferably, NP is derived from homologs or variantsas described above, e.g., all Ebola virus variants as well as any serotypes of Marburg virus (MARV). The NP proteins preferably are produced from vectors containing the DNA encoding the NP proteins. The NP proteins alternatively are produced fromvectors containing the DNA encoding the NP proteins fused at the N-terminus to a heterologous secretion signal (e.g., BiP or TPA). The proteins are then processed by cellular signalases to release the mature and glycosylated NP proteins. In one embodiment, the immunogenic composition comprises the nucleoprotein derived from Ebola Zaire virus. Preferably, recombinant NP from Ebola Zaire virus is purified by immunoaffinity chromatography (IAC) using a monoclonal antibody (e.g.,Z-D04-AE8 produced by the United States Army Medical Research Institute for Infectious Diseases) as described in Example 2. Alternatively, the recombinant NP from Ebola Zaire virus is purified by conventional chromatography methods, which are known toone skilled in the art. Adjuvants In addition to the antigenic components described above, the invention optionally contains an adjuvant which aids in inducing a potent, protective immune response to the conformationally relevant antigen, Saponin or Saponin-Based Adjuvants In an especially preferred embodiment of the invention, a saponin or saponin-based adjuvant such as ISCOMATRIX.RTM. or GPI-0100 are added to the recombinant subunit surface glycoprotein, with or without additional structural proteins in thecomposition. Targeting specific antigen-presenting cell (APC) populations may involve a particular receptor on the surface of the APC, which could bind the adjuvant/antigen complex and thereby result in more efficient uptake and antigen processing asdiscussed above. For example, a carbohydrate-specific receptor on an APC may bind the sugar moieties of a saponin such as ISCOMATRIX.RTM. or GPI-0100 (Kensil, C. R. et al., J. Immunol. (1991) 146:431-437; Newman M. J. et al., J. Immunol. (1992)148:2357-2362; U.S. Pat. Nos. 5,057,540; 5,583,112; 6,231,859). Although the validity of the invention is not bound by this theory, a possible mechanism of action may be that if the saponin is also bound to an antigen, this antigen would thus bebrought into close proximity of the APC and more readily taken up and processed. Similarly, if the adjuvant forms micellar or liposomal complexes with antigen and the adjuvant can interact or fuse with the APC membrane, this may allow the antigen accessto the cytosolic or endogenous pathway of antigen processing. As a result, peptide epitopes of the antigen may be presented in the context of MHC class I molecules on the APC, thereby inducing the generation of CD8+ cytotoxic T lymphocytes ("CTL";Newman et al., supra; Oxenius, A., et al., J. Virol. (1999) 73: 4120). A saponin is any plant glycoside with soapy action that can be digested to yield a sugar and a sapogenin aglycone. Sapogenin is the nonsugar portion of a saponin. It is usually obtained by hydrolysis, and it has either a complex terpenoid or asteroid structure that forms a practicable starting point in the synthesis of steroid hormones. The saponins of the invention can be any saponin as described above or saponin-like derivative with hydrophobic regions, especially the strongly polarsaponins, primarily the polar triterpensaponins such as the polar acidic bisdesmosides, e.g. saponin extract from Quillajabark Araloside A, Chikosetsusaponin IV, Calendula-Glycoside C, chikosetsusaponin V, Achyranthes-Saponin B. Calendula-Glycoside A,Araloside B, Araloside C, Putranjia-Saponin III, Bersamasaponiside, Putrajia-Saponin IV, Trichoside A, Trichoside B, Saponaside A, Trichoside C, Gypsoside. Nutanoside, Dianthoside C, Saponaside D, aescine from Aesculus hippocastanum or sapoalbin fromGyposophilla struthium, preferably, saponin extract Quillaja saponaria Molina and Quil A. In addition, saponin may include glycosylated triterpenoid saponins derived from Quillaja Saponaria Molina of Beta Amytin type with 8-11 carbohydrate moieties asdescribed in U.S. Pat. No. 5,679,354. Saponins as defined herein include saponins that may be combined with other materials, such as in an immune stimulating complex ("ISCOM")-like structure as described in U.S. Pat. No. 5,679,354. Saponins alsoinclude saponin-like molecules derived from any of the above structures, such as GPI-0100, such as described in U.S. Pat. No. 6,262,029. Preferably, the saponins of the invention are amphiphilic natural products derived from the bark of the tree, Quillaia saponaria. Preferably, they consist of mixtures of triterpene glycosides with an average molecular weight (MW) of 2000. A particularly preferred embodiment of the invention is a purified fraction of this mixture. The most preferred embodiment of the invention is one or more GP95 proteins combined with ISCOMATRIX.RTM. or GPI-0100 to produce a vaccine formulation able to induce potent, safe, protective immune responses in vaccinated subjects, includingmembers of the immunodeficient population. Emulsion and Emulsion-Based Adjuvants In another preferred embodiment, an emulsion or emulsion-based adjuvant, such as Montanide ISA-51, Co-Vaccine HT, or Ribi R-700, is added to the recombinant subunit GP protein, with or without additional structural proteins in the composition. Emulsions and emulsion-based vaccines such as those formulated with Montanide ISA-51 (see Example 3) are known in the art (Podda A. and G. DelGiudice, Expert Rev. Vaccines (2003) 2:197-203; Banzhoff A. et al., Gerontology (2003) 49:177-84) and arebelieved to function primarily through a depot effect. CoVaccine HT does not function in this manner. Rather it most likely functions as an immune modulator, since it contains carbohydrate moieties bound to micro-droplets of vegetable oil, which isthought to mimic the bacterial cell surface. Thus, while this adjuvant is physically an emulsion, its mode of action as an adjuvant is that of an immunomodulator. Ribi R-700 (or other adjuvants of the Ribi Adjuvant System, (GlaxoSmithKline,Philadelphia, Pa.) contains highly purified microbial cell wall constituents such as monophosphoryl lipid A (MPL) and Synthetic Trehalose Dicorynomycolate (TDM) in an emulsion of metabolizable oil. Like CoVaccine HT, Ribi R-700 also demonstrates aimmunomodulatory effect in addition to the depot and antigen presentation advantages of an emulsion. While reports in the literature (Podda and DelGiudice; Banzhoff et al.) have suggested that addition of emulsions such as MF59 to subunit vaccines may overcome some of the immune difficulties in the elderly, side by side evaluation with anotherunadjuvanted, subunit-like (split influenza) vaccine formulation failed to show an added benefit (Ruf et al.), resulting in a lack of medical endorsement for the use of the MF59 adjuvanted vaccine (Prescrire Int.). Addition of carbohydrates orimmunostimulatory molecules to an emulsion (e.g., Co-Vaccine HT) is believed to further enhance the adjuvant effect through more effective stimulation of antigen presenting cells as described above. Thus, the combination of an emulsion-based adjuvantcontaining additional immunostimulatory molecules with a conformationally relevant recombinant Filovirus surface glycoprotein produces a particularly potent vaccine composition. In a highly preferred embodiment, ZEBOV GP95 is combined with Co-Vaccine HTto produce a vaccine formulation able to induce potent, protective immune responses in vaccinated subjects. In a preferred embodiment, the recombinant Filovirus surface glycoprotein, with or without additional structural proteins in the composition, is formulated with aluminum-based adjuvants (collectively, "alum" or "alum-based adjuvants") such asaluminum hydroxide, aluminum phosphate, or a mixture thereof. Aluminum-based adjuvants remain the only adjuvants currently registered for human use in the United States and their effectiveness is widely recognized. Aluminum-based adjuvants are believedto function via a depot mechanism and the combination of the conformationally relevant Filovirus surface glycoprotein antigen with the depot effect is sufficient to induce a potent immune response in vaccinated individuals. Dipeptidyl Peptidase Inhibitors Dipeptidyl Peptidase Inhibitors are synthetic molecules that inhibit the dipeptidyl peptidase (DPP) family of serine proteases. These enzymes digest proteins found naturally in the body and regulate tumor growth and immune responses. Inhibition of certain DPPs appears to stimulate the immune system to mount an attack against infectious agents or tumors. Inhibition of DPP 8/9 in monocytes has been shown to induce the release of IL-1β, a key molecule stimulating immune responses,which then stimulates cytokine and chemokine production (www.pther.com). The cytokines and chemokines involved in the response to orally administered DPP inhibitors are known to promote the body's own anti-tumor defenses, including the activity of T-cells, neutrophils, monocytes/macrophages and natural killer cells. Based on the same mechanism, the responses to externally administered antigens can be enhanced. Administration and Use The described invention thus concerns and provides a means for preventing or attenuating infection by Filovirus. As used herein, a vaccine is said to prevent or attenuate a disease if administration of the vaccine to an individual resultseither in the total or partial immunity of the individual to the disease, or in the total or partial attenuation (i.e., suppression) of a symptom or condition of the disease. A composition is said to be "pharmacologically acceptable" if its administration can be tolerated by a recipient patient. Such an agent is said to be administered in a "therapeutically effective amount" if the amount administered isphysiologically significant. An agent is physiologically significant if its presence results in a detectable change in the physiology of a recipient patient. The active vaccines of the invention can be used alone or in combination with other active vaccines such as those containing other active subunits or formulations containing or expressing homologous or heterologous immunogens. Corresponding ordifferent subunits from one or several serotypes may be included in a particular