Patent ReferencesApolipoprotein B MRNA editing protein compositions and methods High throughput method and system for screening candidate compounds for activity against target ion channels Patent #: 6686193 InventorAssigneeApplicationNo. 10622377 filed on 07/18/2003US Classes:424/93.2Genetically modified micro-organism, cell, or virus (e.g., transformed, fused, hybrid, etc.)ExaminersPrimary: Hama, JoanneAttorney, Agent or FirmForeign Patent References
International ClassesA61K 48/00A01N 65/00 C12N 5/00 C12N 5/02 Description>The present invention relates to a testsystem for the identification and testing of active compounds, which act on synaptic transmission (active compounds for treatment of neuronal diseases), which influence endo/exocytosis, which influence processing of proteins and in particular of activecompounds which can be used for treatment of osteoporosis or Pagers disease, for treatment of neurological and neuromuscular diseases and other nerve diseases or as psychotropic pharmaceuticals. The invention furthermore relates to a non-human mammal,preferably a rodent, in which one or more chloride channels from the group consisting of CIC-3, CIC-4, CIC-6 and CIC-7 are not expressed or are expressed non-functionally, and to somatic cell lines which are derived, for example, from such an animal, andto the use thereof for the identification and testing of substances which are suitable for influencing in their activity, in particular inhibiting or activating, chloride channels, in particular CIC, CIC-3, CIC-5, CIC-6 and/or CIC-7.Osteoporosis is a disease in which increased degradation of bone occurs, leading to fragility. Osteoporosis is widespread in elderly persons, in particular in elderly women (of hormonal origin). For this reason, sex hormones, which can indeedstop the process of bone degradation, but in most cases have serious undesirable side effects, are often administered to elderly female patients. Specific osteoporosis; medicaments have not hitherto been developed. In the context of the present invention, it has now been found, surprisingly, that mutations in the nucleic acid sequence encoding the CIC-7 protein (chloride channel CIC-7) leads to the expression of a non-functional protein, or completelysuppresses expression of such protein thereby causing a very severe form of osteopetrosis in mice. On the basis of these surprising results, it was found that patients with severe juvenile osteopetrosis also have mutations in the CIC-7 gene. The chloride channel CIC-7 is a predominantly intracellular chloride channel present in late endosomes and lysosomes. CIC-7 is expressed ubiquitously, and in particular also occurs in osteoclasts, the bone-degrading cells. Mutations that leadto the expression of a non-functional CIC-7 protein or that completely suppress expression (called "knock-out" or "KO" in the following), prevent osteoclasts from being able to degrade bone. More detailed studies have shown that GIC-7 is incorporatedtogether with the proton pump into the so-called "ruffled membrane". The ruffled membrane borders the resorption lacunae and acid equivalents are transported into the resorption lacunae via a proton-pump, and the electroneural transport of HCl into thelacunae is ensured by a parallel chloride conductance carried by CIC-7. An acidic pH in the lacunae is essential or the bone degradation. If an appropriate chloride conductance is absent, the proton pump cannot pump effectively, with the consequencethat osteoclasts cannot acidify the resorption lacunae and cannot destroy the bone. By knock-out of CIC-7, severe degeneration of the retina furthermore occurs, and neurodegeneration in the central nervous system (CNS) is moreover observed. These observations can be attributed to the fact that the late-endosomal and lysosomalacidification and degradation is impaired in many tissues by CIC-7 knock-out. In the context of the present invention, it has also been found that chloride channels of the CLC gene family are also involved in the acidification of synaptic vesicles. This has been demonstrated, for example, by knock-out of the CIC-3channel. With this knock-out, changes in synaptic transmission in the central nervous system and neuronal degeneration occur. It has furthermore been found that other CIC channels, such as CIC-4 and CIC-7, are present in synaptic vesicles. Synapticvesicles take up neurotransmitters, which are then released into the synaptic gap via exocytosis and, thus, modulate (stimulate or inhibit) the downstream nerve cell. The uptake of neurotransmitters into synaptic vesicles is driven by the pH gradientand the potential gradient across the membrane of the synaptic vesicles (cf. literature references (62)-(67)), so that the activity of chloride channels in synaptic vesicles influences signal transduction in the nervous system. By the studies set up in the context of the present invention, it is now possible to provide a test system, which enables identification and testing of substances that inhibit one or more chloride channels from the group consisting of CIC-1,CIC-2, CIC-Ka, CIC-Kb, CIC-3, CIC-4, CIC-5, CIC-6 and/or CIC-7--in particular the predominantly intracellular chloride channels CIC-3, CIC-4, CIC-5, CIC-6 and/or CIC-7- or of otherwise influencing them in activity, i.e. for example activating them ormodifying their regulation. In particular, for the first time a test system and a process are provided for the identification and testing of substances, which (completely or partly) inhibit the chloride channel CIC-7, in particular substances which aresuitable for treatment of osteoporosis or Paget's disease. Such a test system also enables identification of substances that influence neuronal signal transduction, and are therefore suitable for treatment of neuronal diseases. The invention is based on the consideration that a (partial) inhibition of the CIC-7 chloride channel inhibits osteoclast function and, therefore, counteracts bone degradation. Research along the same line is being conducted in thepharmaceutical industry, where effective inhibitors of the proton pump are being searched for. By the present knowledge, it is now possible for the first time to identify substances which act specifically on the CIC-7 chloride channel and cause partialor complete inhibition or activate the channel or modify regulation thereof. A total KO of CIC-7 also Influences other tissue and causes e.g. degeneration of the retina and degeneration of the CNS. Therefore pharmacological inhibition of CIC-7 (i.e. byadministration of CIC-7 inhibitors) could potentially have similar effects. This problem can be solved on the one hand by only partial inhibition of the channel, and on the other hand by using active compounds or pharmaceuticals which do not reachundesirable target organs (i.e. eye and brain) (e.g. because of the blood-brain barrier). Further, as CIC-7 exerts its role in bone degradation in the plasma membrane of osteoclasts, but is in intracellular vesicles in neurons, drugs may be designedthat do not enter cells and therefore act specifically on osteoclast-expressed CIC-7. The invention is furthermore based on the assumption that synaptic transmission in the nervous system can be influenced by an inhibition or stimulation of chloride channels. Interventions into synaptic transmission are a widely used principle ofthe pharmacology for treatment of neurological and neuromuscular diseases. Thus drugs that influence the corresponding uptake of transporters into synaptic vesicles or that influence re-uptake of the secreted neurotransmitter from the synaptic cleftinto the cell are employed. Uptake of neurotransmitters into the synaptic vesicles takes place via transporters located in the membrane thereof, which in general are coupled with and driven by the electrochemical gradients for protons across the vesiclemembrane (cf. publications (81) and (82)). If these gradients are changed, the uptake of transmitters are modified, in some cases differentially. On the one hand, particular CLC channels are possibly present only in particular subpopulations of nervecells or synaptic vesicles (e.g. for particular neurotransmitters), and on the other hand the electrochemical-gradient for protons consists of two components (ΔpH and Δψ), to which the various transporters are coupled. The uptake ofacetylcholine is thus chiefly driven via the pH gradient, while the uptake of glutamate is chiefly driven by the electrical potential Δψ. The electrochemical gradient for protons in synaptic vesicles is built up by the proton pump in conjunction with chloride channels. The presence of a chloride conductivity reduces the electrical component Δψ of the gradient andincreases the ΔpH component. Inhibition of a chloride channel in synaptic vesicles thus reduces ΔpH, but increases Δψ as a result e.g. the uptake of acetylcholine is reduced but the uptake of glutamate is increased, provided thatthe channel occurs on both vesicle types. According to a particular embodiment, conversely, a specific stimulation of individual chloride channels is also envisaged. This would result e.g. in a reduction in glutamate uptake and an increase inacetylcholine uptake. In addition to the possibility of modulating the concentration of neurotransmitters in synaptic vesicles, such substances can also influence the transport of the vesicles within the cell, e.g. also endo- and exocytosis. This follows from theobservation that in the event of CIC-5 KO, endocytotic trafficking is is greatly reduced (cf. (8)), and from the fact that the endocytotic and exocytotic pathway can be impaired considerably by reducing the vesicular pH (cf. publications (69) to (74)). Substances, which influence and in particular inhibit, the activity of the CIC chloride channels CIC-3, CIC-4, CIC-6 and/or CIC-7, which occur predominantly intracellularly, are thus suitable as therapeutic agents for neurological, andneuromuscular diseases and other nerve diseases and, in the case of CIC-7, for osteoporosis, Paget's disease, and other bone-degrading