formulation. The therapeutic compositions of the described invention can be administered parenterally by subcutaneous, intramuscular, intradermal, or transdermal (e.g., topical) application. Many different techniques exist for the timing of the immunizations when a multiple administration regimen is utilized. It is preferable to use the compositions of the invention more than once to increase the levels and diversities ofexpression of the immunoglobulin repertoire as well as the population size of mature T-cells in the immunized subject. Typically, if multiple immunizations are given, they will be given one to two months apart. To immunize subjects against Filovirus-induced disease for example, the vaccines containing the subunit(s) are administered to the subject in conventional immunization protocols involving, usually, multiple administrations of the vaccine. Administration is typically by injection, typically intramuscular or subcutaneous injection; however, other modes of administration may also be employed. According to the described invention, an "effective amount" of a therapeutic composition is one which is sufficient to achieve a desired biological effect. Generally, the dosage needed to provide an effective amount of the composition will varydepending upon such factors as the subject's age, condition, sex, and extent of disease, if any, and other variables which can be adjusted by one of ordinary skill in the art. The antigenic preparations of the invention can be administered by eithersingle or multiple dosages of an effective amount. Effective amounts of the compositions of the invention can vary from 0.01-500 μg per dose, more preferably from 0.1-20 μg per dose, and most preferably 1-5 μg per dose. EXAMPLES Example 1 Cloning of Filovirus Structural Genes and Expression in Insect Cells Cloning of Required Genes into Vectors for Expression in Insect Cells Sequences for expression of four selected Ebola Zaire virus proteins nucleoprotein NP, glycoprotein GP and the small viral proteins VP24 and VP40 were accessed from Genbank (www.ncbi.nlm.nih.gov/Genbank/index.html) Ebola Zaire, Mayinga strain;accession number NC--002549. PCR amplification used specially designed DNA primers and cDNA plasmids to prepare the properly positioned inserts containing required restriction sites and stop codons. This allowed directional cloning into theselected expression vectors (pMT/BiP/V5-His A (with BiP secretion signal) and pMT/V5-His A (no secretion signal), Invitrogen Corp., www.invitrogen.com). All plasmids contained the Drosophila metallothionein promoter to allow inducible protein expressionin insect cells. The endogenous secretion signal (first 32 amino acids) of the surface glycoprotein GP gene was removed to allow for standardized expression conditions in all constructs using the well characterized BiP secretion signal. Native full-length GPcontains a membrane anchor at the C-terminal end. In one construct the full-length GP was cloned. In another construct, the membrane anchor was removed in order to achieve maximum secretion of the expressed protein (last 29 amino acids deleted) withthe resulting product comprising 95% of the full-length GP protein and being referred to as GP95. As NP and VP40 are not normally secreted proteins, expression was evaluated from both a secreted and non-secreted construct. Table 1 summarizes the clonedcoding sequences. For details about the preparation of the expression plasmids and use in the Drosophila expression system, see commonly assigned U.S. Pat. Nos. 6,165,477; 6,416,763; 6,432,411; and 6,749,857, the contents of which are fully incorporated hereinby reference. Unless otherwise defined herein, the definitions of terms used in such commonly assigned patents and related to the Drosophila expression system shall apply herein. The DNA sequences cloned into the plasmids in such commonly assignedpatents are, of course, different from, and superseded by, the cloned Filovirus sequences disclosed herein. TABLE-US-00001 TABLE 1 Summary of cloned genomic sequences for expression of Ebola subunit proteins Cloned genomic Expressed subunit Ebola subunit information protein (based on protein Plasmid (position in bp)* wildtype protein) GlycoproteinpMT/BiP- 6135-7979 amino acids (GP95) EboZ-GP95 (edited) 33-647 (secreted) Nucleoprotein pMT/BiP- 470-2689 Full length (NP) (secreted) EboZ-NP VP24 (secreted) pMT/BiP- 10346-11101 Full length EboZ-VP24 VP40 (secreted) pMT/BiP- 4479-5459 Full lengthEboZ-VP40 Glycoprotein pMT/BiP- 6135-8069 amino acids Full-length EboZ-GP-FL (edited) 33-676 (GP-FL) (secreted) Nucleoprotein pMT-EboZ- 470-2689 Full length (NP NS) NP-NS (not secreted) VP40 NS (not pMT-EboZ- 4479-5459 Full length secreted) VP40-NS*Basepair numbers listed are based on Genbank accession number NC_002549) Stable Transformation of Drosophila S2 Cells and Analysis of Protein Expression Drosophila S2 cells adapted to ExCell 420 (SAFC; www.sigmaaldrich.com) were co-transformed with one of the expression plasmids for Ebola Zaire VP40 (secreted or non-secreted), VP24, NP (secreted or non-secreted) or GP (95% or full-length) andone of the selectable marker plasmids pCoHygro or pCoBlast (Invitrogen Corp.; www.invitrogen.com) using the calcium phosphate coprecipitation method. Stable expression of each individual subunit was verified in at least 1-2 duplicate cell lines. Samples of culture medium following induction with 200 μM CuSO4 were evaluated by polyacrylamide gel electrophoresis followed by Coomassie staining and Western Blot. Blots were probed with anti-Ebola HMAF (polyvalent hyperimmune mouse asciticfluid) or individual monoclonal antibodies reactive against Ebola Zaire virus proteins. HMAF (raised in ICR mice immunized with irradiated SEBOV, ZEBOV and REBOV) reacted with all expressed Ebola subunit proteins. Some background reactions wereobserved when HMAF was used, whereas monoclonal antibodies detected only the appropriate subunits. A summary of expression yields and product properties can be found in Table 2. TABLE-US-00002 TABLE 2 Summary of Expression for Recombinant Ebola Virus Proteins Ebola Aminoacid Predicted Estimated Subunit Protein sequence contained* molecular weight expression level Comments on expressed protein VP40 1-326 35.4 kDa 10-20mg/L Uniform expression pattern of major (secreted) (full length) (>90%) and minor (90% retained inside the cells, one (Non-Secreted) (full length) uniform size of product of around 100 kDa. Higher yield than when expressed in secreted form. GP-FL33-676 70.9 kDa 1-5 mg/L Majority of protein is secreted as a single size product. Expression level is lower than for truncated GP. *Position based on native Ebola virus proteins as contained in Genbank NC_002549 Production of Soluble Secreted Ebola VP40, VP24, GP95 and NP Proteins The cell lines expressing secreted forms of VP40, VP24, GP95 or NP were scaled up and several 400 ml spinner flask cultures or a stirred-tank Bioreactor were inoculated at 1-2×106 cells/ml. Expression in each culture flask wasinduced after 48 hours by adding CuSO4 to the media. Culture supernatants were harvested on day 7. Expression was verified by polyacrylamide gel electrophoresis and Western Blot. FIG. 2 shows a Coomassie stained PAGE gel containing expressionproducts from selected spinner flask culture supernatants. Example 2 Purification of Recombinant Filovirus Proteins Monoclonal antibodies specific to individual Ebola virus proteins obtained from United States Army Medical Research Institute for Infectious Diseases ("USAMRIID") (Table 3) were coupled to NHS-sepharose (Amersham; www.amershambiosciences.com) atratios of 10 mg to 1 ml of matrix. Culture medium was loaded directly onto the immunoaffinity chromatography (IAC) columns and bound protein was eluted with 20 mM glycine buffer at pH 2.5 after a PBS wash. Eluates were neutralized and buffer exchangedinto PBS using ultrafiltration devices (Centriplus, Millipore; www.millipore.com). Final products were filtered using 0.2 μm syringe filters and protein content determined by UV absorption and gel-electrophoresis. Silver staining of final gels wasused to determine the approximate purity of proteins (FIGS. 3, 4 and 5). Yields and purity of each protein are summarized in Table 4. TABLE-US-00003 TABLE 3 Monoclonal antibodies used for Ebola subunit purification Antibody specificity Antibody name VP24 Z-AC01-BG11-01 VP40 M-HD06-A10A GP 13C6-1-1 NP ZD04-AE8 NP FB03-BE-08 TABLE-US-00004 TABLE 4 Summary of purified soluble Ebola proteins Soluble Ebola protein Estimated Purity Amount purified VP24 >95% 13.9 mg GP95 (batch 1) >90% 10.5 mg GP95 (batch 2) >90% 12.1 mg GP95 (batch sw) >90% 37.9 mg VP40(batch 1) 85-90% 3.55 mg VP40 (batch 2) 90% 2.8 mg VP40 (batch 3) 85-90% 3.8 mg The glycosylation status of purified soluble VP40, VP24, NP and GP95 proteins was determined using PNGase (New England Biolabs, www.neb.com) or an enzymatic deglycosylation kit (E-DEGLY, Sigma, www.sigma-aldrich.com) to remove N- or O-linkedsugars from the tested proteins. Molecular weight analysis of glycosylated versus non-glycosylated proteins was conducted on SDS-PAGE gels using Coomassie staining. This was correlated with results from gels probed with a glycoprotein in-gel stain kit(Invitrogen; www.probes.invitrogen.com) and Western blots probed with antibodies reactive to individual proteins (see FIGS. 6-9). GP For recombinant GP95 protein, a 10 ml immunoaffinity column (prepared with 107 mg of EGP13C6 MAb) was used to purify three batches from 800 ml (batch 1), 1200 ml (batch 2) or 4000 ml (batch sw) culture supernatant as described above. Coomassiestained SDS-PAGE gels were used to analyze the product (FIG. 3). One major product can consistently be observed (>90% purity) in purified material of all batches. The size of the secreted product is estimated to be approximately 110 kDa (fulllength--see lane 8). In a reduced sample (lane 2), GP1 can be observed around 90 kDa and GP2 at approximately 20 kDa, indicating efficient post-translational processing by furin. Native protein gels as well as FPLC data (size exclusion chromatography)suggest that the majority of GP95 in solution is present as dimers and trimers. A Western blot probed with the conformationally sensitive antibody 13C6 is shown in FIG. 8. Purified GP95 was also analyzed by