diseases. In the context of the invention, these channel proteins are therefore useful as molecular targets in orderto discover and develop substances for the treatment of such diseases. Several assays are suitable as methods for discovering and testing such substances. According to one embodiment of the invention, binding of the substances to the target molecule is tested by methods well-known to the skilled person. For this,the channel proteins are expressed endogenously, e.g. by osteoclasts, or heterologously, e.g. by bacteria, yeasts or mammalian cells, and purified. Appropriate processes are well-known to the skilled person. In a preferred embodiment of the inventionbinding of the substances to the proteins can be investigated by well-known methods of fluorescence correlation spectroscopy and fluorescence intensity distribution analysis (cf. references (85) to (88)). In another preferred embodiment, themeasurement is carried out by similarly well-known methods of plasmon resonance measurement (cf. references (89) to (94)). In yet another embodiment, the binding of ligands to the CIC channels CIC3, CIC-4, CIC-6 and/or CIC-7 is measured by the use oflabeled ligands, the label being radioactive, fluorescent or any other label that can be identified specifically when compared the same un-labelled ligand. Methods are well-known to the person skilled in the art. Another preferred method of this invention for the identification of substances which act on the chloride channels CIC-3, CIC-4, CIC-6 and/or CIC-7 comprises test systems in which the corresponding channel protein is expressed functionally,either endogenously or heterologously. Such systems are also appropriate for testing the substances found in the above binding processes for functional effects. In this case, measurement is carried out via the function of the channel protein, whichchanges either currents, potentials or pH values in particular systems, which then either are measured directly, or their effect on the detection systems is measured. In another preferred method of this invention measurements as above are not performedon the wild-type form of the channel, but on a mutant channel protein that may for instance reside in a different compartment (e.g. plasma membrane) that is easier to study. In another preferred method of this invention, the structure of CIC-3, CIC-4, CIC-6, and/or CIC-7 may be used to identify or optimize substances binding to the channel protein by molecular modeling. Another preferred method of this Invention for the identification of substances which act on the chloride channels CIC-3, CIC-4, CIC-6 and/or CIC-7 comprises test systems in which the corresponding channel protein is expressed functionally, butthe other channel proteins are either present to a lesser degree or are not present at all. Such systems are also appropriate for testing the substances found in the above binding processes for functional effects. In this case, measurement is carriedout via the function of the channel protein, which changes either currents, potentials or pH values in particular systems, which then either are measured directly, or their effect on the detection systems is measured. In a preferred embodiment of the invention, the activity of the substance on a channel CIC-x (x=3, 4, 6 or 7) is measured on cells or preparations derived therefrom (such as membrane preparations or vesicles) which exclusively or preferentially(predominantly) express only the channel CIC-x (e.g. CIC-7 in the search for osteoporosis medicaments). The specificity is tested by measuring the activity of test substances, for example, on cells which exclusively or preferentially (predominantly) express only the CIC-7 channel. These cells or cell lines are obtained, for example, by isolationof the is germ cells and somatic cells, which contain nucleic acid sequences encoding chloride channels, from non-human mammals, preferably rodents (in; particular mice). In these cells as many as possible of the chloride channel encoding nucleic acidgenes--with the exception of the chloride channel for which a specific inhibitor is being searched for--are modified by mutation, truncation, complete deletion and/or partial deletion such that the particular chloride channels are not expressed or areexpressed, non-functionally. Non-functionally in this context means that the the chloride channel protein is expressed such that the transport function of the chloride channel is reduced or suppressed completely. These genetic or genetically engineeredmodifications are also called knock-out. Corresponding genetically modified mice (as an example of a non-human mammal) are also called knock-out mice or KO mice. Natural mutants, for example, exist as knock-outs of the CIC-1 channel in mice and humans,i.e. a non-functional or absent expression of the CIC-1 channel occurs naturally in a certain percentage of the population, which leads to myotonia congenita. In the case of a knockout of the CIC-K1 channel or of the CIC-KB channel, diabetes Insipidus(in mice) or Bartter's syndrome (in humans) occurs. A knock-out of CIC-5 in humans leads to Dent's disease. The specificity of substances binding to or modifying CIC channels can of course also be measured by other methods, for example on the isolated channel protein, which can be obtained e.g. by over-expression. Appropriate processes for cloning andexpression of the nucleic acid sequence encoding the corresponding channel protein are known in the greatest of detail to the skilled person. The specificity can furthermore also be determined directly using suitable assays, such as e.g. the "pit assay"(see below), which are well-known to the skilled person. The experimentally generated knock-out of ion channels and in particular of chloride channels is well-known to the skilled person and is described, for example, in publications (1) to (8) cited in the appendix. It is furthermore known thatnumerous modifications of the nucleic acid sequences, which code for chloride channels lead to a lack of function or expression of the proteins (cf. publications (9) to (24)). The general structural build-up and the transmembrane topology of thechloride channels is shown in the diagram in FIG. 1. For example, individual point mutations in domains D3 to D5 already lead to disturbances in or a lack of expression or to expression of a protein which has no chloride channel properties. The sameeffect can be achieved by truncation in the region of domains D10 to D12 or generally by truncation in transmembrane-spanning domains. The gene, i.e. the nucleic acid sequence which codes for the chloride channel, can of course also be deletedcompletely or replaced by a nucleic acid sequence, which codes for another protein, or the promoter region which controls the gene expression can be mutated. The aim of the genetic modification is to suppress the protein expression or to effectnon-functional expression of the protein. Alternatively, a so-called knock-down with which the genetic engineering modifications lead merely to a restriction in the chloride is channel function, without completely suppressing the transport properties,is also possible. Such knock-down strategies are well-known to the skilled person and include e.g. antisense strategies or ribozyme strategies, i.e. knock-down using antisense oligonucleotides and ribozymes, but are not limited to these. Methods usedin the knock-down are described in more detail in publications (25) to (36) cited in the appendix, to which reference is expressly made here. In the context of the present invention, it is possible to use both somatic cell lines, which are produced from a genetically modified non-human mammal, (rodent, in particular mouse) and those cell lines in which the expression of thecorresponding channels CICxxx has subsequently been reduced or abolished by genomic mutations of the somatic cell line and/or the expression of the channels has been down-regulated by other processes, such as e.g. via antisense technology or ribozyme orRNAi strategies. This down-regulation or reduction of expression can in particular also be inducible and, thus, prevent or alleviate problems of cell survival and other problems, which can arise from switching off several chloride channels at the sametime. These cell lines can also be of human origin. The identification and testing of substances for chloride channel-specific actions preferably starts from genetically-modified non-human mammals or from cell lines in which preferably two or three chloride channels are not expressed or areexpressed non-functionally. In the case of the chloride channel CIC-7, the expression of this chloride channel should not be impaired, so that a knock-out or knock-down of one or more other chloride channels, for example from the group consisting ofCIC-3, CIC-4, CIC-5 and CIC-6, must take place. Corresponding conditions also apply if substances which act specifically on another channel are to be identified and tested. Thus, for a test with respect to CIC-4 e.g. cell lines which express only theCIC-4 channel must be established. Testing of the substances can be carried out either directly on these cells or on preparations obtained from these cells, such as e.g. vesicles, membrane preparations, in particular synaptic vesicle preparations, orpurified proteins. Processes for the isolation of these preparations are well-known to the skilled person. The specificity of the action against a particular CIC chloride channel is tested using on the one hand, as described for discovering the substances, cell lines which chiefly or exclusively contain only this particular chloride channel in theintracellular compartments tested, or using the abovementioned preparations derived therefrom. Substances which show the expected effect in these cell lines or on preparations derived therefrom are then tested on other cell lines or preparations derivedtherefrom which do not have this channel. If they are specific, they should have no effect on these cell lines. More specific