MALDI-ToF. The molecular weight of the GP95 aglycon (monomer) is 89 kDa and the N-linked glycosylation adds an additional 21.4 kDa per monomer. GP contains 7 potential N-linked glycosylation sites, 5 in the GP 1 region and two in the GP2 region. N-linked glycosylations were confirmed in both regions by PNGase treatment. Analysis showed no evidence for O-linked glycosylation of the upto 21 potential O-glycosylation sites. VP40 For the purification of 3 batches (lots #588-161, #609-73 and #619-23VP40 protein a 2 ml immunoaffinity column (prepared with 19 mg of M-HD06-A10 A MAb) was used. 800 to 1600 ml of culture supernatant were loaded directly onto the IAC columnand VP40 eluted after a PBS wash. Silver stained gels were used to analyze the products of all three lots (FIG. 4). VP40 is secreted by S2 cells as two products that co-purify on the IAC column. The apparent sizes of the two VP40 bands on protein gelsare 44 and 40 kDa. A Western blot probed with the Ebola Zaire VP40-specific monoclonal antibody A10A is shown in FIG. 7. Both forms of secreted VP40 show a single N-linked sugar moiety as determined by PNGase digestion and consistently appear as a major and a minor band product on SDS-PAGE gels. Dimers and higher oligomers are observed as a "smear" above themajor protein band under non-reducing conditions but disappear under reducing conditions (FIG. 4). Based on enzymatic deglycosylation, there is no indication of O-linked glycosylation in VP40 expressed and secreted from insect cells. N-terminal sequencing of both of the VP40 bands showed efficient processing of the BiP secretion signal and the amino acid sequence of the first 10 amino acids was identical. This rules out that the alternate translation initiation site atM14 is being used by our insect cell line. This alternate expression product was confirmed when VP40 was expressed in mammalian cells (Jasenosky et al. 2001). Purified VP40 (lot #588-161) was also analyzed by MALDI-ToF (Autoflex, Bruker Daltonics, www.bdal.com). It showed a molecular weight of 36.8 kDa for the secreted VP40 with one confirmed N-linked glycosylation. The theoretical weight of theaglyco-form is 35.4 kDa. Peptide mass fingerprint data suggests that the glycosylation site at Asn25 is processed. The second site at Asn222 is apparently not glycosylated. VP24 For recombinant VP24 protein, a 10 ml immunoaffinity column (prepared with 93 mg of Z-AC1-BG11 MAb) was used to purify VP24 from 800 ml of culture supernatant. The purification scheme was as described above. Silver stained gels were used toanalyze the product (FIG. 5). The apparent molecular weights for the three bands on this silver stained PAGE gel are 32, 29 and 26 kDa which can be attributed to the presence of single, double and triple glycosylated products. PNGase treatment resultsin reduction to one band of lower molecular weight (~25 kDa) on SDS-PAGE. Purity of the product is estimated at >95%. A Western blot of purified VP24 probed with ZEBOV specific monoclonal antibody reactive against VP24 is shown in FIG. 9. Purified VP24 (predicted molecular weight of polypeptide: 28.4 kDa) shows the following molecular weights by MALDI-ToF: 28.9, 29.9 and 30.9 kDa. The peptide mass fingerprint suggests that the protein is partially glycosylated at the predictedsites Asn86, Asn187 and Asn248. NP Both available NP reactive monoclonal antibodies were coupled to NHS-sepharose (approx. 100 mg of monoclonal antibody bound to 10 ml sepharose). Both columns were tested for their ability to purify NP recombinant protein. The bindingefficiency of both NP columns was low compared to GP or VP24 columns. The Z-D04-AE8 column in comparison to the FB03-BE-08 column showed higher yields. The purification of recombinant NP proteins from S2 culture medium by this method resulted inproduct that was estimated to be below 50% in purity. Example 3 Immunogenicity of Recombinant Ebola Virus Proteins in Balb/c Mice The immunogenicity of the purified recombinant VP24, VP40, and GP95 proteins was tested in Balb/c mice. The candidate vaccines were formulated using two adjuvants with different modes of action. The saponin-based GPI-0100 (Hawaii Biotech,Inc.) provides a direct immuno-stimulatory and -modulatory effect, while Montanide ISA-51 (Seppic, www.seppic.com) is an oil-in-water emulsion that provides a depot effect. Mice were immunized by subcutaneous injection three times at 4-week intervalswith the test vaccine formulations. Details of the experimental groups are summarized in Table 5 below. One week after the third dose, 5 mice from each group were splenectomized. The rest were terminally bled two weeks after the third dose. All micewere also tail-bled at weeks 2 and 6. Splenocytes were stimulated in vitro with antigen and analyzed for proliferative capacity and secretion of cytokines post-stimulation (by ELISA). Antigen specific antibody titers in the tail- and terminal bleedswere determined by ELISA using immunizing antigent irradiated Ebola virus as coating antigen. TABLE-US-00005 TABLE 5 Mouse immunogenicity study using soluble recombinant Ebola virus proteins Group Immuno- No. of no. Adjuvant gen mice Formulation Route 1 GPI-0100 10 μg 15 100 μg of GPI-0100 s.c. GP95 is mixed with 10 μg antigenand PBS 2 ISA-51 10 μg 15 50% ISA-51 is mixed s.c. GP95 into adequate volume of immunogen in PBS 3 GPI-0100 10 μg 10 100 μg of GPI-0100 s.c. VP-40 is mixed with 10 μg antigen and PBS 4 ISA-51 10 μg 10 50% ISA-51 is mixed s.c. VP-40 intoadequate volume of immunogen in PBS 5 GPI-0100 10 μg 10 100 μg of GPI-0100 s.c. VP-24 is mixed with 10 μg antigen and PBS 6 ISA-51 10 μg 10 50% ISA-51 is mixed s.c. VP-24 into adequate volume of immunogen in PBS 7 GPI-0100 NONE 10 100 μgof GPI-0100 s.c. is mixed with PBS 8 ISA-51 NONE 10 50% ISA-51 is mixed s.c. into adequate volume of PBS The results of the immunogenicity study are summarized in Table 6. The Stimulation Indices present the fold-increase of tritiated thymidine uptake in antigen-stimulated cells divided by unstimulated control cells of the same animal. To allowcomparison, data from adjuvant-only control groups stimulated with respective antigens has also been included. The ELISA titers are expressed as the GMT of individual EC50 titers based on sigmoid curve fitting on a logarithmic scale (using Origin 7.5software, www.originlab.com). The lymphoproliferation data reveals strong immune responses to all three recombinant Ebola proteins. The specific stimulation indices (SI) ranged from 2.2 up to 15.1 where an SI≥3 is generally considered significant. Relatively highlevels of cytokines (IL-4, IL-5, IL-10) were secreted by stimulated splenocytes, particularly in the groups receiving the GPI-0100 adjuvant. Interferon gamma (IFN-γ) levels rose to levels clearly above control values and suggest that Th1 type responses have been induced with all three immunogens. Formulations with both adjuvants seem to induce approximately equal IFN-γ responses with all three antigens. ELISA titers obtained with all three immunogens show that relatively high serum titers against the antigens were induced following 2 vaccine doses with further increase following administration of a 3rd dose. TABLE-US-00006 TABLE 6 Summary of results of mouse immunogenicity study Vaccine Stimulation IL-4 IL-5 IL-10 IFN-γ ELISA titer ELISA titer ELISA titer formulation Index [ng/ml] [ng/ml] [ng/ml] [ng/ml] (post dose 1) (post dose 2) (post dose3) GP95 (GPI-0100) 15.1 ± 3.5 5.0 ± 0.5 10.9 ± 1.8 6.6 ± 1.0 5.8 ± 1.0 <250 7325 9949 GP95 (ISA51) 10.6 ± 4.9 1.4 ± 0.1 2.1 ± 0.5 1.6 ± 0.4 5.5 ± 2.1 <250 934 3384 GPI-0100 control 1.0 ± 0.1 0.02 ± 0.00 0.06 ± 0.00 0.04 ± 0.00 0.15 ± 0.01 <250 <250 <250 (GP stimulated) ISA51 control 1.1 ± 0.2 0.01 ± 0.01 0.06 ± 0.00 0.04 ± 0.00 0.14 ± 0.01 <250 <250 <250 (GP stimulated) VP40 (GPI-0100) 3.0 ± 0.37.0 ± 1.3 20.2 ± 1.0 11.8 ± 1.4 6.3 ± 2.0 441 18699 21767 VP40 (ISA51) 4.4 ± 1.0 2.3 ± 0.2 12.4 ± 2.5 8.8 ± 1.0 5.1 ± 0.4 275 5538 25866 GPI-0100 control 1.1 ± 0.2 0.01 ± 0.00 0.05 ± 0.00 0.04 ± 0.000.09 ± 0.03 <250 <250 <250 (VP40 stimulated) ISA51 control 0.9 ± 0.1 0.00 ± 0.00 0.05 ± 0.00 0.04 ± 0.01 0.22 ± 0.14 <250 <250 <250 (VP40stimulated) VP24 (GPI-0100) 6.2 ± 2.1 6.4 ± 0.9 23.8 ± 1.7 14.8± 1.7 5.4 ± 1.4 <250 3764 7780 VP24 (ISA51) 2.2 ± 0.7 1.2 ± 0.3 9.5 ± 2.6 5.9 ± 1.4 6.6 ± 0.4 <250 1521 7662 GPI-0100 control 1.0 ± 0.1 0.02 ± 0.00 0.08 ± 0.02 0.05 ± 0.01 0.33 ± 0.14 <250 <250<250 (VP24 stimulated) ISA51 control 0.9 ± 0.1 0.01 ± 0.01 0.06 ± 0.01 0.04 ± 0.00 0.16 ± 0.03 <250 <250 <250 (VP24 stimulated) As described above, immune mouse sera from the first immunogenicity study were tested by ELISA using the recombinant proteins as coating antigens. In addition, the same sera were titered using irradiated Ebola virus particles as coatingantigens. Table 7 compares the geometric mean titers of the highest dilution yielding an absorption value of 0.2 above background after color development. TABLE-US-00007 TABLE 7 Comparison of ELISA titers in the same immune mouse sera obtained using different coating antigens: Recombinant protein antigens irradiated Ebola virus post dose 1 post dose 2 post dose 3 post dose 1 post dose 2 post dose3 GP95 (GPI-0100) 250 27858 64000 <100 1397 3363 (33) GP95 (ISA-51) <250 6964 16000 <100 155 580 (33) VP24 (GPI-0100) <250 16000 36758 <100 <100 51 (33) (33) VP24 (ISA-51) <250 9190 36758 <100 124 33 (33) VP40 (GPI-0100) 2297147033 256000 41 37710 30271 VP40 (ISA-51) 758 48503 256000 64 15659 30271 GPI-0100 control <250 <250 <250 <100 <100 41 (33) (33) ISA-51 control <250 <250 <250 <100 <100 <100 (33) (33) (33) The two methods yielded different relative titer values likely due to the different sources and composition of coating antigen. 