assays follow, depending on the channel: If e.g. the effect on the CIC-7 channel is to be tested with respect to osteoporosis,cultured wild-type (WT) osteoclasts can be tested in a "pit assay" (cf. publications (52) to (58)) on dentine, ivory, bone or other suitable substrates and, for example, the formation of holes in the substrate can be investigated or the acidification ofthe resorption lacunae can be investigated with appropriate dyes (e.g. acridine orange) (cf. publications (59) to (61)). If inhibition of chloride channels of synaptic vesicles (such as e.g. CIC-3) is aimed at, the acidification of purified synaptic vesicles in suspension can be measured with dyes in the next step (cf. publications (62) to (64)). An inhibition ofthe channel should manifest itself in an inhibition of the rate of acidification, and the specificity can be checked by isolating synaptic vesicles from the corresponding KO mouse. The substance should have no effect on the rate of acidification ofsynaptic vesicles isolated from those mice. In further steps, the specificity for particular types of synaptic vesicles can be tested by determining the uptake of (e.g. radioactively labelled) neurotransmitters in synaptic vesicles in the presence andabsence of the substance. The corresponding methods are well-known to the skilled person (cf. e.g. publications (65) to (68)). Somatic cell lines can be isolated from various tissues of KO mice, and the material is obtained in a form which is as sterile as possible and is introduced, either in the native form or preferentially after enzymatic digestion, into appropriatecell culture containers (e.g. dishes) together with nutrient media (e.g. Dulbecco's MEM, preferably at least initially with added antibiotics) and incubated at 37° C. and 5% CO2. The cells are multiplied with standard techniques of cellculture, according to a particular embodiment of the invention the cell line being immortalized by transfection with appropriate genes (e.g. SV40 largeT antigen, or telomerase) (cf. publications (37) to (39)). As an alternative, KO mice can be crossedwith a mouse strain which expresses an appropriate immortalization gene (such as e.g. the immorto mouse, cf. publications (40) to (42), and also other mice (cf. publication (43)) which express these genes, possibly under the control of an induciblepromoter). In particular, these cell lines can be further developed as a test system by transfecting them with appropriate constructs which express proteins which serve directly or indirectly as an indicator for the measurement method. For example, it ispossible to express chimaeric proteins which, on the basis of particular protein sequence signals, are diverted specifically into particular compartments. The other part of the chimaeric unit contains either an appropriate indicator protein directly,such as e.g. pH-sensitive fluorescent proteins, such as particular GFP mutants (cf. publications (44) to (46)), or binding sites for diverting indicator substances, such as e.g. antibodies (cf. publication (49)) or biotin-coupled dyes (cf. publication(47)) into these compartments (cf. (44) to (51)). A particular embodiment of the invention thus relates to the use of the abovementioned non-human mammals or somatic cell lines (of human or non-human origin) for identification of substances which act on synaptic transmission. A test system anda process are provided for the first time for the identification and testing of substances which inhibit or otherwise influence in activity (i.e. for example activate or modify its/their regulation) the chloride channel CIC-3, CIC-4, CIC-6 and/or CIC-7,in particular substances which are suitable for treatment of neurological and neuromuscular diseases and other nerve diseases or as psychotropic pharmaceuticals. Compounds that may be useful for the treatment of osteoporosis may be distinguished from other compounds by their effectiveness in influencing CIC-7. That is to say, for example, active compounds against CIC-3 (which occurs on synaptic vesicles)will not interfere with the extracellular acidification of osteoclasts. On the other hand, substances which act on CIC-7 can optionally be modified such that they cannot cross the blood-brain barrier and therefore cannot act in the CNS. Such methodsare well-known to the skilled person. It is also conceivable that substances are diverted (directed or sorted) specifically into certain neurone groups (e.g. by binding to specific surface receptors), or the substances are first metabolized to theactive substance via specific enzymatic activities present in specific subsets of neurones. A test of the specificity can be carried out, as mentioned above, on the one hand with the aid of appropriate cell lines which express only particular channel types, on preparations derived therefrom (see above) or in specific test systems, suchas osteoclasts in culture, or on synaptic vesicle preparations from WT and KO animals. The present invention relates in particular to a nucleic acid sequence which codes for a protein from the group consisting of the chloride channels CIC-3, CIC-4, CIC-6 and CIC-7, wherein the nucleic acid sequence is modified by mutation,truncation or complete or partial deletion. The invention furthermore relates to a genetically modified non-human mammal, the gametes and somatic cells of which contain nucleic acid sequences which code for a protein from the group consisting of the chloride channels CIC-1, CIC-2, CIC-Ka,CIC-Kb, CIC-3, CIC-4, CIC-5, CIC-6 and/or CIC-7, wherein the nucleic acid sequence(s) which code(s) for CIC-3, CIC-4, CIC-6 and/or CIC-7 is (are) modified (with respect to the naturally occurring nucleic acid sequence) by mutation, truncation and/orcomplete or partial deletion. According to a preferred embodiment of the invention the genetically modified, non-human mammal additionally contains the nucleic acid sequence(s) which code(s) for CIC-1, CIC-2, CIC-Ka, CIC-Kb and/or CIC-5 and which is (are) modified bymutation, truncation and/or complete or partial deletion. According to the invention, somatic cell lines which do not express one or more chloride channels from the group consisting of CIC-1, CIC-2, CIC-Ka, CIC-Kb, CIC-3, CIC-4, CIC-5, CIC-6 and CIC-7 are established or derived from the mammal, which inparticular is a rodent and particularly preferably a mouse. As already described, it is also possible to derive from these non-human mammals preparations, such as e.g. vesicle and other membrane preparations, in particular also synaptic vesiclepreparations, which have an appropriate expression pattern in respect of the chloride channels and are therefore just as suitable as the KO animals or cell lines as such. The invention furthermore relates to somatic cell lines in which either the expression of the chloride channels CIC-1, CIC-2, CIC-Ka, CIC-Kb, CIC-3, CIC-4, CIC-5, CIC-6 and CIC-7, in particular from the group consisting of CIC-3, CIC-4, CIC-6 andCIC-7, is reduced by genomic mutations of the somatic cell line and/or the expression of the channels is down-regulated by other processes, such as e.g. via antisense technology or ribozyme strategies. This down-regulation can in particular also beinducible in order to prevent or alleviate problems with the vitality of the cells and other problems which can arise by switching off several chloride channels at the same time. The abovementioned cell lines can also be of human origin. The invention furthermore relates to the use of a genetically modified, non-human mammal, the germ cells and somatic cells of which contain nucleic acid sequences which code for a protein from the group consisting of the chloride channels CIC-1,CIC-2, CIC-Ka, CIC-Kb, CIC-3, CIC-4, CIC-5, CIC-6 and/or CIC-7, wherein one or more of these nucleic acid sequences is/are modified (with respect to the naturally occurring nucleic acid sequence) by mutation, truncation and/or complete or partialdeletion, for the identification and testing of substances which are suitable for inhibiting one or more chloride channels. Mammals in which one or more of the nucleic acid sequences which code for proteins from the group consisting of the chloride channels CIC-1, CIC-2, CIC-Ka, CIC-Kb, CIC-3, CIC-4, CIC-5, CIC-6 and CIC-7 is modified (with respect to the naturallyoccurring nucleic acid sequence) by mutation, truncation and/or complete or partial deletion, in each case one of the sequences which code for CIC-7, CIC-3, CIC-3 or CIC-6 not being modified, so that this chloride channel is expressed normally, i.e.functionally. Instead of mammals, the abovementioned cell lines (human and non-human) or preparations derived therefrom (see above) can also be used. Finally, the invention relates to a process for the identification and testing of substances which are suitable for inhibiting or otherwise influencing in its/their activity, i.e. for example activating or modifying their regulation, one or morechloride channels from the group consisting of CIC-3, CIC-4, CIC-6 and CIC-7. In this process, on cell lines or cells (or preparations derived therefrom, in particular membrane preparations, such as vesicles; see above) which express only one chloridechannel from the group consisting of CIC-3, CIC-4, CIC-6 and CIC-7, the luminal pH of the compartments which express the channel and/or the potential across the membrane enclosing the channel is determined. These cell lines or cells are then broughtinto contact with the substances to be tested, and the luminal pH of the compartment, which expresses the channel and/or the potential across the membrane enclosing the channel is determined again. A change in one or both of the physical parametersmeans that the test substance influences the chloride channel in question. An increase in the pH means that it is a substance which (partially) hinders or (partially) inhibits the chloride channel. Lowering of the pH indicates an acidification of thecompartment and therefore a substance which activates the chloride channel. Measurement of an increase in the potential