0.375 μg of each individual recombinant protein (either GP95, VP40 or VP24) was applied per well resulting in acontrolled amount of protein. In contrast, when irradiated virus was used as coating antigen, the relative amounts of each viral protein reflected the composition of the virus particles. VP40 is the major protein in virus particles. High titers in theassay can be attributed to its abundance of about 40% of the total virus protein. In contrast, GP is the major surface protein, but represents only 2-5% of the particle mass. Therefore, relatively less GP protein is contained in each virus-coated well,perhaps resulting in lower overall titers. Similarly, VP24 is only a minor component (2-5%) of virions and in addition resides exclusively inside the particle. It therefore would not be unexpected that anti-VP24 ELISA titers measured against wholevirus would be lower than the anti-VP40 and anti-GP titers. The results show that immunization with Ebola proteins expressed in Drosophila S2 cells results in production of high titer antibodies that are reactive with intact viral particles. Example 4 Optimization of Ebola Vaccine Formulations Based on Recombinant Proteins The major vaccine candidate protein (GP95) was tested at 1, 3 or 9 μg formulated with three adjuvants (GPI-0100 (Hawaii Biotech, Inc.), CoVaccine HT.RTM. (CoVaccine, www.covaccine.com) and Ribi-700 (GlaxoSmithKline, Philadelphia, Pa.) whileVP40 was tested only at 10 μg per dose using the same three adjuvants. 10 Balb/c mice per group were vaccinated three times at four-week intervals (Table 8). Tail bleeds were collected 2 weeks after the first and second immunizations. Three micewere splenectomized 4 days following the third dose, three on day seven. The remaining four mice from each group were terminally bled 14 days post third immunization. TABLE-US-00008 TABLE 8 Dose/adjuvant formulation study groups: Group no. Adjuvant Immunogen No. of mice Formulation Adm. 1 GPI-0100 1 μg GP95 10 250 μg of GPI-0100 is mixed with 2 sites s.c. antigen and PBS 2 CoVaccine HT 1 μg GP95 100.1 ml of CoVaccine HT is mixed 2 sites s.c. with 0.1 ml of immunogen in PBS 3 RIBI R-700 1 μg GP95 10 Prepare formulation according to 2 sites s.c. manufacturer's instructions 4 GPI-0100 3 μg GP95 10 250 μg of GPI-0100 is mixed with 2 sitess.c. antigen and PBS 5 CoVaccine HT 3 μg GP95 10 0.1 ml of CoVaccine HT is mixed 2 sites s.c. with 0.1 ml of immunogen in PBS 6 RIBI R-700 3 μg GP95 10 Prepare formulation according to 2 sites s.c. manufacturer's instructions 7 GPI-0100 9 μgGP95 10 250 μg of GPI-0100 is mixed with 2 sites s.c. antigen and PBS 8 CoVaccine HT 9 μg GP95 10 0.1 ml of CoVaccine HT is mixed 2 sites s.c. with 0.1 ml of immunogen in PBS 9 RIBI R-700 9 μg GP95 10 Prepare formulation according to 2 sitess.c. manufacturer's instructions 10 GPI-0100 10 μg VP-40 10 250 μg of GPI-0100 is mixed with 2 sites s.c. antigen and PBS 11 CoVaccine HT 10 μg VP-40 10 0.1 ml of CoVaccine HT is mixed 2 sites s.c. with 0.1 ml of immunogen in PBS 12 RIBIR-700 10 μg VP-40 10 Prepare formulation according to 2 sites s.c. manufacturer's instructions 13 GPI-0100 NONE 10 250 μg of GPI-0100 is mixed with 2 sites s.c. PBS 14 CoVaccine HT NONE 10 0.1 ml of CoVaccine HT is mixed 2 sites s.c. with 0.1 mlof PBS 15 RIBI R-700 NONE 10 Prepare formulation according to 2 sites s.c. manufacturer's instructions Analysis of antibodies raised (ELISA titers) of the combined dose/adjuvant study are shown in Table 9. Titers are expressed as the dilution yielding the half maximal absorption value (determined by using a sigmoidal curve fitting algorithm). Homologous antigen preparations (GP95 or VP40) from the same lots used for immunizations were used as coating antigens. TABLE-US-00009 TABLE 9 Summary of ELISA titers from the dose/adjuvant study Recombinant GP95 as coating antigen Recombinant VP40 as coating antigen Vaccine formulation Post dose 1 Post dose 2 Post dose 3 Post dose 1 Post dose 2 Post dose 3 1μg GP95 <250 4097 24644 ND ND ND (250 μg GPI-0100) 3 μg GP95 <250 6215 16577 ND ND ND (250 μg GPI-0100) 9 μg GP95 <250 10403 18627 ND ND ND (250 μg GPI-0100) 1 μg GP95 <250 <250 1179 ND ND ND (CoVaccine HT) 3 μgGP95 <250 581 7588 ND ND ND (CoVaccine HT) 9 μg GP95 <250 1345 7297 ND ND ND (CoVaccine HT) 1 μg GP95 <250 <250 <250 ND ND ND (Ribi R-700) 3 μg GP95 <250 <250 696 ND ND ND (Ribi R-700) 9 μg GP95 <250 <250 2913 ND NDND (Ribi R-700) 10 μg VP40 ND ND ND 906 22732 57638 (250 μg GPI-0100) 10 μg VP40 ND ND ND 697 9023 22689 (CoVaccine HT) 10 μg VP40 ND ND ND 157 9429 24045 (Ribi R-700) Control (250 μg <250 <250 <250 <250 <250 <250GPI-0100) Control <250 <250 <250 <250 <250 <250 (CoVaccine HT) Control <250 <250 <250 <250 <250 <250 (Ribi R-700) *(ND: titer not determined) Table 10 shows the cytokine secretion data obtained from antigen-stimulated immune splenocytes. It also lists the Stimulation Index expressed as the fold-increase of tritiated thymidine uptake in antigen-stimulated cells divided by unstimulatedcontrol cells of the same animal. Data from adjuvant-only control groups is included, stimulated with the antigen shown. Results shown are the mean values with standard deviation obtained using splenocyte preparations from three individual mice pergroup harvested on day 4 (upper value) and 7 (lower value) post 3rd dose of vaccine. TABLE-US-00010 TABLE 10 Summary of Cellular Responses Elicited During the Dose/Adjuvant Study Stimulation IL-5 TNF-α IFN-γ Vaccine formulation index IL-4 [ng/ml] [ng/ml] [ng/ml] [ng/ml] 1 μg GP95 4.3 ± 3.6 0.9 ± 1.2 8.3± 1.2 1.0 ± 0.3 3.8 ± 2.2 (250 μg GPI-0100) 3 μg GP95 6.5 ± 3.6 1.7 ± 1.8 7.4 ± 1.3 1.3 ± 0.7 4.6 ± 0.4 (250 μg GPI-0100) 9 μg GP95 5.7 ± 3.3 1.3 ± 1.3 3.3 ± 2.9 1.2 ± 1.6 2.6 ± 2.5 (250μg GPI-0100) 1 μg GP95 9.7 ± 5.6 0.0 ± 0.0 2.8 ± 0.5 1.4 ± 0.1 3.4 ± 0.3 (CoVaccine HT) 3 μg GP95 5.7 ± 0.8 0.0 ± 0.0 3.3 ± 1.2 1.4 ± 0.3 3.5 ± 0.7 (CoVaccine HT) 9 μg GP95 6.1 ± 1.7 2.3 ± 3.43.9 ± 3.0 1.4 ± 1.0 3.4 ± 1.5 (CoVaccine HT) 1 μg GP95 1.8 ± 0.7 0.0 ± 0.0 0.3 ± 0.5 1.4 ± 1.0 2.8 ± 2.2 (Ribi R-700) 3 μg GP95 33.0 ± 34.0 0.0 ± 0.0 0.3 ± 0.4 1.0 ± 1.6 1.7 ± 2.8 (Ribi R-700) 9μg GP95 18.7 ± 6.9 0.0 ± 0.0 0.1 ± 0.1 0.3 ± 0.3 0.3 ± 0.3 (Ribi R-700) Control (250 μg GPI- 1.2 ± 0.5 0.0 ± 0.0 0.0 ± 0.0 0.0 ± 0.0 0.0 ± 0.0 0100) GP95 stim. Control (CoVaccine 1.2 ± 0.5 0.0 ± 0.00.0 ± 0.0 0.0 ± 0.0 0.0 ± 0.0 HT) GP95 stimulated Control (Ribi R-700) 1.1 ± 0.2 0.0 ± 0.0 0.0 ± 0.0 0.0 ± 0.0 0.0 ± 0.0 GP95 stimulated 10 μg VP40 2.9 ± 0.8 4.2 ± 3.6 6.2 ± 2.1 0.9 ± 0.7 1.9 ± 2.2(250 μg GPI-0100) 10 μg VP40 20.9 ± 7.9 3.7 ± 3.6 4.8 ± 2.6 0.7 ± 0.4 1.6 ± 0.4 (CoVaccine HT) 10 μg VP40 26.5 ± 15.0 0.0 ± 0.0 0.8 ± 1.5 0.0 ± 0.0 0.0 ± 0.0 (Ribi R-700) Control (GPI-0100) 1.2 ± 0.30.0 ± 0.0 0.0 ± 0.0 0.0 ± 0.0 0.0 ± 0.0 VP40 stim. Control (CoVaccine 1.6 ± 0.5 0.0 ± 0.0 0.0 ± 0.0 0.0 ± 0.0 0.0 ± 0.0 HT) VP40 stim. Control (Ribi R-700) 1.4 ± 0.2 0.0 ± 0.0 0.0 ± 0.0 0.0 ± 0.0 0.0± 0.0 VP40 stimulated Overall the GPI-0100 adjuvant shows a strong advantage with both antigens compared to other formulations for both humoral and cellular responses. Based on the same immunological markers, CoVaccine HT appears to have a moderate effect. Theresponses elicited by formulations containing Ribi R-700 (especially based on cytokine responses) are the lowest. As seen in the previous immunogenicity study, the kinetics of the response to VP40 are more rapid compared to the other antigens. Splenocytes from immunized mice receiving the leading vaccine formulations (GP95 and VP40 formulated with GPI-0100) harvested on day 4 post third dose were cultured at a final concentration of 2×106/ml in the presence (or absence) ofeither GP95 or VP40 antigens or Pokeweed mitogen (PWM) at final concentrations of 5 μg/ml for 18 hrs. Cells were then harvested, washed, and stained with fluorochrome-conjugated antibodies to stain for cell surface (CD3 or CD19) and activationmarkers (CD69), and then analyzed by flow cytometry. The data shown in FIG. 10 demonstrates that the total percentage of CD 19+ B-cells stayed approximately the same regardless of the treatment (none, PWM, or antigen). Addition of Pokeweed mitogen activated (CD69+) about 40% of the cells in allmice tested. In contrast to the control groups (GPI-0100 only), the cells of the four mice immunized with recombinant Ebola antigens showed a substantial increase (five fold above background or more) in expression of surface activation marker CD69 inresponse to in vitro antigen stimulation. This suggests that the tested vaccine formulations induce strong cellular memory in vaccinated Balb/c mice. Example 5 Protective Efficacy of Ebola Vaccine Candidates in the Mouse Challenge Model for Ebola Zaire Vaccine formulations containing 10 μg of either GP95, VP40, or VP24 as individual antigens or the mix of all three, unadjuvanted or in combination with the adjuvants GPI-0100, CoVaccine HT, Talabostat or PT-510 (both from Point Therapeutics,Inc., Boston, Mass.) were tested at USAMRIID in the mouse challenge model for protection against Ebola Zaire virus. GPI-0100 as well as CoVaccine HT were co-administered to animals in injectable formulations, while Talabostat (10 μg doses) and PT-510(80 μg doses) were given by oral gavage on days -1, 0 and +1 relative to injection of antigen preparation (these animals received antigen preparations in PBS). Three doses of vaccine were administered subcutaneously in 4-week intervals and yieldedhigh serum antibody titers in all vaccinated mice (table 11). VP40 showed excellent immunogenicity which can be seen in the ELISA titers raised by unadjuvanted formulations in groups 11 (even after one dose). GP95 alone (group 1) showed a similarimmunogenicity as VP40 while VP24 without adjuvant is raising moderate ELISA antibody titers. The efficacy against virus challenge by i.p. injection of 100 pfu of mouse adapted Ebola virus approximately two weeks after the last dose is also shown intable 11. The column showing survivors lists animals that remained healthy for up to 20 days after challenge (when the experiment was terminated) and all surviving mice in groups 3, 4, 5, 16, 17, 18, 19 and 20 remained healthy throughout the study. Incontrast, survivors in groups 1, 2, 8, 10 and 22 developed signs of disease for at least one day during the experiment. The vaccine formulation containing Ebola Zaire GP95 with CoVaccine HT as well as Talabostat or PT-510 completely protected all of theanimals from both morbidity and mortality. Vaccine formulations containing all three antigens (GP95, VP40 and VP24) and either of the adjuvants showed the same level of protection. Furthermore, the combination of the three proteins without adjuvant,completely protected 9/10 animals. GP95 alone or formulated with GPI-0100 partially protected the animals against death but not morbidity. Interestingly, 6 of 10 animals in the group vaccinated with VP24 in formulation with CoVaccine HT as well as twoanimals receiving