likewise means that it is a substance which (partly) hinders or (partly) inhibits the chloride channel. Lowering of the potentialindicates a substance. Which activates the chloride channel. The activity of a substance in respect of its ability to influence the chloride channel in question is higher the lower the concentration of substance that has to be added in order to effecta change in the physical parameter or parameters. The process according to the invention is based on the principle that a change in the activity of intracellular chloride channels can change the luminal pH of the compartments which express them and/or the potential across the membrane enclosingthem. Chloride channels allow a charge compensation for the proton pumps occurring in the same vesicles (e.g. of the endo- or exocytotic pathway), which has the effect of a higher pump output and therefore a higher acidification of the compartment. Atthe same time, they lower the electrical potential across this membrane. An inhibition or switching off of the chloride channels would therefore result in a reduced acidification and a higher electrical potential, but a stimulation of their activitywould result in an increased acidification and a lowering of the electrical potential. In the present invention the effect of the substances to be tested on the corresponding chloride channels is measured indirectly via one or more effects of thechanged acidification and/or potential of intracellular compartments. In order to identify specific substances for a particular channel type, in the preferred use the compartments measured should as far as possible contain only one chloride channelagainst which the test is being carried out. The chloride channel specificity is demonstrated by carrying out control studies on cell lines which express another channel. If the compartments express more than one chloride channel, further measurementsmust be carried out on other KO cell lines or mice, as described above. The process according to the invention for the identification and testing of substances which are suitable for inhibiting one or more chloride channels from the group consisting of CIC-3, CIC-4, CIC-5, CIC-6 and/or CIC-7 is characterized in thata) on cells which express only one or chiefly or predominantly only one of the chloride channels mentioned, the luminal pH of the compartments which express the channel and/or the potential across the membrane enclosing the channel is measured, b) thecells are brought into contact with a substance and c) the luminal pH of the compartments which express the channel and/or the potential across the membrane enclosing the channel is measured again on the cells, the difference between the pH and/or themembrane potential before and after addition of the substance determining the activity of the substance. As already mentioned, one process variant consists of direct measurement of the pH of intracellulular organelles or measurement of the cell effects which occur as a result of the change in pH. Several methods are possible for measurement of thepH. There are, for example, dyes of which the fluorescence is pH-dependent or which concentrate selectively in compartments with particular pH values when the cells are Incubated with them or their precursor stages (examples: acridine orange,Lysotracker and other dye from Molecular Probes, Eugene, Oreg., USA). A higher specificity for particular compartments can be achieved e.g. by endocytotic uptake of dyes (staining of, endocytotic compartments, depending on the uptake time, early or lateup to lysosomal compartments; cf. e.g. publications (71), (75), (76)). An even higher specificity for particular compartments can be achieved by binding the dyes via coupled molecular groups (such as e.g. specific antibodies or biotin) to particulartarget molecules, which occur in an increased amount or exclusively in particular compartments, i.e. which are expressed in the cell line (e.g. by permanent transfection), the cell line being brought into contact with the dye. These target molecules canalso be prepared via molecular cell biology techniques, e.g. by fusing a target control signal, which directs the molecule into a particular compartment via an appropriate machinery of the cell, to a corresponding binding motif (e.g. epitope forantibodies or avidin) by a molecular biology method and then expressing the construct in the corresponding cell line used for testing the substances. Using such techniques, it is possible to examine and measure predominantly or even very specificallyonly those compartments that contain the channel of interest The accumulation of particular substances In compartments with a particular pH (such as e.g. acridine orange or Lysotracker from Molecular Probes) or indirect tests in which pH-dependentreactions in the compartments are utilized to produce indicator substances (e.g. by pH-dependent proteolytic cleavage), which are then easy to detect (e.g. using dyes (cf. publications (95) and (96)), although the detection is not limited thereto), arealso used e.g. as a further technique for pH measurement. Alternatively or in addition, the membrane potential in these compartments can be measured, e.g. via potential-sensitive dyes (cf. e.g. publication (67)). Alternatively, protein-coded potential sensors (cf. e.g. publication (77)), which arepossibly also diverted or sorted specifically, are also possible here. The present invention provides for the first time a test system with which active compounds which are suitable for the preparation of medicaments for treatment of osteoporosis or Paget's disease or for the preparation of medicaments for treatmentof neurological and neuromuscular diseases and other nerve diseases or for the preparation of psychotropic pharmaceuticals can be identified and tested. The invention thus also relates to the use of substances, which completely or partly inhibit thechloride channel CIC-7 for the preparation of medicaments for treatment of osteoporosis or Pager's disease, and to the use of substances which completely or partly inhibit the chloride channel CIC-3, CIC-4, CIC-6 and/or CIC-7 for the preparation ofmedicaments for treatment of neurological and neuromuscular diseases and other nerve diseases or of psychotropic pharmaceuticals. The invention furthermore relates to pharmaceutical compositions (medicaments) for treatment of osteoporosis or Paget'sdisease which comprise one or more substances which completely or partly inhibit the chloride channel CIC-7, and to medicaments for treatment of neurological and neuromuscular diseases and other nerve diseases and psychotropic pharmaceuticals whichcomprise one or more substances which completely or partly inhibit the chloride channel CIC-3, CIC-4, CIC-6 and/or CIC-7. The medicaments comprise the active compounds in a formulation suitable for oral or intravenous administration, optionally togetherwith pharmaceutically tolerated carrier substances. The invention is explained in more detail below with the aid of examples. DESCRIPTION OF THE FIGURES FIG. 1: Transmembrane topology model of CLC channels according to the biochemical study of Schmidt-Rose and Jentsch (T. Schmidt-Rose and T. J. Jentsch, Proc. Natl. Acad. Sci. USA 94 (1997) 7633-7638). N- and C-termini are locatedintracellularly. Initial hydropathy analysis of CIC-0 showed the presence of up to 13 transmembrane domains (D1-D13). Apart from some prokaryotic CICs, all known CIC proteins have two CBS domains (cf. A. Bateman, Trends Biochem. Sci. 22 (1997) 12-13and C. P. Ponting, Mol. Med. 75 (1997) 160163) on the C terminus. EXAMPLES Example 1 Protocol for Generating Knock-Outs by the Example of CIC-7 The CIC-7 knock-out mouse was produced by standard methods which are well-known to the skilled person and are described in detail, inter alia, in method books (cf. e.g. publication (78)). This technique requires several steps. In the firststep a DNA construct which, in addition to the target sequence (in this case the genomic sequence of the mouse which contains the gene which codes for the CIC-7 channel), contain appropriate selection markers. In the second step an allele of the targetgene is modified in pluripotent embryonal stem cells of the mouse by homologous recombination with the aid of this DNA construct such that it can no longer code for a functional protein. In the third step these recombinant embryonal stem cells areinjected into mouse blastocysts, which are then transplanted into the uterus of pseudo-pregnant foster mothers (mice). These then give birth to descendants which are chimaeric, i.e. In addition to the genetically modified cells which originate from thestem cells injected, also contain normal, genetically non-manipulated cells of the blastocysts injected. These chimaeric mice are paired with normal "wild-type" (WT) mice. The descendants are tested (e.g. by southern blotting or by PCR techniques) asto whether the genetically modified, that is, to say functionally destroyed, gene has been inherited via the germ line. In the positive case these are now heterozygotic animals in which the channel gene on one of the two chromosomes is destroyed. Heterozygotic mice are crossed with one another to finally obtain homozygotic knock-out animals in which the corresponding channel genes are destroyed on both chromosomes. In the case of the CIC-7 KO mouse, the construct was prepared as follows: With the aid of a rat cDNA probe (protein sequence published in reference (79)); Accession No. for protein and cDNA: Z67744 GenBank), a commercially obtainable genomicphage library in the vector .lamda.FIXII of the mouse strain 129/Sv (Stratagene, 11011 North Torrey Pines Road, La Jolla, Calif. 92037, USA) was scanned by standard methods of plating out, stripping off filters and hybridization with the radioactivelylabelled cDNA probe. Several phage clones which hybridized under high stringency were isolated, purified and analysed with standard methods of restriction mapping, partial sequencing and amplification of selected fragments by the PCR. A genomic clonewhich contained a piece approximately 14 kb in size of the genomic sequence of CIC-7, including the exon 2 (cf. (80)), was selected for preparation of the construct. For this, the genomic clone was digested with the two restriction enzymes BglII andBsrGI, as a result of which the part of the sequence which contains the coding exons 3, 4, 5, 6 and 7 was removed. This part was replaced with a DNA fragment approximately 1.6 kb in size which contains a neomycin resistance cassett driven by thephosphoglycerate promoter, by ligating the cassette into the genomic sequence by appropriate enzymatic reactions using standard processes. After transformation of bacteria with the corresponding vector containing this construct, bacterial coloniescontaining the correct construct were isolated, the DNA was extracted, and after digestion with HindIII, a thymidine kinase cassette was attached at the 5' end of the construct for negative selection. After renewed transformation, isolation and checkingof the now finished construct, pluripotent embryonal stem cells (mouse) were transfected with it by electroporation and plated out and multiplied under appropriate culture conditions (culture on "feeder layers" in the presence of leukaemia inhibitoryfactor (LIF) to prevent differentiation). The cells were selected with G418 (selection for the presence of the neomycin resistance cassette) and gancyclovir (selection for the absence of the thymidine kinase cassette). Resistant clones were isolated,drawn out and analysed by southern blot analysis for homologous recombination on the CIC-7 locus. Correct clones in which the CIC-7 gene on one chromosome was destroyed (i.e. exons 3-7 were replaced by the neomycin cassette), were expanded by growingand injected into mouse blastocysts, as described above, under microscopic control with micromanipulators. The subsequent procedure was as described above. Since the genetic modification was inherited via the germ line, a CIC-7 KO mouse was produced inthis way. The absence of the CIC-7 channel protein was demonstrated with the aid of a specific antibody established against an amino-terminal peptide of CIC-7. The CIC-7 KO mouse unexpectedly showed the phenotype of a potent osteopetrosis, accompaniedby a retina degeneration and signs of degenerative changes in the central nervous system. Example 2 Generation of a CIC3 KO Mouse In a manner similar to that described in example 1, a CIC-3 KO mouse in which exon 3, which codes for sequences in the first transmembrane domain (cf. publications (83) and (84)), was deleted was also produced. This construct furthermore leadsto a premature stop in translation, so that a very small, truncated protein was predicted. CIC-3 protein was no longer to be detected in the KO mouse with a specific antibody established against an amino-terminal peptide of CIC-3. The CIC-3 KO mouseshowed a degeneration of the hippocampus and a degeneration of the retina. It was possible to demonstrate that the CIC-3 chloride channel occurs in intracellular, predominantly endosomal compartments and synaptic vesicles. pH measurements showed thatthe absence of CIC-3 caused a reduction In the acidification of synaptic vesicles. REFERENCES (1) Clarke L L, Grubb B R, Gabriel S E, Smithies O, Koller B H, Boucher R C (1992) Defective epithelial chloride transport in a gene-targeted mouse model of cystic fibrosis. Science 257:1125-1128. (2) Dorin J R, Dickinson P, Alton E W, Smith SN, Geddes D M, Stevenson B J, Kimber W L, Fleming S, Clarke A R, Hooper M L, et al (1992) Cystic fibrosis in the mouse by targeted insertional mutagenesis. Nature 359:211-215 (3) Ratcliff R, Evans M J, Doran J, Wainwright B J, Williamson R, Colledge W H(1992) Disruption of the cystic fibrosis transmembrane conductance regulator gene in embryonic stem cells by gene targeting. Transgenic Res. 1:177-181. (4) Ratcliff R, Evans M J, Cuthbert, A W, MacVinish U, Foster D, Anderson JR, Colledge W H (1993)Production of a severe cystic fibrosis mutation in mice by gene targeting. Nature Genet. 4:3541. (5) Matsumura Y, Uchida S, Kondo Y, Miyazaki H, Ko S B, Hayama A, Morimoto T, Liu W. Arisawa M, Sasaki S, Marumo F (1999) Overt nephrogenic diabetesinsipidus in mice lacking the CLC-K1 chloride channel. Nature Genet. 21:95-98. (6) Brenner R, Perez G J, Bonev A D, Eckman D M, Kosek J C, Wiler S W, Patterson A J, Nelson M T, Aldrich R W (2000) Vasoregulation by the beta1 subunit of thecalcium-activated potassium channel. Nature 407:870-876. (7) Lee M P, Ravenel J D, Hu R J, Lustig L R, Tomaselli G, Berger. R D, Brandenburg S A, Utzi T J, Bunton T E, Umb C, Francis H, Gorelikow M, Gu H, Washington K, Argani P, Goldenring J R, CoffeyR J, Feinberg AP (2000) Targeted disruption of the kylqt1 gene causes deafness and gastric hyperplasia in mice. J Clin Invest 106:1447-1455. (8) Piwon N, GOnther W, Schwake M, Bosl MR, Jentsch T J (2000) CIC-5 CI--channel disruption impairs endocytosisIn a mouse model for Dent's disease. Nature 408:369-373. (9) Steinmeyer K, Lorenz C, Pusch M, Koch M C, Jentsch T J (1994) Multfineric structure of CIC-1 chloride channel revealed by mutations in dominant myotonia congenita (Thomsen). EMBO J.13:737-743. (10) Gronemeier M, Condie A, Prosser J, Steinmeyer K, Jentsch T J, Jockusch H (1994) Nonsense and missense mutations in the muscular chloride channel gene CIC-1 of myotonic mice. J Biol Chem 269:5963-5967. (11) Lorenz C, Meyer-Kleine C,Steinmeyer K, Koch M C, Jentsch T J (1994) Genomic organization of the human muscle chloride channel CIC-1 and analysis of novel mutations leading to Becker-type myotonia. Hum Mol Genet 3:941-946. (12) Meyer-Kleine C, Steinmeyer K, Ricker K, Jentsch TJ, Koch M C. (1995) Spectrum of mutations in the major human skeletal muscle chloride channel gene (CLCN1) leading to myotonia. Am J Hum Genet. 57:1325-1334. (13) Pusch M, Steinmeyer K, Koch M C, Jentsch T J. (1995) Mutations in dominant humanmyotonia congenita drastically alter the voltage dependence of the CIC-1 chloride channel. Neuron 15:1455-1463. (14) Uoyd S E, Pearce S H, Fisher S E, Steinmeyer K, Schwappach B, Scheinman S J, Harding B, Bolino A, bevoto M, Goodyer P, Rigden S P,Wrong O, Jentsch T J, Craig I W, Thakker R V. A common molecular basis for three inherited kidney stone diseases. Nature 379:445449. (15) Lloyd S E, Pearce S H, Gunther W, Kawaguchi H, Igarashi T, Jentsch T J, Thakker R V. (1997) Idiopathic lowmolecular weight proteinuria associated with hypercal-ciuric nephrocalcinosis in Japanese children is due to mutations of the renal chloride channel (CLCN5). J Clin Invest. 99:967-974. (16) Uoyd S E, Gunther W, Pearce S H, Thomson A, Bianchi M L,Bosio M, Craig I W, Fisher S E, Scheinman S J, Wrong O, Jentsch T J, Thakker R V. (1997) Characterisation of renal chloride channel, CLCN5, mutations in hypercalciuric nephrolithiasis (kidney stones) disorders. Hum Mol Genet 6:1233-1239. (17)Schmidt-Rose T, Jentsch T J. (1997) Reconstition of functional voltage-gated chloride channels from complementary fragments of CLC-1. J Biol Chem 272:20515-20521. (18) Schwappach B, Stobrawa S, Hechenberger M, Steinmeyer K, Jentsch T J.(1998) Golgilocalization and functionally important domains in the NH2 and COOH terminus of the yeast CLC putative chloride channel Gef1p. J Biol Chem 273:15110-15118. (19) Kubisch C, Schmidt-Rose T, Fontaine B. Bretag A H, Jentsch T J. (1998) CIC-1 chloridechannel mutations in myotonia congenita: variable penetrance of mutations shifting the voltage dependence. Hum Mol Genet. 7:1753-1760. (20) Igarashi T, Gunther W, Sekine T, Inatomi J, Shiraga H, Takahashi S, Suzuki J, Tsuru N, Yanagihara T, Shimazu M,Jentsch T J, Thakker R V.(1998) Functional characterization of renal chloride channel, CLCN5, mutations associated with Dent's Japan disease. Kidney Int. 54:1850-1856. (21) Friedrich T, Breiderhoff T, Jentsch T J.(1999) Mutational analysisdemonstrates that CIC-4 and CIC-5 directly mediate plasma membrane currents. J Biol Chem 274:896-902. (22) Yamamoto K, Cox J P, Friedrich T, Christie P T, Bald M, Houtman P N, Lapsley M J, Patzer L, Tsimaratos M, VanT Hoff W G, Yamaoka K, Jentsch T J,Thakker R V. (2000) Characterization of renal chloride channel (CLCN5) mutations in Dents disease. J Am Soc Nephrol 11:1460-1468. (23) Piwon N, Gunther W, Schwake M, Bosl M R, Jentsch TJ.(2000) CIC-5 CI-channel disruption impairs endocytosis in a mousemodel for Dent's disease. Nature 408:369-373. (24) Fahike C.(2000) Molecular mechanisms of ion conduction In CIC-type chloride channels: lessons from diseaseausing mutations. Kidney Int 57:780-786. (25) Jen K Y, Gewirtz AM. (2000) Suppression ofgene expression by targeted disruption of messenger RNA: available options and current strategies. Stem Cells 18:307-319. (26) Marschall P, Thomson J B, Eckstein F. Inhibition of gene expression with ribozymes. Cell Mol Neurobiol. 14:523-538. (27)Lewalle P, Marfiat P (1993) Inhibition of P210 expression in chronic myeloid leukaemia: oligonucleotides and/or transduced antisense sequences. Leuk Lymphoma 11 Suppl 1:139-43. (28) Montrose-Rafizadeh C, Kole J, Bartkowsid L M, Lee L H, Blackmon D L,Behnken S E, Gearhart J D, Cohn J A, Montrose M H (1997). Gene targeting of a CFTR allele in HT29 human epithelial cells. J Cell Physiol 170:299-308 (29) Luyckx V A, Leclercq B, Dowland L K, Yu A S (1999) Diet-dependent hypercalciuria in transgenicmice with reduced CLC5 chloride channel expression. Proc Natl Acad Sci USA 96:12174-12179 (30) Liu R. U W, Karin N J, Bergh J J, Adler-Storthz K, Farach-Carson M C (2000) Ribozyme ablation demonstrates that the cardiac subtype of the voltage-sensitivecalcium channel is the molecular transducer of 1,25-dihydroxyvitamin D3-stimulated calcium influx in osteoblastic cells. J Biol Chem 275:8711-8718 (31) Nakao M, Furukawa K, Satoh E, Ono K, Iijima T (2000) Inhibition by antisense oligonucleotides ofplasma membrane Ca2 ATPase in vascular endothelial cells. Eur J Pharmacol 387:273-277. (32) Tottene A, Volsen S, Pietrobon D (2000) alpha1E subunits form the pore of three cerebellar R-type calcium channels with different pharmacological andpermeation properties. J Neurosci 20:171-178. (33) Brussaard A B (1997) Antisense oligonucleotides induce functional deletion of ligand gated ion channels in cultured neurons and brain explants. J Neurosci Methods. 