the antigens and oral doses of PT-510 survived the challenge. In contrast, all animals receiving VP40 alone with or without adjuvant succumbed to the infection despite very high levels of serum antibodies. In combination, these results demonstrate that vaccine formulations containing recombinant Ebola subunit antigens produced from stably transformed insect cell lines have the potential to be used as efficacious vaccine products, even withoutadjuvant. TABLE-US-00011 TABLE 11 Vaccine formulations and results of the mouse challenge study No. Day 20 (Jul. 05, 2005) Group of ELISA titers Percent no. Adjuvant Immunogen mice first second third dead healthy alive 1 NONE 10 μg GP95 10 155 52014030 3 7 70% all were sick 2 GPI-0100 10 μg GP95 10 100 1251 19507 1 9 90% all were sick 3 CoVaccine HT 10 μg GP95 10 300 58520 65315 0 10 100% 4 Talabostat 10 μg GP95 10 90 14030 72900 0 9 100% 5 PT510 10 μg GP95 10 100 14913 72900 0 9 100%6 NONE 10 μg VP24 10 72 139 580 10 0 0% 7 GPI-0100 10 μg VP24 10 46 89 579 10 0 0% 8 CoVaccine HT 10 μg VP24 10 155 27,122 37,710 4 6 60% all were sick 9 Talabostat 10 μg VP24 10 193 1251 12570 10 0 0% 10 PT510 10 μg VP24 10 193 335 2419 82 20% (were sick) 11 NONE 10 μg VP40 10 100 139 24,300 10 0 0% 12 GPI-0100 10 μg VP40 10 80 33,786 101,359 10 0 0% 13 CoVaccine HT 10 μg VP40 10 3,754 1,415,647 1,968,300 10 0 0% 14 Talabostat 10 μg VP40 10 269 647 244096 10 0 0% 15 PT510 10μg VP40 10 193 580 339389 10 0 0% 16 NONE mix 10 155 900 21,772 1 9 90% 17 GPI-0100 mix 10 112 33,786 101,359 0 10 100% 18 CoVaccine HT mix 10 1,740 378,800 656,100 0 10 100% 19 Talabostat mix 10 235 8100 134213 0 9 100% 20 PT510 mix 10 128 4971 93058 0 9 100% 21 NONE NONE 9 64 72 72 9 0 0% 22 GPI-0100 NONE 10 51 46 57 9 1 10% Was sick 23 CoVaccine HT NONE 9 128 208 266 9 0 0% 24 Talabostat NONE 10 100 111 139 10 0 0% 25 PT510 NONE 10 125 100 112 10 0 0% > 2TEbolaZaire Virus r Ile Pro Leu Gly Val Ile His Asn Ser Thr Leu Gln Val Seral Asp Lys Leu Val Cys Arg Asp Lys Leu Ser Ser Thr Asn Gln 2Leu Arg Ser Val Gly Leu Asn Leu Glu Gly Asn Gly Val Ala Thr Asp 35 4 Pro Ser Ala Thr LysArg Trp Gly Phe Arg Ser Gly Val Pro Pro 5Lys Val Val Asn Tyr Glu Ala Gly Glu Trp Ala Glu Asn Cys Tyr Asn65 7Leu Glu Ile Lys Lys Pro Asp Gly Ser Glu Cys Leu Pro Ala Ala Pro 85 9 Gly Ile Arg Gly Phe Pro Arg Cys Arg Tyr Val His Lys ValSer Thr Gly Pro Cys Ala Gly Asp Phe Ala Phe His Lys Glu Gly Ala Phe Leu Tyr Asp Arg Leu Ala Ser Thr Val Ile Tyr Arg Gly Thr Phe Ala Glu Gly Val Val Ala Phe Leu Ile Leu Pro Gln Ala Lys Lys Asp PhePhe Ser Ser His Pro Leu Arg Glu Pro Val Asn Ala Thr Asp Pro Ser Ser Gly Tyr Tyr Ser Thr Thr Ile Arg Tyr Gln Ala Gly Phe Gly Thr Asn Glu Thr Glu Tyr Leu Phe Glu Val Asp Asn 2hr Tyr Val Gln Leu Glu Ser Arg PheThr Pro Gln Phe Leu Leu 222u Asn Glu Thr Ile Tyr Thr Ser Gly Lys Arg Ser Asn Thr Thr225 234s Leu Ile Trp Lys Val Asn Pro Glu Ile Asp Thr Thr Ile Gly 245 25u Trp Ala Phe Trp Glu Thr Lys Lys Asn Leu Thr Arg Lys Ile Arg267u Glu Leu Ser Phe Thr Val Val Ser Asn Gly Ala Lys Asn Ile 275 28r Gly Gln Ser Pro Ala Arg Thr Ser Ser Asp Pro Gly Thr Asn Thr 29hr Glu Asp His Lys Ile Met Ala Ser Glu Asn Ser Ser Ala Met33al Gln Val HisSer Gln Gly Arg Glu Ala Ala Val Ser His Leu Thr 325 33r Leu Ala Thr Ile Ser Thr Ser Pro Gln Ser Leu Thr Thr Lys Pro 345o Asp Asn Ser Thr His Asn Thr Pro Val Tyr Lys Leu Asp Ile 355 36r Glu Ala Thr Gln Val Glu Gln His His ArgArg Thr Asp Asn Asp 378r Ala Ser Asp Thr Pro Ser Ala Thr Thr Ala Ala Gly Pro Pro385 39la Glu Asn Thr Asn Thr Ser Lys Ser Thr Asp Phe Leu Asp Pro 44hr Thr Thr Ser Pro Gln Asn His Ser Glu Thr Ala Gly Asn Asn 423r His His Gln Asp Thr Gly Glu Glu Ser Ala Ser Ser Gly Lys 435 44u Gly Leu Ile Thr Asn Thr Ile Ala Gly Val Ala Gly Leu Ile Thr 456y Arg Arg Thr Arg Arg Glu Ala Ile Val Asn Ala Gln Pro Lys465 478n Pro Asn LeuHis Tyr Trp Thr Thr Gln Asp Glu Gly Ala Ala 485 49e Gly Leu Ala Trp Ile Pro Tyr Phe Gly Pro Ala Ala Glu Gly Ile 55le Glu Gly Leu Met His Asn Gln Asp Gly Leu Ile Cys Gly Leu 5525Arg Gln Leu Ala Asn Glu Thr Thr Gln Ala Leu GlnLeu Phe Leu Arg 534r Thr Glu Leu Arg Thr Phe Ser Ile Leu Asn Arg Lys Ala Ile545 556e Leu Leu Gln Arg Trp Gly Gly Thr Cys His Ile Leu Gly Pro 565 57p Cys Cys Ile Glu Pro His Asp Trp Thr Lys Asn Ile Thr Asp Lys 589p Gln Ile Ile His Asp Phe Val Asp Lys Thr Leu Pro Asp Gln 595 6ly Asp Asn Asp Asn Trp Trp Thr Gly 6Ebola Zaire Virus 2acgtacagat ctatcccact tggagtcatc cacaatagca cattacaggt tagtgatgtc 6ctag tttgtcgtga caaactgtcatccacaaatc aattgagatc agttggactg tcgaag ggaatggagt ggcaactgac gtgccatctg caactaaaag atggggcttc ccggtg tcccaccaaa ggtggtcaat tatgaagctg gtgaatgggc tgaaaactgc 24cttg aaatcaaaaa acctgacggg agtgagtgtc taccagcagc gccagacggg 3gggcttcccccggtg ccggtatgtg cacaaagtat caggaacggg accgtgtgcc 36tttg ccttccataa agagggtgct ttcttcctgt atgatcgact tgcttccaca 42tacc gaggaacgac tttcgctgaa ggtgtcgttg catttctgat actgccccaa 48aagg acttcttcag ctcacacccc ttgagagagc cggtcaatgcaacggaggac 54agtg gctactattc taccacaatt agatatcagg ctaccggttt tggaaccaat 6agagt acttgttcga ggttgacaat ttgacctacg tccaacttga atcaagattc 66cagt ttctgctcca gctgaatgag acaatatata caagtgggaa aaggagcaat 72ggaa aactaatttg gaaggtcaaccccgaaattg atacaacaat cggggagtgg 78tggg aaactaaaaa aaacctcact agaaaaattc gcagtgaaga gttgtctttc 84gtat caaacggagc caaaaacatc agtggtcaga gtccggcgcg aacttcttcc 9aggga ccaacacaac aactgaagac cacaaaatca tggcttcaga aaattcctct 96gttcaagtgcacag tcaaggaagg gaagctgcag tgtcgcatct aacaaccctt acaatct ccacgagtcc ccaatccctc acaaccaaac caggtccgga caacagcacc aatacac ccgtgtataa acttgacatc tctgaggcaa ctcaagttga acaacatcac agaacag acaacgacag cacagcctcc gacactccct ctgccacgaccgcagccgga ccaaaag cagagaacac caacacgagc aagagcactg acttcctgga ccccgccacc acaagtc cccaaaacca cagcgagacc gctggcaaca acaacactca tcaccaagat ggagaag agagtgccag cagcgggaag ctaggcttaa ttaccaatac tattgctgga gcaggac tgatcacaggcgggagaaga actcgaagag aagcaattgt caatgctcaa aaatgca accctaattt acattactgg actactcagg atgaaggtgc tgcaatcgga gcctgga taccatattt cgggccagca gccgagggaa tttacataga ggggctaatg aatcaag atggtttaat ctgtgggttg agacagctgg ccaacgagac gactcaagctcaactgt tcctgagagc cacaactgag ctacgcacct tttcaatcct caaccgtaag attgatt tcttgctgca gcgatggggc ggcacatgcc acattctggg accggactgc atcgaac cacatgattg gaccaagaac ataacagaca aaattgatca gattattcat tttgttg ataaaaccct tccggaccagggggacaatg acaattggtg gacaggatag ctcgagg tacgt 5la Zaire Virus 3atcccacttg gagtcatcca caatagcaca ttacaggtta gtgatgtcga caaactagtt 6gaca aactgtcatc cacaaatcaa ttgagatcag ttggactgaa tctcgaaggg gagtgg caactgacgt gccatctgcaactaaaagat ggggcttcag gtccggtgtc caaagg tggtcaatta tgaagctggt gaatgggctg aaaactgcta caatcttgaa 24aaac ctgacgggag tgagtgtcta ccagcagcgc cagacgggat tcggggcttc 3gtgcc ggtatgtgca caaagtatca ggaacgggac cgtgtgccgg agactttgcc 36aaagagggtgcttt cttcctgtat gatcgacttg cttccacagt tatctaccga 42actt tcgctgaagg tgtcgttgca tttctgatac tgccccaagc taagaaggac 48agct cacacccctt gagagagccg gtcaatgcaa cggaggaccc gtctagtggc 54tcta ccacaattag atatcaggct accggttttg gaaccaatgagacagagtac 6cgagg ttgacaattt gacctacgtc caacttgaat caagattcac accacagttt 66cagc tgaatgagac aatatataca agtgggaaaa ggagcaatac cacgggaaaa 72tgga aggtcaaccc cgaaattgat acaacaatcg gggagtgggc cttctgggaa 78aaaa acctcactag aaaaattcgcagtgaagagt tgtctttcac agttgtatca 84gcca aaaacatcag tggtcagagt ccggcgcgaa cttcttccga cccagggacc 9aacaa ctgaagacca caaaatcatg gcttcagaaa attcctctgc aatggttcaa 96agtc aaggaaggga agctgcagtg tcgcatctaa caacccttgc cacaatctcc agtccccaatccctcac aaccaaacca ggtccggaca acagcaccca taatacaccc tataaac ttgacatctc tgaggcaact caagttgaac aacatcaccg cagaacagac gacagca cagcctccga cactccctct gccacgaccg cagccggacc cccaaaagca aacacca acacgagcaa gagcactgac ttcctggacc ccgccaccacaacaagtccc aaccaca gcgagaccgc tggcaacaac aacactcatc accaagatac cggagaagag gccagca gcgggaagct aggcttaatt accaatacta ttgctggagt cgcaggactg acaggcg ggagaagaac tcgaagagaa gcaattgtca atgctcaacc caaatgcaac aatttac attactggactactcaggat gaaggtgctg caatcggact ggcctggata tatttcg ggccagcagc cgagggaatt tacatagagg ggctaatgca caatcaagat ttaatct gtgggttgag acagctggcc aacgagacga ctcaagctct tcaactgttc agagcca caactgagct acgcaccttt tcaatcctca accgtaaggc aattgatttcctgcagc gatggggcgg cacatgccac attctgggac cggactgctg tatcgaacca gattgga ccaagaacat aacagacaaa attgatcaga ttattcatga ttttgttgat acccttc cggaccaggg ggacaatgac aattggtgga caggatagta a 9PRTEbola Sudan Virus 4Arg Ser Pro Trp Met ProLeu Gly Val Val Thr Asn Ser Thr Leu Gluhr Glu Ile Asp Gln Leu Val Cys Lys Asp His Leu Ala Ser Thr 2Asp Gln Leu Lys Ser Val Gly Leu Asn Leu Glu Gly Ser Gly Val Ser 35 4 Asp Ile Pro Ser Ala Thr Lys Arg Trp Gly Phe Arg Ser GlyVal 5Pro Pro Lys Val Val Ser Tyr Glu Ala Gly Glu Trp Ala Glu Asn Cys65 7Tyr Asn Leu Glu Ile Lys Lys Pro Asp Gly Ser Glu Cys Leu Pro Pro 85 9 Pro Asp Gly Val Arg Gly Phe Pro Arg Cys Arg Tyr Val His Lys Gln Gly Thr GlyPro Cys Pro Gly Asp Tyr Ala Phe His Lys Asp Ala Phe Phe Leu Tyr Asp Arg Leu Ala Ser Thr Val Ile Tyr Arg Val Asn Phe Ala Glu Gly Val Ile Ala Phe Leu Ile Leu Ala Lys Pro Lys Glu Thr Phe Leu Gln Ser Pro Pro IleArg Glu Ala Val Asn Thr Glu Asn Thr Ser Ser Tyr Tyr Ala Thr Ser Tyr Leu Glu Tyr Ile Glu Asn Phe Gly Ala Gln His Ser Thr Thr Leu Phe Lys Ile 2sn Asn Thr Phe Val Arg Leu Asp Arg Pro His Thr Pro Gln Phe 222e Gln Leu Asn Asp Thr Ile His Leu His Gln Gln Leu Ser Asn225 234r Gly Arg Leu Ile Trp Thr Leu Asp Ala Asn Ile Asn Ala Asp 245 25e Gly Glu Trp Ala Phe Trp Glu Asn Lys Lys Asn Leu Ser Glu Gln 267g Gly Glu Glu LeuSer Phe Glu Ala Leu Ser Leu Asn Glu Thr 275 28u Asp Asp Asp Ala Ala Ser Ser Arg Ile Thr Lys Gly Arg Ile Ser 29rg Ala Thr Arg Lys Tyr Ser Asp Leu Val Pro Lys Asn Ser Pro33ly Met Val Pro Leu His Ile Pro Glu Gly Glu ThrThr Leu Pro Ser 325 33n Asn Ser Thr Glu Gly Arg Arg Val Gly Val Asn Thr Gln Glu Thr 345r Glu Thr Ala Ala Thr Ile Ile Gly Thr Asn Gly Asn His Met 355 36n Ile Ser Thr Ile Gly Ile Arg Pro Ser Ser Ser Gln Ile Pro Ser 378r Pro Thr Thr Ala Pro Ser Pro Glu Ala Gln Thr Pro Thr Thr385 39hr Ser Gly Pro Ser Val Met Ala Thr Glu Glu Pro Thr Thr Pro 44ly Ser Ser Pro Gly Pro Thr Thr Glu Ala Pro Thr Leu Thr Thr 423u Asn Ile Thr ThrAla Val Lys Thr Val Leu Pro Gln Glu Ser 435 44r Ser Asn Gly Leu Ile Thr Ser Thr Val Thr Gly Ile Leu Gly Ser 456y Leu Arg Lys Arg Ser Arg Arg Gln Thr Asn Thr Lys Ala Thr465 478s Cys Asn Pro Asn Leu His Tyr Trp Thr AlaGln Glu Gln His 485 49n Ala Ala Gly Ile Ala Trp Ile Pro Tyr Phe Gly Pro Gly Ala Glu 55le Tyr Thr Glu Gly Leu Met His Asn Gln Asn Ala Leu Val Cys 5525Gly Leu Arg Gln