71:55-64. (34) Vincent A,Lautermilch N J, Spitzer N C (2000) Antisense suppression of potassium channel expression demonstrates its role in maturation of the action potential. J Neurosci 20:6087-6094. (35) Wang L, Chen L, Jacob T J (2000) The role of CIC-3 in volume activatedchloride currents and volume regulation in bovine epithelial cells demonstrated by antisense inhibition. J. Physiol. 524: 63-75. (36) Leconte L, Barnstable C J.(2000) Impairment of rod cGMP-gated channel alpha-subunit expression leads to photoreceptor and bipolar cell degeneration. Invest Ophthalmol Vis Sci 41:917-926. (37) Gokhan S, Song Q, Mehler M F (1998) Generationand regulation of developing immortalized neural cell lines. Methods 16:345-358. (38) Katakura Y. Alam S, Shirahata S. (1998) Immortalization by gene transfection. Methods Cell Biol 57:69-91. (39) Yeager T R, Reddel R R (1999) Constructingimmortalized human cell lines. Curr Opin Biotechnol 10:465469. (40) Jat P S, Noble M D, Atallots P, Tanaka Y, Yannoutsos N, Larsen L, Kioussis D. (1991) Direct derivation of conditionally immortal cell lines from an H-2 Kb-tsA58 transgenic mouse. ProcNatl Acad Sci USA 88:5096-5100. (41) Whitehead R H, VanEeden P E, Noble M D, Ataliotis P, Jat PS. (1993) Establishment of conditionally immortalized epithelial cell lines from both colon and small intestine of adult H-2Kb-tsA58 transgenic mice. ProcNatl Acad Sci USA 90:587-591. (42) D'Abaco G M, Whitehead R H, Burgess A W (1996) Synergy between Apc min and an activated ras mutation is sufficient to induce colon carcinomas. Mol Cell Biol 16:884-891. (43) Vandewalle A.(1999) Immortalized kidneycells derived from transgenic mice harboring L-type pyruvate kinaseand vimentin promoters. Exp Nephrol 7:386-393. (44) Miesenbock G, De Angelis D A, Rothman J E (1998) Visualizing secretion and synaptic transmission with pH-sensitive green fluorescentproteins. Nature 394: 192-195. (45) Uopis J, McCaffery J M, Miyawaki A, Farquhar M G, Tsien RY. (1998) Measurement of cytosolic, mitochondrial, and Golgi pH in single living cells with green fluorescent proteins. Proc Natl Acad Sci USA. 95:6803-6808. (46) Kneen M, Farinas J, U Y, Verkman A S (1998) Green fluorescent protein as a noninvasive intracellular pH indicator. Biophys J 74:1591-1599. (47) Wu M M, Uopis J, Adams S R, McCaffery J M, Teter K, Kulomaa M S, Machen T E, Moore H P,Tsien R Y.(2000) Studying organelle physiology with fusion protein-targeted avidin and fluorescent biotin conjugates. Methods Enzymol. 327:546-564. (48) Schapiro F B, Grinstein S.(2000) Determinants of the pH of the Goigi complex. J Biol Chem275:21025-21032. (49) Demaurex N, Furuya W. D'Souza S, Bonifacino J S, Grinstein S (1998) Mechanism of acidification of the trans-Golgi network (TGN). In situ measurements of pH using retrieval of TGN38 and furin from the cell surface. J Biol Chem273:2044-2051. (50) Diwu Z, Chen C S, Zhang C, Kiaubert D H, Haugland RP. (1999) A novel acidotropic pH indicator and its potential application in labeling acidic organelles of live cells. Chem Biol 6:411-418. (51) Overly C C, Lee K D, Berthiaume E,Hollenbeck PJ. (1995) Quantitative measurement of intraorganelle pH in the endosomal-iysosomal pathway in neurons by using ratiometric imaging with pyranine. Proc Natl Acad Sci USA 92:3156-3160. (52) Boyde A, Ali N N, Jones S J.(1984) Resorption ofdentine by isolated osteoclasts in vitro. Br Dent J 156:216-220 (53) Chambers T J, Revell P A, Fuller K, Athanasou N A. (1984) Resorption of bone by isolated rabbit osteoclasts. J Cell Sci. 1984 March;66:383-399. (54) Sun L, Adebanjo O A, Moonga B S,Corisdeo S, Anandatheerthavarada H K, Biswas G, Arakawa T, Hakeda Y, Koval A, Sodam B, Bevis P J, Moser A J, Lai F A, Epstein S, Troen B R, Kumegawa M, Zaidi M (1999) CD38/ADP-ribosyl cyclase: A new role in the regulation of osteoclastic bone resorption. J Cell Biol 146:1161-1172 (55) Okazaki R, Toriumi M, Fukumoto S, Miyamoto M, Fujita T, Tanaka K, Takeuchi Y (1999) Thiazolidinediones inhibit osteoclast-like cell formation and bone resorption in vitro. Endocrinology 140:5060-5065 (56) Udagawa N,Takahashi N, Jimi E, Matsuzaki K, Tsurukai T, Itoh K, Nakagawa N, Yasuda H, Goto M, Tsuda E, Higashio K, Gillespie M T, Martin T J, Suda T (1999) Osteoblasts/stromal cells stimulate osteoclast activation through expression of osteoclast differentiationfactor/RANKL but not macrophage colony-stimulating factor receptor activator of NF-kappa B ligand. Bone 25:517-523 (57) Redey S A, Razzouk S, Rey C, Bemache-Assollant D, Leroy G, Nardin M, Coumot G (1999) Osteoclast adhesion and activity on synthetichydroxyapatite, carbonated hydroxyapatite, and natural calcium carbonate: relationship to surface energies. J Biomed Mater Res 45:140-147 (58) llvesaro J, Vaananen K, Tuukkanen J (2000) Bone-resorbing osteoclasts contain gap-junctonal connexin-43. JBone Miner Res 15:919-926. (59) Baron R, Neff L, Louvard D, Courtoy PJ. (1985) Cell-mediated extracellular acidification and bone resorption: evidence for a low pH in resorbing lacunae and localization of a 100-kD lysosomal membrane protein atosteoclast ruffled border. J. Cell Biol. 101:2210-2222. (60) Inoue M, Yoshida H, Akisaka T (1999) Visualization of acidic compartments in cultured osteoclasts by use of an acidotrophic amine as a marker for low pH. Cell Tissue Res 298:527-537. (61)Laitala-Leinonen T. Lowik C, Papapoulos S, Vaananen H K (1999) Inhibition of intravacuolar acidification by antisense RNA decreases osteoclast differentiation and bone resorption in vitro. J Cell Sci 112:3657-3666. (62) Shioi J, Naito S, Ueda T. (1989)Glutamate uptake into synaptic vesicles of bovine cerebral cortex and electrochemical potential difference of proton across the membrane. Biochem J. 258:499-504. (63) Tabb J S, Kish P E, Van Dyke R, Ueda T. (1992) Glutamate transport into synapticvesicles. Roles of membrane potential, pH gradient, and intravesicular pH. J Blol Chem. 267:15412-15418. (64) Hartinger J, Jahn R. (1993) An anion binding site that regulates the glutamate transporter of synaptic vesicles. J Biol Chem.268:23122-23127. (65) Maycox P R, Deckwerth T, Hell J W, Jahn R. (1988) Glutamate uptake by brain synaptic vesicles. Energy dependence of transport and functional reconstitution in proteoliposomes. J. Biol. Chem. 263:15423-15428. (66) Hell J W,Maycox P R, Stadler H, Jahn R.(1988) Uptake of GABA by rat brain synaptic vesicles isolated by a new procedure. EMBO J. 7:3023-3029. (67) Hell J W, Maycox P R, Jahn R.(1990) Energy dependence and functional reconstitution of the gamma-aminobutyric acidcarrier from synaptic vesicles. J. Biol. Chem. 265:2111-2117 (68) Thomas-Reetz A, Hell J W, During M J, Walch-Solimena C, Jahn R, De Camilli P.(1993) A gamma-aminobutyric acid transporter driven by a proton pump is present in synaptic-likemicrovesicles of pancreatic beta cells. Proc Natl Acad Sci USA. 90:5317-5321. (69) Mellman I (1992) The importance of being acid: the role of acidification in intracellular membrane traffic. J. exp. Biol. 172: 39-45. (70) Presley J F, Mayor S,Dunn K W, Johnson L S, McGraw T E, Maxfield FR. (1993) The End2 mutation in CHO cells slows the exit of transferrin receptors from the recycling compartment but bulk membrane recycling is unaffected. J Cell Biol 122:1231-1241. (71) Presley J F, MayorS, McGraw T E, Dunn K W, Maxfield FR. (1997) Bafilomycin A1 treatment retards transferrin receptor recycling more than bulk membrane recycling. J. Biol. Chem. 272:13929-13936. (72) Johnson L S, Dunn K W, Pytowski B, McGraw TE. (1993) Endosomeacidification and receptor trafficking: bafilomycin A1 slows receptor externalization by a mechanism involving the receptor's internalization motif. Mol Biol Cell 4:1251-1266. (73) Chapman R E, Munro S. (1994) Retrieval of TGN proteins from the cellsurface requires endosomal acidification. EMBO J. 13:2305-2312. (74) Clague M J, Urbe S, Aniento F, Gruenberg J. (1994) Vacuolar ATPase activity is required for endosomal carrier vesicle formation. J. Biol. Chem. 269:21-24. (75) Tycko B, Maxfield FR (1982) Rapid acidification of endocytotic vesicles containing α2-macroglobulin. Cell 28: 643-651. (76) Zen K, Biwersi J, Periasamy N, Verkman A S (1992) Second messengers regulate endosomal acidification in Swiss 3T3 fibroblasts. J CellBiol 119: 99-110. (77) Siegel M S, Isacoff E Y (1997) A genetically encoded optical probe of membrane voltage. Neuron 19:735-741. (78) Gene Targeting. A Practical Approach. Editor Joyner, A. L. IRL Press at Oxford University Press (Oxford, New York,Tokyo) (1993). (79) Brandt S, Jentsch T J (1995) CIC-6 and CIC-7 are two novel broadly expressed members of the CLC chloride channel family. FEBS Letters 377:15-20. (80) Komak U, Bosl M R, Kubisch C.(1999) Complete genomic structure of the CLCN6 andCLCN7 putative chloride channel genes. Biochim Biophys Acta 1447:100-106. (81) Reimer R J, Fon E A, Edwards RH. (1998) Vesicular neurotransmitter transport and the presynaptic regulation of quantal size. Curr Opin Neurobiol. 8:405412. (82) GasnierB. (2000) The loading of neurotransmitters into synaptic vesicles. Biochimie 82:327337. (83) Kawasaki M, Uchida S, Monkawa T, Miyawaki A, Mikoshiba K, Mammo F, Sasaki S. (1994) Cloning and expression of a protein kinase C-regulated chloride channelabundantly expressed in rat brain neuronal cells. Neuron. 12:597404. (84) Borsani G, Rugarii E I, Taglialatela M, Wong C, Ballabio A.(1995) Characterization of a human and murine gene (CLCN3) sharing similarities to voltage-gated chloride channels andto a yeast integral membrane protein. Genomics. 27:131-141. (85) Sterrer S, Henco K. (1997) Fluorescence correlation spectroscopy (FCS)--a highly sensitive method to analyze drug/target interactions. J Recept Signal Transduct Res. 17:511-520 (86)Kask P, Palo K, Ullmann D, Gall K. (1999) Fluorescence-intensity distribution analysis and its application in biomolecular detection technology. Proc Natl Acad Sci USA. 96:13756-13561. (87) Palo K, Mets U, Jager S, Kask P, Gall K (2000) Fluorescenceintensity multiple distributions analysis: concurrent determination of diffusion times and molecular brightness. Biophys J 79:2858-2866. (88) Schaerti S. Meyer-Almes FJ, LopezCalle E, Siemers A, Kramer J (2000) A novel and robust homogeneousfluorescence-based assay using nanoparticles for pharmaceutical screening and diagnostics. J Biomol Screen 5:227-238. (89) Kardsson R.(1994) Real-time competitive kinetic analysis of interactions between low-molecular-weight ligands in solution andsurface-immobilized receptors. Anal Biochem. 221:142-151. (90) Beerheide W, Bernard H U, Tan Y J, Ganesan A, Rice W G, Ting AE. (1999) Potential drugs against cervical cancer: zinc-ejecting inhibitors of the human papillo-mavirus type 16 E6oncoprotein. J Natl Cancer Inst. 91:1211-1220. (91) Deckert F, Legay F.(2000) Development and validation of an IL-6 immuno-receptor assay based on surface plasmon resonance. J Pharm Biomed Anal. 23:403-412. (92) Frostell-Kardsson A, Remaeus A, RoosH, Andersson K, Borg P, Hamalainen M, Karlsson R.(2000) Biosensor analysis of the interaction between immobilized human serum albumin and drug compounds for prediction of human serum albumin binding levels. J Med Chem. 43:1986-1992. (93) Markgren P O,Hamalainen M, Danielson UH. (2000) Kinetic analysis of the interaction between HIV-1 protease and inhibitors using optical biosensor technology. Anal Biochem. 2000 Mar 1;279(1):71-8. (94) Williams C. (2000) Biotechnology match making: screeningorphan ligands and receptors. Curr Opin Biotechnol 11:42-46. (95) Van Noorden C J, Vogels I M, Everts V, Beertsen W. (1987) Localization of cathepsin B activity in fibroblasts and chondrocytes by continuous monitoring of the formation of a finalfluorescent reaction product using 5-nitrosalicylaldehyde. Histochem J 19:483-487. (96) Xia L, Kilb J, Wex H, U Z, Upyansky A, Breuil V, Stein L, Palmer J T, Dempster D W, Bromme D (1999) Localization of rat cathepsin K In osteoclasts and resorptionpits: inhibition of bone resorption and cathepsin K-activity by peptidyl vinyl sulfones. Biol Chem. 1999 June;380(6):679-87. The invention has been described in detail with reference to preferred embodiments thereof. However, it will be appreciated that those skilled in the art, upon consideration of this disclosure, may make modifications and improvements within thespirit and scope of the invention. All references disclosed herein are incorporated by reference. > 53 DNA Homo sapiens gene (53) CLCN3 cacgg gcgaactaga acactgggaa aggggctgca ggttccggac cggaccggcc 6ccgga ataatgagca aggagggtgt ggtgggttga aagccatcct actttactcc gttagag catggattca gttttagtct taagggggaa gtgagattgg agatttttat taatttt gggcagaagc aggttgactc tagggatctc cagagcgaga ggatttaact 24ttgct cccgtgtttg aaggaggaca ataaaagtcccaccgggcaa aattttcgta 3ctgcgg tagaaaacgt caggtatctt ttaaatcgcg atagttttcg ctgtgtcagg 36ttcgg tggagctccg agggtagcta ggttctaggt ttgaaacaga tgcagaatcc 42cagcg caaaaaacag ccaccgattt tgctatgtct ctgagctgcg agataatcag 48taa atg gagtct gag cag ctg ttc cat aga ggc tac tat aga aac 53lu Ser Glu Gln Leu Phe His Arg Gly Tyr Tyr Arg Asn agc tac aac agt ata aca agt gca agt agt gat gag gaa ctt tta gat 578 Ser Tyr Asn Ser Ile Thr Ser Ala Ser Ser Asp Glu Glu Leu Leu Asp 5 3ca ggt gtt att atg gac ttt caa aca tct gaa gat gac aat tta 626 Gly Ala Gly Val Ile Met Asp Phe Gln Thr Ser Glu Asp Asp Asn Leu 35 4a gat ggt gac act gca gtt gga act cat tat aca atg aca aat gga 674 Leu Asp Gly Asp Thr Ala Val Gly Thr HisTyr Thr Met Thr Asn Gly 5 ggc agc att aac agt tct aca cat tta ctg gat ctt ttg gat gaa cca 722 Gly Ser Ile Asn Ser Ser Thr His Leu Leu Asp Leu Leu Asp Glu Pro 65 7t cca ggt gtt ggt aca tat gat gat ttc cat act att gat tgg gtg 77ro GlyVal Gly Thr Tyr Asp Asp Phe His Thr Ile Asp Trp Val 8 cga gaa aaa tgt aaa gac aga gaa agg cat aga cgg atc aac agc aaa 8Glu Lys Cys Lys Asp Arg Glu Arg His Arg Arg Ile Asn Ser Lys 95 aaa gaa tca gca tgg gaa atg aca aaa agtttg tat gat gcg tgg 866 Lys Lys Glu Ser Ala Trp Glu Met Thr Lys Ser Leu Tyr Asp Ala Trp gga tgg cta gta gta aca cta aca gga ttg gca tca ggg gca ctg 9Gly Trp Leu Val Val Thr Leu Thr Gly Leu Ala Ser Gly Ala Leu ggatta ata gac att gct gcc gat tgg atg act gac cta aag gag 962 Ala Gly Leu Ile Asp Ile Ala Ala Asp Trp Met Thr Asp Leu Lys Glu att tgc ctt agt gcg ttg tgg tac aac cac gaa cag tgc tgt tgg y Ile Cys Leu Ser Ala Leu Trp Tyr Asn His GluGln Cys Cys Trp tct aat gaa aca aca ttt gaa gag agg gat aaa tgt cca cag tgg y Ser Asn Glu Thr Thr Phe Glu Glu Arg Asp Lys Cys Pro Gln Trp aaa aca tgg gca gaa tta atc ata ggt caa gca gag ggt cct ggt tct s ThrTrp Ala Glu Leu Ile Ile Gly Gln Ala Glu Gly Pro Gly Ser 2atc atg aac tac ata atg tac atc ttc tgg gcc ttg agt ttt gcc r Ile Met Asn Tyr Ile Met Tyr Ile Phe Trp Ala Leu Ser Phe Ala 222tt gca gtt tcc ctg gta aag gta tttgct cca tat gcc tgt ggc e Leu Ala Val Ser Leu Val Lys Val Phe Ala Pro Tyr Ala Cys Gly 225 23ct gga att cca gag att aaa act att tta agt gga ttc atc atc aga r Gly Ile Pro Glu Ile Lys Thr Ile Leu Ser Gly Phe Ile Ile Arg 245ac ttg gga aaa tgg act tta atg att aaa acc atc aca tta gtc y Tyr Leu Gly Lys Trp Thr Leu Met Ile Lys Thr Ile Thr Leu Val 255 267ct gtg gca tca ggt ttg agt tta gga aaa gaa ggt ccc ctg gta u Ala Val Ala Ser Gly Leu Ser Leu GlyLys Glu Gly Pro Leu Val 275 28at gtt gcc tgt tgc tgc gga aat atc ttt tcc tac ctc ttt cca aag s Val Ala Cys Cys Cys Gly Asn Ile Phe Ser Tyr Leu Phe Pro Lys 29agc aca aac gaa gct aaa aaa agg gag gtg cta tca gct gcc tca rSer Thr Asn Glu Ala Lys Lys Arg Glu Val Leu Ser Ala Ala Ser 33gca ggg gtt tct gta gct ttt ggt gca cca att gga gga gtt ctt a Ala Gly Val Ser Val Ala Phe Gly Ala Pro Ile Gly Gly Val Leu 323gc ctg gaa gag gtt agc tat tatttt cct ctc aaa act tta tgg e Ser Leu Glu Glu Val Ser Tyr Tyr Phe Pro Leu Lys Thr Leu Trp 335 345ca ttt ttt gct gct tta gtg gct gca ttt gtt ttg agg tcc atc g Ser Phe Phe Ala Ala Leu Val Ala Ala Phe Val Leu Arg Ser Ile 355 36at cca ttt ggt aac agc cgt ctg gtc ctt ttt tat gtg gag tat cat n Pro Phe Gly Asn Ser Arg Leu Val Leu Phe Tyr Val Glu Tyr His 378ca tgg tac ctt ttt gaa ctg ttt cct ttt att ctt cta ggg gta r Pro Trp Tyr Leu Phe Glu Leu PhePro Phe Ile Leu Leu Gly Val 385 39tt gga ggg ctt tgg gga gcc ttt ttc att agg gca aat att gcc tgg e Gly Gly Leu Trp Gly Ala Phe Phe Ile Arg Ala Asn Ile Ala Trp 44cgt cga cgc aag tcc acg aaa ttt gga aag tat ccc gtt ctg gaa s Arg Arg Arg Lys Ser Thr Lys Phe Gly Lys Tyr Pro Val Leu Glu 4425 43tt att gtt gca gcc att act gct gtg ata gcc ttc cct aat cca l Ile Ile Val Ala Ala Ile Thr Ala Val Ile Ala Phe Pro Asn Pro 435 44ac act agg cta aac acc agtgaa ctg atc aaa gag ctt ttt aca gac r Thr Arg Leu Asn Thr Ser Glu Leu Ile Lys Glu Leu Phe Thr Asp 456gt ccc ctg gaa tcc tct tct ctt tgt gac tac aga aat gac atg s Gly Pro Leu Glu Ser Ser Ser Leu Cys Asp Tyr Arg Asn Asp Met 46547at gcc agt aaa att gtc gat gac att cct gat cgt cca gca ggc att n Ala Ser Lys Ile Val Asp Asp Ile Pro Asp Arg Pro Ala Gly Ile 489ta tat tca gct ata tgg cag tta tgc ctg gca ctc ata ttt aaa 2 Val Tyr Ser Ala Ile Trp GlnLeu Cys Leu Ala Leu Ile Phe Lys 495 55ata atg aca gta ttc act ttt ggc atc aag gtt cca tca ggc ttg 2 Ile Met Thr Val Phe Thr Phe Gly Ile Lys Val Pro Ser Gly Leu 5525 ttc atc ccc agc atg gcc att gga gcg atc gca gga agg att gtgggg 2 Ile Pro Ser Met Ala Ile Gly Ala Ile Ala Gly Arg Ile Val Gly 534cg gtg gag cag ctt gcc tac tat cac cac gac tgg ttt atc ttt 2 Ala Val Glu Gln Leu Ala Tyr Tyr His His Asp Trp Phe Ile Phe 545 55ag gag tgg tgt gag gtcggg gct gat tgc att aca cct ggc ctt tat 22Glu Trp Cys Glu Val Gly Ala Asp Cys Ile Thr Pro Gly Leu Tyr 567tg gtt ggt gct gct gca tgc tta ggt ggt gtg aca aga atg act 2258 Ala Met Val Gly Ala Ala Ala Cys Leu Gly Gly Val Thr Arg Met Thr575 589cc ctg gtg gtt att gtt ttt gag ctt act gga ggc ttg gaa tat 23Ser Leu Val Val Ile Val Phe Glu Leu Thr Gly Gly Leu Glu Tyr 595 6att gtt ccc ctt atg gct gca gtc atg acc agt aaa tgg gtt gga gat 2354 Ile Val Pro Leu Met AlaAla Val Met Thr Ser Lys Trp Val Gly Asp 662tt ggc agg gaa ggc att tat gaa gca cac atc cga tta aat gga 24Phe Gly Arg Glu Gly Ile Tyr Glu Ala His Ile Arg Leu Asn Gly 625 63ac cct ttc ttg gat gca aaa gaa gaa ttc gaa ttc act catacc acc 245ro Phe Leu Asp Ala Lys Glu Glu Phe Glu Phe Thr His Thr Thr 645ct gct gac gtt atg aga cct cga agg aat gat cct ccc tta gct 2498 Leu Ala Ala Asp Val Met Arg Pro Arg Arg Asn Asp Pro Pro Leu Ala 655 667tg aca caggac aat atg aca gtg gat gat ata gaa aac atg att 2546 Val Leu Thr Gln Asp Asn Met Thr Val Asp Asp Ile Glu Asn Met Ile 675 68at gaa acc agc tac aat gga ttt cct gtc ata atg tca aaa gaa tct 2594 Asn Glu Thr Ser Tyr Asn Gly Phe Pro Val Ile Met Ser LysGlu Ser 69aga tta gtg gga ttt gcc ctc aga aga gac ctg aca att gca ata 2642 Gln Arg Leu Val Gly Phe Ala Leu Arg Arg Asp Leu Thr Ile Ala Ile 77agt gcc agg aaa aaa caa gaa ggt atc gtt ggc agt tct cgg gtg 269er Ala Arg LysLys Gln Glu Gly Ile Val Gly Ser Ser Arg Val 723tt gca cag cac acc cca tct ctt cca gca gaa agt cct cgg cca 2738 Cys Phe Ala Gln His Thr Pro Ser Leu Pro Ala Glu Ser Pro Arg Pro 735 745ag ctt cga agc att ctt gac atg agc cct tttaca gtg aca gac 2786 Leu Lys Leu Arg Ser Ile Leu Asp Met Ser Pro Phe Thr Val Thr Asp 755 76ac acc cca atg gag att gtg gtg gat att ttc cga aag ctg gga ctg 2834 His Thr Pro Met Glu Ile Val Val Asp Ile Phe Arg Lys Leu Gly Leu 778ag tgcctt gta act cac aat ggg cgc ctc ctt ggc att ata aca 2882 Arg Gln Cys Leu Val Thr His Asn Gly Arg Leu Leu Gly Ile Ile Thr 785 79aa aaa gat atc ctc cgg cat atg gcc cag acg gca aac caa gac ccc 293ys Asp Ile Leu Arg His Met Ala Gln Thr Ala AsnGln Asp Pro 88tca ata atg ttc aac tga atctcacaga tgaggagaga gaagaaacgg 298er Ile Met Phe Asn 8aagaggaagt ttatttgttg aatagcacaa ctctttaacc tgagggagtc atctactttt 3tcctcct ttacaaaaaa agaaaggaaa tataaaagcc gggtttttgcaacatggttt 3aataatg ctggtggaat ggaggagttg tttggggagg gaaaggagag agaaggaaag 3tgaggta tttcccgtct aacagaaagc agcgtatcaa ctcctattgt tctgcactgg 322ttcag ctgaggatgt gcctgatagt gcaggcttgc gcctcaacag agatgacagc 