Leu Ala Asn Glu Thr Thr Gln Ala Leu Gln Leu Phe 534g Ala Thr Thr Glu Leu Arg Thr Tyr Thr Ile Leu Asn Arg Lys545 556e Asp Phe Leu Leu Arg Arg Trp Gly Gly Thr Cys Arg Ile Leu 565 57y Pro Asp Cys Cys Ile Glu Pro His Asp Trp Thr Lys Asn Ile Thr 589s Ile Asn Gln IleIle His Asp Phe Ile Asp Asn Pro Leu Pro 595 6sn Gln Asp Asn Asp Asp Asn Trp Trp Thr Gly 6Ebola Sudan Virus 5aggttccatg gatgcctttg ggtgttgtga ctaacagcac tttagaagta acagagattg 6tagt ctgcaaggat catcttgcat ctactgacca gctgaaatcagttggtctca cgaggg gagcggagta tctactgata tcccatctgc aacaaagcgt tggggcttca tggtgt tcctcccaag gtggtcagct atgaagcggg agaatgggct gaaaattgct 24ttga aataaagaag ccggacggga gcgaatgctt acccccaccg ccagatggtg 3ggctt tccaaggtgc cgctatgttcacaaagccca aggaaccggg ccctgcccag 36acgc ctttcacaag gatggagctt tcttcctcta tgacaggctg gcttcaactg 42acag aggagtcaat tttgctgagg gggtaattgc attcttgata ttggctaaac 48aaac gttccttcag tcacccccca ttcgagaggc agtaaactac actgaaaata 54gttattatgccaca tcctacttgg agtatgaaat cgaaaatttt ggtgctcaac 6acgac ccttttcaaa attgacaata atacttttgt tcgtctggac aggccccaca 66agtt ccttttccag ctgaatgata ccattcacct tcaccaacag ttgagtaata 72ggag actaatttgg acactagatg ctaatatcaa tgctgatattggtgaatggg 78ggga aaataaaaaa aatctctccg aacaactacg tggagaagag ctgtctttcg 84tatc gctcaacgag acagaagacg atgatgcggc atcgtcgaga attacaaagg 9atctc cgaccgggcc accaggaagt attcggacct ggttccaaag aattcccctg 96ttcc attgcacata ccagaaggggaaacaacatt gccgtctcag aattcgacag gtcgaag agtaggtgtg aacactcagg agaccattac agagacagct gcaacaatta gcactaa cggcaaccat atgcagatct ccaccatcgg gataagaccg agctccagcc tcccgag ttcctcaccg accacggcac caagccctga ggctcagacc cccacaaccccatcagg tccatcagtg atggccaccg aggaaccaac aacaccaccg ggaagctccc gcccaac aacagaagca cccactctca ccaccccaga aaatataaca acagcggtta ctgtcct gccacaggag tccacaagca acggtctaat aacttcaaca gtaacaggga ttgggag tcttgggctt cgaaaacgcagcagaagaca aactaacacc aaagccacgg agtgcaa tcccaactta cactactgga ctgcacaaga acaacataat gctgctggga cctggat cccgtacttt ggaccgggtg cggaaggcat atacactgaa ggcctgatgc accaaaa tgccttagtc tgtggactta ggcaacttgc aaatgaaaca actcaagctcagctttt cttaagagcc acaacggagc tgcggacata taccatactc aataggaagg tagattt ccttctgcga cgatggggcg ggacatgcag gatcctggga ccagattgtt ttgagcc acatgattgg acaaaaaaca tcactgataa aatcaaccaa atcatccatg tcatcga caacccctta cctaatcaggataatgatga taattggtgg acgggctagt tcgacaa cct 45DNAEbola Sudan Virus 6atgcctttgg gtgttgtgac taacagcact ttagaagtaa cagagattga ccagctagtc 6gatc atcttgcatc tactgaccag ctgaaatcag ttggtctcaa cctcgagggg gagtat ctactgatat cccatctgcaacaaagcgtt ggggcttcag atctggtgtt ccaagg tggtcagcta tgaagcggga gaatgggctg aaaattgcta caatcttgaa 24aagc cggacgggag cgaatgctta cccccaccgc cagatggtgt cagaggcttt 3gtgcc gctatgttca caaagcccaa ggaaccgggc cctgcccagg tgactacgcc 36aaggatggagcttt cttcctctat gacaggctgg cttcaactgt aatttacaga 42aatt ttgctgaggg ggtaattgca ttcttgatat tggctaaacc aaaagaaacg 48cagt caccccccat tcgagaggca gtaaactaca ctgaaaatac atcaagttat 54acat cctacttgga gtatgaaatc gaaaattttg gtgctcaacactccacgacc 6caaaa ttgacaataa tacttttgtt cgtctggaca ggccccacac gcctcagttc 66cagc tgaatgatac cattcacctt caccaacagt tgagtaatac aactgggaga 72tgga cactagatgc taatatcaat gctgatattg gtgaatgggc tttttgggaa 78aaaa atctctccga acaactacgtggagaagagc tgtctttcga agctttatcg 84gaga cagaagacga tgatgcggca tcgtcgagaa ttacaaaggg aagaatctcc 9ggcca ccaggaagta ttcggacctg gttccaaaga attcccctgg gatggttcca 96atac cagaagggga aacaacattg ccgtctcaga attcgacaga aggtcgaaga ggtgtgaacactcagga gaccattaca gagacagctg caacaattat aggcactaac aaccata tgcagatctc caccatcggg ataagaccga gctccagcca aatcccgagt tcaccga ccacggcacc aagccctgag gctcagaccc ccacaaccca cacatcaggt tcagtga tggccaccga ggaaccaaca acaccaccgg gaagctcccccggcccaaca gaagcac ccactctcac caccccagaa aatataacaa cagcggttaa aactgtcctg caggagt ccacaagcaa cggtctaata acttcaacag taacagggat tcttgggagt gggcttc gaaaacgcag cagaagacaa actaacacca aagccacggg taagtgcaat aacttac actactggactgcacaagaa caacataatg ctgctgggat tgcctggatc tactttg gaccgggtgc ggaaggcata tacactgaag gcctgatgca taaccaaaat ttagtct gtggacttag gcaacttgca aatgaaacaa ctcaagctct gcagcttttc agagcca caacggagct gcggacatat accatactca ataggaaggc catagatttcctgcgac gatggggcgg gacatgcagg atcctgggac cagattgttg cattgagcca gattgga caaaaaacat cactgataaa atcaaccaaa tcatccatga tttcatcgac cccttac ctaatcagga taatgatgat aattggtgga cgggc burg Virus 7Arg Ser Leu Pro Ile Leu Glu Ile Ala Ser Asn Asn Gln Pro GlnAsnsp Ser Val Cys Ser Gly Thr Leu Gln Lys Thr Glu Asp Val His 2Leu Met Gly Phe Thr Leu Ser Gly Gln Lys Val Ala Asp Ser Pro Leu 35 4 Ala Ser Lys Arg Trp Ala Phe Arg Thr Gly Val Pro Pro Lys Asn 5Val Glu Tyr Thr Glu GlyGlu Glu Ala Lys Thr Cys Tyr Asn Ile Ser65 7Val Thr Asp Pro Ser Gly Lys Ser Leu Leu Leu Asp Pro Pro Thr Asn 85 9 Arg Asp Tyr Pro Lys Cys Lys Thr Ile His His Ile Gln Gly Gln Pro His Ala Gln Gly Ile Ala Leu His Leu Trp Gly AlaPhe Phe Tyr Asp Arg Ile Ala Ser Thr Thr Met Tyr Arg Gly Arg Val Phe Glu Gly Asn Ile Ala Ala Met Ile Val Asn Lys Thr Val His Lys Met Ile Phe Ser Arg Gln Gly Gln Gly Tyr Arg His Met Asn Leu Thr ThrAsn Lys Tyr Trp Thr Ser Asn Asn Gly Thr Gln Thr Asn Asp Gly Cys Phe Gly Ala Leu Gln Glu Tyr Asn Ser Thr Lys Asn Gln 2ys Ala Pro Ser Lys Ile Pro Ser Pro Leu Pro Thr Ala Arg Pro 222e Lys Pro Thr Ser Thr Pro ThrAsp Ala Thr Thr Leu Asn Thr225 234p Pro Asn Asn Asp Asp Glu Asp Leu Ile Thr Ser Gly Ser Gly 245 25r Gly Glu Gln Glu Pro Tyr Thr Thr Ser Asp Ala Val Thr Lys Gln 267u Ser Ser Thr Met Pro Pro Thr Pro Ser Pro Gln Pro SerThr 275 28o Gln Gln Glu Gly Asn Asn Thr Asp His Ser Gln Gly Thr Val Thr 29ro Asn Lys Thr Asn Thr Thr Ala Gln Pro Ser Met Pro Pro His33sn Thr Thr Ala Ile Ser Thr Asn Asn Thr Ser Lys Asn Asn Phe Ser 325 33r Leu SerVal Ser Leu Gln Asn Thr Thr Asn Tyr Asp Thr Gln Ser 345a Thr Glu Asn Glu Gln Thr Ser Ala Pro Ser Lys Thr Thr Leu 355 36o Pro Thr Gly Asn Leu Thr Thr Ala Lys Ser Thr Asn Asn Thr Lys 378o Thr Thr Thr Ala Pro Asn Met ThrAsn Gly His Leu Thr Ser385 39er Pro Thr Pro Asn Pro Thr Thr Gln His Leu Val Tyr Phe Arg 44ys Arg Ser Ile Leu Trp Arg Glu Gly Asp Met Phe Pro Phe Leu 423y Leu Ile Asn Ala Pro Ile Asp Phe Asp Pro Val Pro Asn Thr435 44s Thr Ile Phe Asp Glu Ser Ser Ser Ser Gly Ala Ser Ala Glu Glu 456n His Ala Ser Pro Asn Ile Ser Leu Thr Leu Ser Tyr Phe Pro465 478e Asn Glu Asn Thr Ala Tyr Ser Gly Glu Asn Glu Asn Asp Cys 485 49p Ala Glu LeuArg Ile Trp Ser Val Gln Glu Asp Asp Leu Ala Ala 55eu Ser Trp Ile Pro Phe Phe Gly Pro Gly Ile Glu Gly Leu Tyr 5525Thr Ala Gly Leu Ile Lys Asn Gln Asn Asn Leu Val Cys Arg Leu Arg 534u Ala Asn Gln Thr Ala Lys Ser Leu GluLeu Leu Leu Arg Val545 556r Glu Glu Arg Thr Phe Ser Leu Ile Asn Arg His Ala Ile Asp 565 57e Leu Leu Thr Arg Trp Gly Gly Thr Cys Lys Val Leu Gly Pro Asp 589s Ile Gly Ile Glu Asp Leu Ser Arg Asn Ile Ser Glu Gln Ile 5956sp Gln Ile Lys Lys Asp Glu Gln Lys Glu Gly Thr Gly Trp Gly Leu 662y Lys Trp Trp Thr Ser625 63NAMarburg Virus 8aggttagatc tctccctatt ttagagatag ctagtaacaa tcaaccccaa aatgtggatt 6gctc cggaactctc cagaagacag aagatgtccatctgatggga ttcacactga gcaaaa agttgctgat tcccctttgg aggcatccaa gcgatgggct ttcaggacag acctcc caagaatgtt gagtatacag aaggggagga agccaaaaca tgctacaata 24taac ggatccctct ggaaaatcct tgctgttgga tcctcctacc aacatccgtg 3cctaa atgcaaaactatccatcata ttcaaggtca aaaccctcat gcgcaaggga 36tcca tttgtgggga gcatttttcc tgtatgatcg cattgcctcc acaacaatgt 42gcag agtcttcact gaagggaaca tagcagctat gattgtcaat aagacagtgc 48tgat tttctcgagg caaggacagg ggtaccgtca catgaatctg acttctacta54attg gacaagtaac aatggaacac aaacgaatga cactggatgc ttcggtgctc 6gaata caactccacg aagaatcaaa catgtgctcc gtccaaaata ccctcaccac 66cagc ccgtccagag atcaaaccca caagcacccc aactgatgcc accacactca 72caga cccaaacaat gatgatgagg acctcataacatccggttca gggtccggag 78aacc ctatacaact tcagatgcgg tcactaagca agggctttca tcaacaatgc 84ctcc ctcaccacaa ccaagcacgc cacagcaaga aggaaacaac acagaccatt 9ggtac tgtgactgaa cccaacaaaa ccaacacaac ggcacaaccg tccatgcccc 96acac cactgcaatctctactaaca acacctccaa gaacaacttc agcaccctct tatcact acaaaacacc accaattacg acacacagag cacagccact gaaaatgaac ccagtgc cccctcgaaa acaaccctgc ctccaacagg aaatcttacc acagcaaaga ctaacaa cacgaaaggc cccaccacaa cggcaccaaa tatgacaaat gggcatttaagtccctc ccccaccccc aacccgacca cacaacatct tgtatatttc agaaagaaac gtatcct ctggagggaa ggcgacatgt ttccttttct ggacgggtta ataaatgctc ttgattt tgatccagtt ccaaatacaa agacgatctt tgatgaatct tctagttctg cttcggc tgaggaagat caacatgcctcccccaatat cagtttaact ttatcctatt ctaatat aaatgaaaac actgcctact ctggagaaaa tgagaacgat tgtgatgcag taagaat ttggagcgtt caggaggatg acctggcagc agggctcagt tggataccgt ttggccc tggaatcgaa ggactttata ctgctggttt aattaaaaac caaaacaatttctgcag gttgaggcgt ctagccaatc aaactgccaa atccttggaa ctcttattaa tcacaac cgaggaaagg acattttcct taattaatag acatgccatt gactttctac caaggtg gggaggaaca tgcaaagtgc ttggacctga ttgttgcatt ggaatagaag tgtccag gaatatttcg gaacaaattgaccaaatcaa aaaagatgaa caaaaagagg ctggttg gggtctaggt ggtaaatggt ggacatccta gtaagtcgac aacct 98DNAMarburg Virus 9aggttagatc tctccctatt ttagagatag ctagtaacaa tcaaccccaa aatgtggatt 6gctc cggaactctc cagaagacag aagatgtcca tctgatgggattcacactga gcaaaa agttgctgat tcccctttgg aggcatccaa gcgatgggct ttcaggacag acctcc caagaatgtt gagtatacag aaggggagga agccaaaaca tgctacaata 24taac ggatccctct ggaaaatcct tgctgttgga tcctcctacc aacatccgtg 3cctaa atgcaaaact atccatcatattcaaggtca aaaccctcat gcgcaaggga 36tcca tttgtgggga gcatttttcc tgtatgatcg cattgcctcc acaacaatgt 42gcag agtcttcact gaagggaaca tagcagctat gattgtcaat aagacagtgc 48tgat tttctcgagg caaggacagg ggtaccgtca catgaatctg acttctacta 54attggacaagtaac aatggaacac aaacgaatga cactggatgc ttcggtgctc 6gaata caactccacg aagaatcaaa catgtgctcc gtccaaaata ccctcaccac 66cagc ccgtccagag atcaaaccca caagcacccc aactgatgcc accacactca 72caga cccaaacaat gatgatgagg acctcataac atccggttcagggtccggag 78aacc ctatacaact tcagatgcgg tcactaagca agggctttca tcaacaatgc 84ctcc ctcaccacaa ccaagcacgc cacagcaaga aggaaacaac acagaccatt 9ggtac tgtgactgaa cccaacaaaa ccaacacaac ggcacaaccg tccatgcccc 96acac cactgcaatc tctactaacaacacctccaa gaacaacttc agcaccctct tatcact acaaaacacc accaattacg acacacagag cacagccact gaaaatgaac ccagtgc cccctcgaaa acaaccctgc ctccaacagg aaatcttacc acagcaaaga ctaacaa cacgaaaggc cccaccacaa cggcaccaaa tatgacaaat gggcatttaagtccctc ccccaccccc aacccgacca cacaacatct tgtatatttc agaaagaaac gtatcct ctggagggaa ggcgacatgt ttccttttct ggacgggtta ataaatgctc ttgattt tgatccagtt ccaaatacaa agacgatctt tgatgaatct tctagttctg cttcggc tgaggaagat caacatgcctcccccaatat cagtttaact ttatcctatt ctaatat aaatgaaaac actgcctact ctggagaaaa tgagaacgat tgtgatgcag taagaat ttggagcgtt caggaggatg acctggcagc agggctcagt tggataccgt ttggccc tggaatcgaa ggactttata ctgctggttt aattaaaaac caaaacaatttctgcag gttgaggcgt ctagccaatc aaactgccaa atccttggaa ctcttattaa tcacaac cgaggaaagg acattttcct taattaatag acatgccatt gactttctac caaggtg gggaggaaca tgcaaagtgc ttggacctga ttgttgcatt ggaatagaag tgtccag gaatatttcg gaacaaattgaccaaatcaa aaaagatgaa caaaaagagg ctggttg gggtctaggt ggtaaatggt ggacatcc 46PRTEbola Zaire Virus er Ile Pro Leu Gly Val Ile His Asn Ser Thr Leu Gln Val Seral Asp Lys Leu Val Cys Arg Asp Lys Leu Ser Ser Thr Asn Gln 2Leu Arg Ser Val Gly Leu Asn Leu Glu Gly Asn Gly Val Ala Thr Asp 35 4 Pro Ser Ala Thr Lys Arg Trp Gly Phe Arg Ser Gly Val Pro Pro 5Lys Val Val Asn Tyr Glu Ala Gly Glu Trp Ala Glu Asn Cys Tyr Asn65 7Leu Glu Ile Lys Lys Pro Asp GlySer Glu Cys Leu Pro Ala Ala Pro 85 9 Gly Ile Arg Gly Phe Pro Arg Cys Arg Tyr Val His Lys Val Ser Thr Gly Pro Cys Ala Gly Asp Phe Ala Phe His Lys Glu Gly Ala Phe Leu Tyr Asp Arg Leu Ala Ser Thr Val Ile Tyr Arg Gly Thr Phe Ala Glu Gly Val Val Ala Phe Leu Ile Leu Pro Gln Ala Lys Lys Asp Phe Phe Ser Ser His Pro Leu Arg Glu Pro Val Asn Ala Thr Asp Pro Ser Ser Gly Tyr Tyr Ser Thr Thr Ile Arg Tyr Gln Ala Gly Phe GlyThr Asn Glu Thr Glu Tyr Leu Phe Glu Val Asp Asn 2hr Tyr Val Gln Leu Glu Ser Arg Phe Thr Pro Gln Phe Leu Leu 222u Asn Glu Thr Ile Tyr Thr Ser Gly Lys Arg Ser Asn Thr Thr225 234s Leu Ile Trp Lys Val Asn Pro GluIle Asp Thr Thr Ile Gly 245 25u Trp Ala Phe Trp Glu Thr Lys Lys Asn Leu Thr Arg Lys Ile Arg 267u Glu Leu Ser Phe Thr Val Val Ser Asn Gly Ala Lys Asn Ile 275 28r Gly Gln Ser Pro Ala Arg Thr Ser Ser Asp Pro Gly Thr Asn Thr 29hr Glu Asp His Lys Ile Met Ala Ser Glu Asn Ser Ser Ala Met33al Gln Val His Ser Gln Gly Arg Glu Ala Ala Val Ser His Leu Thr 325 33r Leu Ala Thr Ile Ser Thr Ser Pro Gln Ser Leu Thr Thr Lys Pro 345o Asp Asn SerThr His Asn Thr Pro Val Tyr Lys Leu Asp Ile 355 36r Glu Ala Thr Gln Val Glu Gln His His Arg Arg Thr Asp Asn Asp 378r Ala Ser Asp Thr Pro Ser Ala Thr Thr Ala Ala Gly Pro Pro385 39la Glu Asn Thr Asn Thr Ser Lys Ser ThrAsp Phe Leu Asp Pro 44hr Thr Thr Ser Pro Gln Asn His Ser Glu Thr Ala Gly Asn Asn 423r His His Gln Asp Thr Gly Glu Glu Ser Ala Ser Ser Gly Lys 435 44u Gly Leu Ile Thr Asn Thr Ile Ala Gly Val Ala Gly Leu Ile Thr 456y Arg Arg Thr Arg Arg Glu Ala Ile Val Asn Ala Gln Pro Lys465 478n Pro Asn Leu His Tyr Trp Thr Thr Gln Asp Glu Gly Ala Ala 485 49e Gly Leu Ala Trp Ile Pro Tyr Phe Gly Pro Ala Ala Glu Gly Ile 55hr Glu Gly Leu MetHis Asn Gln Asp Gly Leu Ile Cys Gly Leu 5525Arg Gln Leu Ala Asn Glu Thr Thr Gln Ala Leu Gln Leu Phe Leu Arg 534r Thr Glu Leu Arg Thr Phe Ser Ile Leu Asn Arg Lys Ala Ile545 556e Leu Leu Gln Arg Trp Gly Gly Thr Cys HisIle Leu Gly Pro 565 57p Cys Cys Ile Glu Pro His Asp Trp Thr Lys Asn Ile Thr Asp Lys 589p Gln Ile Ile His Asp Phe Val Asp Lys Thr Leu Pro Asp Gln 595 6ly Asp Asn Asp Asn Trp Trp Thr Gly Trp Arg Gln Trp Ile Pro Ala 662e Gly Val Thr Gly Val Ile Ile Ala Val Ile Ala Leu Phe Cys625 634s Lys Phe Val Phe 645NAEbola Zaire Virus cagat ctatcccact tggagtcatc cacaatagca cattacaggt tagtgatgtc 6ctag tttgtcgtga caaactgtca tccacaaatcaattgagatc agttggactg tcgaag ggaatggagt ggcaactgac gtgccatctg caactaaaag atggggcttc ccggtg tcccaccaaa ggtggtcaat tatgaagctg gtgaatgggc tgaaaactgc 24cttg aaatcaaaaa acctgacggg agtgagtgtc taccagcagc gccagacggg 3gggct tcccccggtgccggtatgtg cacaaagtat caggaacggg accgtgtgcc 36tttg ccttccataa agagggtgct ttcttcctgt atgatcgact tgcttccaca 42tacc gaggaacgac tttcgctgaa ggtgtcgttg catttctgat actgccccaa 48aagg acttcttcag ctcacacccc ttgagagagc cggtcaatgc aacggaggac54agtg gctactattc taccacaatt agatatcagg ctaccggttt tggaaccaat 6agagt acttgttcga ggttgacaat ttgacctacg tccaacttga atcaagattc 66cagt ttctgctcca gctgaatgag acaatatata caagtgggaa aaggagcaat 72ggaa aactaatttg gaaggtcaac cccgaaattgatacaacaat cggggagtgg 78tggg aaactaaaaa aaacctcact agaaaaattc gcagtgaaga gttgtctttc 84gtat caaacggagc caaaaacatc agtggtcaga gtccggcgcg aacttcttcc 9aggga ccaacacaac aactgaagac cacaaaatca tggcttcaga aaattcctct 96gttc aagtgcacagtcaaggaagg gaagctgcag tgtcgcatct aacaaccctt acaatct ccacgagtcc ccaatccctc acaaccaaac caggtccgga caacagcacc aatacac ccgtgtataa acttgacatc tctgaggcaa ctcaagttga acaacatcac agaacag acaacgacag cacagcctcc gacactccct ctgccacgac cgcagccggaccaaaag cagagaacac caacacgagc aagagcactg acttcctgga ccccgccacc acaagtc cccaaaacca cagcgagacc gctggcaaca acaacactca tcaccaagat ggagaag agagtgccag cagcgggaag ctaggcttaa ttaccaatac tattgctgga gcaggac tgatcacagg cgggagaagaactcgaagag aagcaattgt caatgctcaa aaatgca accctaattt acattactgg actactcagg atgaaggtgc tgcaatcgga gcctgga taccatattt cgggccagca gccgagggaa tttacacaga ggggctaatg aatcaag atggtttaat ctgtgggttg agacagctgg ccaacgagac gactcaagctcaactgt tcctgagagc cacaactgag ctacgcacct tttcaatcct caaccgtaag attgatt tcttgctgca gcgatggggc ggcacatgcc acattctggg accggactgc atcgaac cacatgattg gaccaagaac ataacagaca aaattgatca gattattcat tttgttg ataaaaccct tccggaccagggggacaatg acaattggtg gacaggatgg caatgga taccggcagg tattggagtt acaggcgtta taattgcagt tatcgcttta tgtatat gcaaatttgt cttttagtaa ctcgaggtac gtac 932DNAEbola Zaire Virus acttg gagtcatcca caatagcaca ttacaggtta gtgatgtcga caaactagtt6gaca aactgtcatc cacaaatcaa ttgagatcag ttggactgaa tctcgaaggg gagtgg caactgacgt gccatctgca actaaaagat ggggcttcag gtccggtgtc caaagg tggtcaatta tgaagctggt gaatgggctg aaaactgcta caatcttgaa 24aaac ctgacgggag tgagtgtcta ccagcagcgccagacgggat tcggggcttc 3gtgcc ggtatgtgca caaagtatca ggaacgggac cgtgtgccgg agactttgcc 36aaag agggtgcttt cttcctgtat gatcgacttg cttccacagt tatctaccga 42actt tcgctgaagg tgtcgttgca tttctgatac tgccccaagc taagaaggac 48agct cacaccccttgagagagccg gtcaatgcaa cggaggaccc gtctagtggc 54tcta ccacaattag atatcaggct accggttttg gaaccaatga gacagagtac 6cgagg ttgacaattt gacctacgtc caacttgaat caagattcac accacagttt 66cagc tgaatgagac aatatataca agtgggaaaa ggagcaatac cacgggaaaa72tgga aggtcaaccc cgaaattgat acaacaatcg gggagtgggc cttctgggaa 78aaaa acctcactag aaaaattcgc agtgaagagt tgtctttcac agttgtatca 84gcca aaaacatcag tggtcagagt ccggcgcgaa cttcttccga cccagggacc 9aacaa ctgaagacca caaaatcatg gcttcagaaaattcctctgc aatggttcaa 96agtc aaggaaggga agctgcagtg tcgcatctaa caacccttgc cacaatctcc agtcccc aatccctcac aaccaaacca ggtccggaca acagcaccca taatacaccc tataaac ttgacatctc tgaggcaact caagttgaac aacatcaccg cagaacagac gacagcacagcctccga cactccctct gccacgaccg cagccggacc cccaaaagca aacacca acacgagcaa gagcactgac ttcctggacc ccgccaccac aacaagtccc aaccaca gcgagaccgc tggcaacaac aacactcatc accaagatac cggagaagag gccagca gcgggaagct aggcttaatt accaatacta ttgctggagt cgcaggactg acaggcg ggagaagaactcgaagagaa gcaattgtca atgctcaacc caaatgcaac aatttac attactggac tactcaggat gaaggtgctg caatcggact ggcctggata tatttcg ggccagcagc cgagggaatt tacacagagg ggctaatgca caatcaagat ttaatct gtgggttgag acagctggcc aacgagacga ctcaagctct tcaactgttcagagcca caactgagct acgcaccttt tcaatcctca accgtaaggc aattgatttc ctgcagc gatggggcgg cacatgccac attctgggac cggactgctg tatcgaacca gattgga ccaagaacat aacagacaaa attgatcaga ttattcatga ttttgttgat acccttc cggaccaggg ggacaatgacaattggtgga caggatggag acaatggata gcaggta ttggagttac aggcgttata attgcagtta tcgctttatt ctgtatatgc tttgtct tt 28PRTEbola Zaire Virus er Met Arg Arg Val Ile Leu Pro Thr Ala Pro Pro Glu Tyr Metla Ile Tyr Pro Val ArgSer Asn Ser Thr Ile Ala Arg Gly Gly 2Asn Ser Asn Thr Gly Phe Leu Thr Pro Glu Ser Val Asn Gly Asp Thr 35 4 Ser Asn Pro Leu Arg Pro Ile Ala Asp Asp Thr Ile Asp His Ala 5Ser His Thr Pro Gly Ser Val Ser Ser Ala Phe Ile Leu Glu Ala Met657Val Asn Val Ile Ser Gly Pro Lys Val Leu Met Lys Gln Ile Pro Ile 85 9 Leu Pro Leu Gly Val Ala Asp Gln Lys Thr Tyr Ser Phe Asp Ser Thr Ala Ala Ile Met Leu Ala Ser Tyr Thr Ile Thr His Phe Gly Ala Thr Asn Pro LeuVal Arg Val Asn Arg Leu Gly Pro Gly Ile Asp His Pro Leu Arg Leu Leu Arg Ile Gly Asn Gln Ala Phe Leu Gln Glu Phe Val Leu Pro Pro Val Gln Leu Pro Gln Tyr Phe Thr Phe Leu Thr Ala Leu Lys Leu Ile Thr Gln Pro LeuPro Ala Ala Thr Thr Asp Asp Thr Pro Thr Gly Ser Asn Gly Ala Leu Arg Pro Gly 2er Phe His Pro Lys Leu Arg Pro Ile Leu Leu Pro Asn Lys Ser 222s Lys Gly Asn Ser Ala Asp Leu Thr Ser Pro Glu Lys Ile Gln225 234e Met Thr Ser Leu Gln Asp Phe Lys Ile Val Pro Ile Asp Pro 245 25r Lys Asn Ile Met Gly Ile Glu Val Pro Glu Thr Leu Val His Lys 267r Gly Lys Lys Val Thr Ser Lys Asn Gly Gln Pro Ile Ile Pro 275 28l Leu Leu Pro Lys TyrIle Gly Leu Asp Pro Val Ala Pro Gly Asp 29hr Met Val Ile Thr Gln Asp Cys Asp Thr Cys His Ser Pro Ala33er Leu Pro Ala Val Ile Glu Lys 325NAEbola Zaire Virus cagat ctatgaggcg ggttatattg cctactgctc ctcctgaatatatggaggcc 6cctg tcaggtcaaa ttcaacaatt gctagaggtg gcaacagcaa tacaggcttc caccgg agtcagtcaa tggggacact ccatcgaatc cactcaggcc aattgccgat ccatcg accatgccag ccacacacca ggcagtgtgt catcagcatt catccttgaa 24gtga atgtcatatc gggccccaaagtgctaatga agcaaattcc aatttggctt 3aggtg tcgctgatca aaagacctac agctttgact caactacggc cgccatcatg 36tcat acactatcac ccatttcggc aaggcaacca atccacttgt cagagtcaat 42ggtc ctggaatccc ggatcatccc ctcaggctcc tgcgaattgg aaaccaggct 48caggagttcgttct tccgccagtc caactacccc agtatttcac ctttgatttg 54ctca aactgatcac ccaaccactg cctgctgcaa catggaccga tgacactcca 6atcaa atggagcgtt gcgtccagga atttcatttc atccaaaact tcgccccatt 66ccca acaaaagtgg gaagaagggg aacagtgccg atctaacatctccggagaaa 72gcaa taatgacttc actccaggac ttcaagatcg ttccaattga tccaaccaaa 78atgg gaatcgaagt gccagaaact ctggtccaca agctgaccgg taagaaggtg 84aaaa atggacaacc aatcatccct gttcttttgc caaagtacat tgggttggac 9ggctc caggagacct caccatggtaatcacacagg attgtgacac gtgtcattct 96agtc ttccagctgt gattgagaag taataactcg aggtacgt 78DNAEbola Zaire Virus gcggg ttatattgcc tactgctcct cctgaatata tggaggccat ataccctgtc 6aatt caacaattgc tagaggtggc aacagcaata caggcttcct gacaccggagtcaatg gggacactcc atcgaatcca ctcaggccaa ttgccgatga caccatcgac ccagcc acacaccagg cagtgtgtca tcagcattca tccttgaagc tatggtgaat 24tcgg gccccaaagt gctaatgaag caaattccaa tttggcttcc tctaggtgtc 3tcaaa agacctacag ctttgactca actacggccgccatcatgct tgcttcatac 36accc atttcggcaa ggcaaccaat ccacttgtca gagtcaatcg gctgggtcct 42ccgg atcatcccct caggctcctg cgaattggaa accaggcttt cctccaggag 48cttc cgccagtcca actaccccag tatttcacct ttgatttgac agcactcaaa 54accc aaccactgcctgctgcaaca tggaccgatg acactccaac aggatcaaat 6gttgc gtccaggaat ttcatttcat ccaaaacttc gccccattct tttacccaac 66ggga agaaggggaa cagtgccgat ctaacatctc cggagaaaat ccaagcaata 72tcac tccaggactt caagatcgtt ccaattgatc caaccaaaaa tatcatggga78gtgc cagaaactct ggtccacaag ctgaccggta agaaggtgac ttctaaaaat 84ccaa tcatccctgt tcttttgcca aagtacattg ggttggaccc ggtggctcca 9cctca ccatggtaat cacacaggat tgtgacacgt gtcattctcc tgcaagtctt 96gtga ttgagaag 978TEbola ZaireVirus er Met Ala Lys Ala Thr Gly Arg Tyr Asn Leu Ile Ser Pro Lyssp Leu Glu Lys Gly Val Val Leu Ser Asp Leu Cys Asn Phe Leu 2Val Ser Gln Thr Ile Gln Gly Trp Lys Val Tyr Trp Ala Gly Ile Glu 35 4 Asp Val Thr His Lys GlyMet Ala Leu Leu His Arg Leu Lys Thr 5Asn Asp Phe Ala Pro Ala Trp Ser Met Thr Arg Asn Leu Phe Pro His65 7Leu Phe Gln Asn Pro Asn Ser Thr Ile Glu Ser Pro Leu Trp Ala Leu 85 9 Val Ile Leu Ala Ala Gly Ile Gln Asp Gln Leu Ile Asp Gln Ser Ile Glu Pro Leu Ala Gly Ala Leu Gly Leu Ile Ser Asp Trp Leu Thr Thr Asn Thr Asn His Phe Asn Met Arg Thr Gln Arg Val Lys Gln Leu Ser Leu Lys Met Leu Ser Leu Ile Arg Ser Asn Ile Leu Lys Phe Ile AsnLys Leu Asp Ala Leu His Val Val Asn Tyr Asn Gly Leu Ser Ser Ile Glu Ile Gly Thr Gln Asn His Thr Ile Ile Ile Arg Thr Asn Met Gly Phe Leu Val Glu Leu Gln Glu Pro Asp Lys 2la Met Asn Arg Met Lys Pro Gly Pro AlaLys Phe Ser Leu Leu 222u Ser Thr Leu Lys Ala Phe Thr Gln Gly Ser Ser Thr Arg Met225 234r Leu Ile Leu Glu Phe Asn Ser Ser Leu Ala Ile 245 25NAEbola Zaire Virus cagat ctatggctaa agctacggga cgatacaatc taatatcgcccaaaaaggac 6aaag gggttgtctt aagcgacctc tgtaacttct tagttagcca aactattcag ggaagg tttattgggc tggtattgag tttgatgtga ctcacaaagg aatggcccta atagac tgaaaactaa tgactttgcc cctgcatggt caatgacaag gaatctcttt 24ttat ttcaaaatcc gaattccacaattgaatcac cgctgtgggc attgagagtc 3tgcag cagggataca ggaccagctg attgaccagt ctttgattga acccttagca 36cttg gtctgatctc tgattggctg ctaacaacca acactaacca tttcaacatg 42caac gtgtcaagga acaattgagc ctaaaaatgc tgtcgttgat tcgatccaat 48aagtttattaacaa attggatgct ctacatgtcg tgaactacaa cggattgttg 54attg aaattggaac tcaaaatcat acaatcatca taactcgaac taacatgggt 6ggtgg agctccaaga acccgacaaa tcggcaatga accgcatgaa gcctgggccg 66tttt ccctccttca tgagtccaca ctgaaagcat ttacacaaggatcctcgaca 72caaa gtttgattct tgaatttaat agctctcttg ctatctaata actcgaggta 783AEbola Zaire Virus taaag ctacgggacg atacaatcta atatcgccca aaaaggacct ggagaaaggg 6ttaa gcgacctctg taacttctta gttagccaaa ctattcaggg gtggaaggttgggctg gtattgagtt tgatgtgact cacaaaggaa tggccctatt gcatagactg ctaatg actttgcccc tgcatggtca atgacaagga atctctttcc tcatttattt 24ccga attccacaat tgaatcaccg ctgtgggcat tgagagtcat ccttgcagca 3acagg accagctgat tgaccagtct ttgattgaacccttagcagg agcccttggt 36tctg attggctgct aacaaccaac actaaccatt tcaacatgcg aacacaacgt 42gaac aattgagcct aaaaatgctg tcgttgattc gatccaatat tctcaagttt 48aaat tggatgctct acatgtcgtg aactacaacg gattgttgag cagtattgaa 54actc aaaatcatacaatcatcata actcgaacta acatgggttt tctggtggag 6agaac ccgacaaatc ggcaatgaac cgcatgaagc ctgggccggc gaaattttcc 66catg agtccacact gaaagcattt acacaaggat cctcgacacg aatgcaaagt 72cttg aatttaatag ctctcttgct atc 753TEbola Zaire Viruser Met Asp Ser Arg Pro Gln Lys Ile Trp Met Ala Pro Ser Leulu Ser Asp Met Asp Tyr His Lys Ile Leu Thr Ala Gly Leu Ser 2Val Gln Gln Gly Ile Val Arg Gln Arg Val Ile Pro Val Tyr Gln Val 35 4 Asn Leu Glu Glu Ile Cys Gln LeuIle Ile Gln Ala Phe Glu Ala 5Gly Val Asp Phe Gln Glu Ser Ala Asp Ser Phe Leu Leu Met Leu Cys65 7Leu His His Ala Tyr Gln Gly Asp Tyr Lys Leu Phe Leu Glu Ser Gly 85 9 Val Lys Tyr Leu Glu Gly His Gly Phe Arg Phe Glu Val Lys Lys Asp Gly Val Lys Arg Leu Glu Glu Leu Leu Pro Ala Val Ser Ser Lys Asn Ile Lys Arg Thr Leu Ala Ala Met Pro Glu Glu Glu Thr Glu Ala Asn Ala Gly Gln Phe Leu Ser Phe Ala Ser Leu Phe Leu Pro Lys Leu Val Val GlyGlu Lys Ala Cys Leu Glu Lys Val Gln Arg Ile Gln Val His Ala Glu Gln Gly Leu Ile Gln Tyr Pro Thr Ala Gln Ser Val Gly His Met Met Val Ile Phe Arg Leu Met Arg Thr 2he Leu Ile Lys Phe Leu Leu Ile His Gln Gly MetHis Met Val 222y His Asp Ala Asn Asp Ala Val Ile Ser Asn Ser Val Ala Gln225 234g Phe Ser Gly Leu Leu Ile Val Lys Thr Val Leu Asp His Ile 245 25u Gln Lys Thr Glu Arg Gly Val Arg Leu His Pro Leu Ala Arg Thr 267s Val Lys Asn Glu Val Asn Ser Phe Lys Ala Ala Leu Ser Ser 275 28u Ala Lys His Gly Glu Tyr Ala Pro Phe Ala Arg Leu Leu Asn Leu 29ly Val Asn Asn Leu Glu His Gly Leu Phe Pro Gln Leu Ser Ala33le Ala Leu Gly Val Ala ThrAla His Gly Ser Thr Leu Ala Gly Val 325 33n Val Gly Glu Gln Tyr Gln Gln Leu Arg Glu Ala Ala Thr Glu Ala 345s Gln Leu Gln Gln Tyr Ala Glu Ser Arg Glu Leu Asp His Leu 355 36y Leu Asp Asp Gln Glu Lys Lys Ile Leu Met Asn Phe HisGln Lys 378n Glu Ile Ser Phe Gln Gln Thr Asn Ala Met Val Thr Leu Arg385 39lu Arg Leu Ala Lys Leu Thr Glu Ala Ile Thr Ala Ala Ser Leu 44ys Thr Ser Gly His Tyr Asp Asp Asp Asp Asp Ile Pro Phe Pro 423oIle Asn Asp Asp Asp Asn Pro Gly His Gln Asp Asp Asp Pro 435 44r Asp Ser Gln Asp Thr Thr Ile Pro Asp Val Val Val Asp Pro Asp 456y Ser Tyr Gly Glu Tyr Gln Ser Tyr Ser Glu Asn Gly Met Asn465 478o Asp Asp Leu Val Leu PheAsp Leu Asp Glu Asp Asp Glu Asp 485 49r Lys Pro Val Pro Asn Arg Ser Thr Lys Gly Gly Gln Gln Lys Asn 55ln Lys Gly Gln His Ile Glu Gly Arg Gln Thr Gln Ser Arg Pro 5525Ile Gln Asn Val Pro Gly Pro His Arg Thr Ile His His Ala SerAla 534u Thr Asp Asn Asp Arg Arg Asn Glu Pro Ser Gly Ser Thr Ser545 556g Met Leu Thr Pro Ile Asn Glu Glu Ala Asp Pro Leu Asp Asp 565 57a Asp Asp Glu Thr Ser Ser Leu Pro Pro Leu Glu Ser Asp Asp Glu 589n AspArg Asp Gly Thr Ser Asn Arg Thr Pro Thr Val Ala Pro 595 6ro Ala Pro Val Tyr Arg Asp His Ser Glu Lys Lys Glu Leu Pro Gln 662u Gln Gln Asp Gln Asp His Thr Gln Glu Ala Arg Asn Gln Asp625 634p Asn Thr Gln Ser Glu His SerPhe Glu Glu Met Tyr Arg His 645 65e Leu Arg Ser Gln Gly Pro Phe Asp Ala Val Leu Tyr Tyr His Met 667s Asp Glu Pro Val Val Phe Ser Thr Ser Asp Gly Lys Glu Tyr 675 68r Tyr Pro Asp Ser Leu Glu Glu Glu Tyr Pro Pro Trp Leu Thr Glu69lu Ala Met Asn Glu Glu Asn Arg Phe Val Thr Leu Asp Gly Gln77ln Phe Tyr Trp Pro Val Met Asn His Lys Asn Lys Phe Met Ala Ile 725 73u Gln His His Gln 74DNAEbola Zaire Virus 2ggat ccatggattc tcgtcctcagaaaatctgga tggcgccgag tctcactgaa 6atgg attaccacaa gatcttgaca gcaggtctgt ccgttcaaca ggggattgtt aaagag tcatcccagt gtatcaagta aacaatcttg aagaaatttg ccaacttatc aggcct ttgaagcagg tgttgatttt caagagagtg cggacagttt ccttctcatg 24cttcatcatgcgta ccagggagat tacaaacttt tcttggaaag tggcgcagtc 3tttgg aagggcacgg gttccgtttt gaagtcaaga agcgtgatgg agtgaagcgc 36gaat tgctgccagc agtatctagt ggaaaaaaca ttaagagaac acttgctgcc 42gaag aggagacaac tgaagctaat gccggtcagt ttctctcctttgcaagtcta 48ccga aattggtagt aggagaaaag gcttgccttg agaaggttca aaggcaaatt 54catg cagagcaagg actgatacaa tatccaacag cttggcaatc agtaggacac 6ggtga ttttccgttt gatgcgaaca aattttctga tcaaatttct cctaatacac 66atgc acatggttgc cgggcatgatgccaacgatg ctgtgatttc aaattcagtg 72gctc gtttttcagg cttattgatt gtcaaaacag tacttgatca tatcctacaa 78gaac gaggagttcg tctccatcct cttgcaagga ccgccaaggt aaaaaatgag 84tcct ttaaggctgc actcagctcc ctggccaagc atggagagta tgctcctttc 9acttttgaacctttc tggagtaaat aatcttgagc atggtctttt ccctcaacta 96attg cactcggagt cgccacagca cacgggagta ccctcgcagg agtaaatgtt gaacagt atcaacaact cagagaggct gccactgagg ctgagaagca actccaacaa gcagagt ctcgcgaact tgaccatctt ggacttgatg atcaggaaaagaaaattctt aacttcc atcagaaaaa gaacgaaatc agcttccagc aaacaaacgc tatggtaact agaaaag agcgcctggc caagctgaca gaagctatca ctgctgcgtc actgcccaaa agtggac attacgatga tgatgacgac attccctttc caggacccat caatgatgac aatcctg gccatcaagatgatgatccg actgactcac aggatacgac cattcccgat gtggttg atcccgatga tggaagctac ggcgaatacc agagttactc ggaaaacggc aatgcac cagatgactt ggtcctattc gatctagacg aggacgacga ggacactaag gtgccta atagatcgac caagggtgga caacagaaga acagtcaaaa gggccagcatgagggca gacagacaca atccaggcca attcaaaatg tcccaggccc tcacagaaca caccacg ccagtgcgcc actcacggac aatgacagaa gaaatgaacc ctccggctca agccctc gcatgctgac accaattaac gaagaggcag acccactgga cgatgccgac gagacgt ctagccttcc gcccttggagtcagatgatg aagagcagga cagggacgga tccaacc gcacacccac tgtcgcccca ccggctcccg tatacagaga tcactctgaa aaagaac tcccgcaaga cgagcaacaa gatcaggacc acactcaaga ggccaggaac gacagtg acaacaccca gtcagaacac tcttttgagg agatgtatcg ccacattctatcacagg ggccatttga tgctgttttg tattatcata tgatgaagga tgagcctgta 2tcagta ccagtgatgg caaagagtac acgtatccag actcccttga agaggaatat 2catggc tcactgaaaa agaggctatg aatgaagaga atagatttgt tacattggat 2aacaat tttattggcc ggtgatgaatcacaagaata aattcatggc aatcctgcaa 222cagt gataactcga ggtacgt 22472AEbola Zaire Virus 2tctc gtcctcagaa aatctggatg gcgccgagtc tcactgaatc tgacatggat 6aaga tcttgacagc aggtctgtcc gttcaacagg ggattgttcg gcaaagagtc cagtgt atcaagtaaa caatcttgaa gaaatttgcc aacttatcat acaggccttt caggtg ttgattttca agagagtgcg gacagtttcc ttctcatgct ttgtcttcat 24tacc agggagatta caaacttttc ttggaaagtg gcgcagtcaa gtatttggaa3cgggt tccgttttga agtcaagaag cgtgatggag tgaagcgcct tgaggaattg 36gcag tatctagtgg aaaaaacatt aagagaacac ttgctgccat gccggaagag 42actg aagctaatgc cggtcagttt ctctcctttg caagtctatt ccttccgaaa 48gtag gagaaaaggc ttgccttgag aaggttcaaaggcaaattca agtacatgca 54ggac tgatacaata tccaacagct tggcaatcag taggacacat gatggtgatt 6tttga tgcgaacaaa ttttctgatc aaatttctcc taatacacca agggatgcac 66gccg ggcatgatgc caacgatgct gtgatttcaa attcagtggc tcaagctcgt 72ggct tattgattgtcaaaacagta cttgatcata tcctacaaaa gacagaacga 78cgtc tccatcctct tgcaaggacc gccaaggtaa aaaatgaggt gaactccttt 84gcac tcagctccct ggccaagcat ggagagtatg ctcctttcgc ccgacttttg 9ttctg gagtaaataa tcttgagcat ggtcttttcc ctcaactatc ggcaattgca96gtcg ccacagcaca cgggagtacc ctcgcaggag taaatgttgg agaacagtat caactca gagaggctgc cactgaggct gagaagcaac tccaacaata tgcagagtct gaacttg accatcttgg acttgatgat caggaaaaga aaattcttat gaacttccat aaaaaga acgaaatcag cttccagcaaacaaacgcta tggtaactct aagaaaagag ctggcca agctgacaga agctatcact gctgcgtcac tgcccaaaac aagtggacat gatgatg atgacgacat tccctttcca ggacccatca atgatgacga caatcctggc caagatg atgatccgac tgactcacag gatacgacca ttcccgatgt ggtggttgatgatgatg gaagctacgg cgaataccag agttactcgg aaaacggcat gaatgcacca gacttgg tcctattcga tctagacgag gacgacgagg acactaagcc agtgcctaat tcgacca agggtggaca acagaagaac agtcaaaagg gccagcatat agagggcaga acacaat ccaggccaat tcaaaatgtcccaggccctc acagaacaat ccaccacgcc gcgccac tcacggacaa tgacagaaga aatgaaccct ccggctcaac cagccctcgc ctgacac caattaacga agaggcagac ccactggacg atgccgacga cgagacgtct cttccgc ccttggagtc agatgatgaa gagcaggaca gggacggaac ttccaaccgccccactg tcgccccacc ggctcccgta tacagagatc actctgaaaa gaaagaactc caagacg agcaacaaga tcaggaccac actcaagagg ccaggaacca ggacagtgac acccagt cagaacactc ttttgaggag atgtatcgcc acattctaag atcacagggg tttgatg ctgttttgta ttatcatatgatgaaggatg agcctgtagt tttcagtacc 2atggca aagagtacac gtatccagac tcccttgaag aggaatatcc accatggctc 2aaaaag aggctatgaa tgaagagaat agatttgtta cattggatgg tcaacaattt 2ggccgg tgatgaatca caagaataaa ttcatggcaa tcctgcaaca tcatcag 22 Other References
|