328cctcg agcacctggcctgtttgctc acatgcaaga cacatacagc cctattctag 334acttg aatggacctc tataaacgca aggttcttgc ctttttttaa tcaaaactgt 34tttaat tcatgaattg tatagttaag cattaccttt ctacattcca gaagagcctt 346ctctc tctctctctc tctctctctc tctctctact gagctgtaacaaagcctctt 352cggtg tatccttttg aagcagtcct ttctcatatt gagatgtact gtgattttac 358tttca tcacaagaag ggagtgtttc ttgtgccatt aaccatgtag tttgtaccat 364aatgc ttggaacagt acacatgcac cacaacaaag gctcatcaaa caggtaaagt 37aaggaa gcgagaacgaaatctctcat tgtgtgccgt gtggctcaaa accgaaaaca 376gcttg gttttaaagg ataaagtttt cttttttgtt ttcctctcag actttatgga 382tgacc gggtcttatg caaattttct atttctaaaa ctactactat gatatacaag 388ttgag cataattaaa taaaatgctg ctgctttgac agtaaagagaaggaagtatt 394aaaaa ac 3953 2 82omo sapiens 2 Met Glu Ser Glu Gln Leu Phe His Arg Gly Tyr Tyr Arg Asn Ser Tyr Ser Ile Thr Ser Ala Ser Ser Asp Glu Glu Leu Leu Asp Gly Ala 2 Gly Val Ile Met Asp Phe Gln Thr Ser Glu Asp AspAsn Leu Leu Asp 35 4y Asp Thr Ala Val Gly Thr His Tyr Thr Met Thr Asn Gly Gly Ser 5 Ile Asn Ser Ser Thr His Leu Leu Asp Leu Leu Asp Glu Pro Ile Pro 65 7 Gly Val Gly Thr Tyr Asp Asp Phe His Thr Ile Asp Trp Val Arg Glu 85 9s CysLys Asp Arg Glu Arg His Arg Arg Ile Asn Ser Lys Lys Lys Ser Ala Trp Glu Met Thr Lys Ser Leu Tyr Asp Ala Trp Ser Gly Leu Val Val Thr Leu Thr Gly Leu Ala Ser Gly Ala Leu Ala Gly Ile Asp Ile Ala Ala Asp TrpMet Thr Asp Leu Lys Glu Gly Ile Cys Leu Ser Ala Leu Trp Tyr Asn His Glu Gln Cys Cys Trp Gly Ser Glu Thr Thr Phe Glu Glu Arg Asp Lys Cys Pro Gln Trp Lys Thr Ala Glu Leu Ile Ile Gly Gln Ala Glu Gly Pro GlySer Tyr Ile 2Asn Tyr Ile Met Tyr Ile Phe Trp Ala Leu Ser Phe Ala Phe Leu 222al Ser Leu Val Lys Val Phe Ala Pro Tyr Ala Cys Gly Ser Gly 225 234ro Glu Ile Lys Thr Ile Leu Ser Gly Phe Ile Ile Arg Gly Tyr 245 25eu Gly Lys Trp Thr Leu Met Ile Lys Thr Ile Thr Leu Val Leu Ala 267la Ser Gly Leu Ser Leu Gly Lys Glu Gly Pro Leu Val His Val 275 28la Cys Cys Cys Gly Asn Ile Phe Ser Tyr Leu Phe Pro Lys Tyr Ser 29Asn Glu Ala LysLys Arg Glu Val Leu Ser Ala Ala Ser Ala Ala 33Gly Val Ser Val Ala Phe Gly Ala Pro Ile Gly Gly Val Leu Phe Ser 325 33eu Glu Glu Val Ser Tyr Tyr Phe Pro Leu Lys Thr Leu Trp Arg Ser 345he Ala Ala Leu Val Ala Ala Phe ValLeu Arg Ser Ile Asn Pro 355 36he Gly Asn Ser Arg Leu Val Leu Phe Tyr Val Glu Tyr His Thr Pro 378yr Leu Phe Glu Leu Phe Pro Phe Ile Leu Leu Gly Val Phe Gly 385 39Leu Trp Gly Ala Phe Phe Ile Arg Ala Asn Ile Ala Trp CysArg 44Arg Lys Ser Thr Lys Phe Gly Lys Tyr Pro Val Leu Glu Val Ile 423al Ala Ala Ile Thr Ala Val Ile Ala Phe Pro Asn Pro Tyr Thr 435 44rg Leu Asn Thr Ser Glu Leu Ile Lys Glu Leu Phe Thr Asp Cys Gly 456euGlu Ser Ser Ser Leu Cys Asp Tyr Arg Asn Asp Met Asn Ala 465 478ys Ile Val Asp Asp Ile Pro Asp Arg Pro Ala Gly Ile Gly Val 485 49yr Ser Ala Ile Trp Gln Leu Cys Leu Ala Leu Ile Phe Lys Ile Ile 55Thr Val Phe Thr Phe GlyIle Lys Val Pro Ser Gly Leu Phe Ile 5525 Pro Ser Met Ala Ile Gly Ala Ile Ala Gly Arg Ile Val Gly Ile Ala 534lu Gln Leu Ala Tyr Tyr His His Asp Trp Phe Ile Phe Lys Glu 545 556ys Glu Val Gly Ala Asp Cys Ile Thr Pro GlyLeu Tyr Ala Met 565 57al Gly Ala Ala Ala Cys Leu Gly Gly Val Thr Arg Met Thr Val Ser 589al Val Ile Val Phe Glu Leu Thr Gly Gly Leu Glu Tyr Ile Val 595 6Pro Leu Met Ala Ala Val Met Thr Ser Lys Trp Val Gly Asp Ala Phe 662rg Glu Gly Ile Tyr Glu Ala His Ile Arg Leu Asn Gly Tyr Pro 625 634eu Asp Ala Lys Glu Glu Phe Glu Phe Thr His Thr Thr Leu Ala 645 65la Asp Val Met Arg Pro Arg Arg Asn Asp Pro Pro Leu Ala Val Leu 667ln Asp AsnMet Thr Val Asp Asp Ile Glu Asn Met Ile Asn Glu 675 68hr Ser Tyr Asn Gly Phe Pro Val Ile Met Ser Lys Glu Ser Gln Arg 69Val Gly Phe Ala Leu Arg Arg Asp Leu Thr Ile Ala Ile Glu Ser 77Ala Arg Lys Lys Gln Glu Gly Ile ValGly Ser Ser Arg Val Cys Phe 725 73la Gln His Thr Pro Ser Leu Pro Ala Glu Ser Pro Arg Pro Leu Lys 745rg Ser Ile Leu Asp Met Ser Pro Phe Thr Val Thr Asp His Thr 755 76ro Met Glu Ile Val Val Asp Ile Phe Arg Lys Leu Gly Leu ArgGln 778eu Val Thr His Asn Gly Arg Leu Leu Gly Ile Ile Thr Lys Lys 785 79Ile Leu Arg His Met Ala Gln Thr Ala Asn Gln Asp Pro Ala Ser 88Met Phe Asn 828 DNA Mus musculus gene (58) Clcn3 3 gctggagtgggcggaggcgt gagaaccgcg ttactttcct cccgaggtgg agagagactg 6gtagt ccttggagag cgcagtgagc ctccagtcgg ggcagaggcg ggttggtttg gcccgct ggagccgagg attgaacaac accctgaaac cagcctccgc cggtccgacc ccgcctt tacgtaacct ctcctgaaag ccggtagcag taaagtccgc cggggtggcc 24gcagc ggtgtcccgg tgaagctccc ggggcggctg gcgcgcgatc gcaagcagat 3ggtcca caggcagcgc agccaccagc cgcccagctt gctatgcctc tgagctgcaa 36tcatt ataca atg aca aat gga ggc agc att aat agc tct aca cac 4ThrAsn Gly Gly Ser Ile Asn Ser Ser Thr His ttg ctg gat ctt tta gat gag cct atc cca ggt gtc ggt acc tac gat 459 Leu Leu Asp Leu Leu Asp Glu Pro Ile Pro Gly Val Gly Thr Tyr Asp 5 gat ttc cat act att gac tgg gtg cga gag aag tgt aag gac aga gaa5Phe His Thr Ile Asp Trp Val Arg Glu Lys Cys Lys Asp Arg Glu 3 agg cac aga cgg atc aac agt aaa aaa aaa gaa tca gca tgg gaa atg 555 Arg His Arg Arg Ile Asn Ser Lys Lys Lys Glu Ser Ala Trp Glu Met 45 5 aca aaa agt ctg tat gac gcc tggtca gga tgg ctt gtc gtt aca ctg 6Lys Ser Leu Tyr Asp Ala Trp Ser Gly Trp Leu Val Val Thr Leu 65 7g gga ctg gca tca ggg gca cta gct gga ttg ata gac att gct gct 65ly Leu Ala Ser Gly Ala Leu Ala Gly Leu Ile Asp Ile Ala Ala 8 gactgg atg act gac ctg aag gag ggc atc tgc ctc agt gca ttg tgg 699 Asp Trp Met Thr Asp Leu Lys Glu Gly Ile Cys Leu Ser Ala Leu Trp 95 tac aac cat gaa cag tgt tgt tgg ggc tct aat gag aca acg ttt gaa 747 Tyr Asn His Glu Gln Cys Cys Trp Gly Ser Asn GluThr Thr Phe Glu agg gat aaa tgt cca cag tgg aaa aca tgg gca gag tta atc att 795 Glu Arg Asp Lys Cys Pro Gln Trp Lys Thr Trp Ala Glu Leu Ile Ile ggc caa gca gag ggc cct gga tct tat atc atg aac tac atc atg tat 843 Gly GlnAla Glu Gly Pro Gly Ser Tyr Ile Met Asn Tyr Ile Met Tyr ttt tgg gct ttg agt ttt gcc ttt ctt gca gtt tct ttg gtg aaa 89he Trp Ala Leu Ser Phe Ala Phe Leu Ala Val Ser Leu Val Lys ttt gct cca tat gcc tgt ggc tct ggaatt cca gag att aaa act 939 Val Phe Ala Pro Tyr Ala Cys Gly Ser Gly Ile Pro Glu Ile Lys Thr ttg agt gga ttt atc atc aga gga tac ttg gga aaa tgg act tta 987 Ile Leu Ser Gly Phe Ile Ile Arg Gly Tyr Leu Gly Lys Trp Thr Leu 2att aaa act atc acg tta gtg ctg gct gtg gca tca ggt ttg agt t Ile Lys Thr Ile Thr Leu Val Leu Ala Val Ala Ser Gly Leu Ser 22tta gga aaa gaa ggt ccc ctg gta cat gtt gcc tgc tgc tgt gga aat u Gly Lys Glu Gly Pro Leu Val His ValAla Cys Cys Cys Gly Asn 225 23tc ttt tcc tac ctc ttt cca aag tat agc acc aat gaa gct aaa aag e Phe Ser Tyr Leu Phe Pro Lys Tyr Ser Thr Asn Glu Ala Lys Lys 245ag gtg ctg tca gcc gcc tca gct gct ggg gtt tct gtg gct ttt gGlu Val Leu Ser Ala Ala Ser Ala Ala Gly Val Ser Val Ala Phe 255 26gt gca ccg atc gga gga gtt ctt ttt agc ttg gag gag gtt agc tat y Ala Pro Ile Gly Gly Val Leu Phe Ser Leu Glu Glu Val Ser Tyr 278tt cct ctc aaa act tta tgg agatca ttt ttt gct gct ttg gtg r Phe Pro Leu Lys Thr Leu Trp Arg Ser Phe Phe Ala Ala Leu Val 285 29gca ttt gtt ttg aga tcc atc aat cca ttt ggt aac agc cgt ctg a Ala Phe Val Leu Arg Ser Ile Asn Pro Phe Gly Asn Ser Arg Leu 33ctc ttt tat gtg gag tat cat aca cca tgg tac ctt ttt gaa ctg l Leu Phe Tyr Val Glu Tyr His Thr Pro Trp Tyr Leu Phe Glu Leu 323ct ttt att ctc cta ggg gta ttt gga ggg ctt tgg gga gct ttt e Pro Phe Ile Leu Leu Gly Val PheGly Gly Leu Trp Gly Ala Phe 335 34tt att agg gca aat att gcc tgg tgt cgt cga cgc aag tcc acc aaa e Ile Arg Ala Asn Ile Ala Trp Cys Arg Arg Arg Lys Ser Thr Lys 356ga aag tat cct gtt ctc gaa gtc att att gtt gca gcc att act e Gly Lys Tyr Pro Val Leu Glu Val Ile Ile Val Ala Ala Ile Thr 365 378tg ata gcc ttc ccc aac cca tac aca agg ctc aac acc agt gaa a Val Ile Ala Phe Pro Asn Pro Tyr Thr Arg Leu Asn Thr Ser Glu 385 39tg att aaa gag ctg ttt acagat tgt ggg ccg ttg gaa tcc tcc tct u Ile Lys Glu Leu Phe Thr Asp Cys Gly Pro Leu Glu Ser Ser Ser 44tgt gac tac aga aat gac atg aat gcc agt aaa att gtt gac gat u Cys Asp Tyr Arg Asn Asp Met Asn Ala Ser Lys Ile Val Asp Asp 4425 att cct gac cgt cca gca ggc gtt gga gta tat tca gct atc tgg cag e Pro Asp Arg Pro Ala Gly Val Gly Val Tyr Ser Ala Ile Trp Gln 434gc cta gcg ctc ata ttt aaa ata ata atg aca gta ttc act ttt u Cys Leu Ala Leu Ile Phe LysIle Ile Met Thr Val Phe Thr Phe 445 456tc aag gtc ccg tca ggc ttg ttt atc ccc agc atg gcc att gga y Ile Lys Val Pro Ser Gly Leu Phe Ile Pro Ser Met Ala Ile Gly 465 47cc att gca ggg aga att gtg ggg atc gct gtg gag cag ctt gcctac a Ile Ala Gly Arg Ile Val Gly Ile Ala Val Glu Gln Leu Ala Tyr 489ac cac gac tgg ttt atc ttc aag gag tgg tgt gag gtt ggg gct r His His Asp Trp Phe Ile Phe Lys Glu Trp Cys Glu Val Gly Ala 495 5gac tgc atc act ccc gggctg tat gcc atg gtt ggg gct gct gcg tgc p Cys Ile Thr Pro Gly Leu Tyr Ala Met Val Gly Ala Ala Ala Cys 552gt ggt gtg aca aga atg act gtg tct ctg gtg gtt att gtt ttt u Gly Gly Val Thr Arg Met Thr Val Ser Leu Val Val Ile Val Phe525 534tt act gga ggc ttg gaa tat att gtt cct ctt atg gct gca gta 2 Leu Thr Gly Gly Leu Glu Tyr Ile Val Pro Leu Met Ala Ala Val 545 55tg acc agt aaa tgg gtt ggt gat gcc ttt ggt agg gaa ggt att tat 2 Thr Ser Lys Trp ValGly Asp Ala Phe Gly Arg Glu Gly Ile Tyr 567ca cac atc cga cta aat ggg tac cct ttc ttg gat gca aaa gaa 2 Ala His Ile Arg Leu Asn Gly Tyr Pro Phe Leu Asp Ala Lys Glu 575 58aa ttc act cat aca acc ctg gct gct gat gtt atg aga cctcga aga 2 Phe Thr His Thr Thr Leu Ala Ala Asp Val Met Arg Pro Arg Arg 59gac cct ccc tta gct gtt ttg aca cag gac aat atg aca gta gat 2235 Ser Asp Pro Pro Leu Ala Val Leu Thr Gln Asp Asn Met Thr Val Asp 66gac ata gaa aacatg att aat gaa acc agc tat aat ggc ttt cct gtt 2283 Asp Ile Glu Asn Met Ile Asn Glu Thr Ser Tyr Asn Gly Phe Pro Val 625 63ta atg tca aaa gaa tct cag aga tta gtg gga ttt gcc ctc aga aga 233et Ser Lys Glu Ser Gln Arg Leu Val Gly Phe Ala LeuArg Arg 645tg act att gca ata gaa agt gcc aga aaa aaa caa gaa ggg att 2379 Asp Leu Thr Ile Ala Ile Glu Ser Ala Arg Lys Lys Gln Glu Gly Ile 655 66tt ggc agt tct cgg gtg tgt ttt gca cag cat act cca tct ctt cca 2427 Val Gly Ser Ser ArgVal Cys Phe Ala Gln His Thr Pro Ser Leu Pro 678aa agt cca cgg cca tta aaa ctg aga agc atc ctt gac atg agc 2475 Ala Glu Ser Pro Arg Pro Leu Lys Leu Arg Ser Ile Leu Asp Met Ser 685 69ttt aca gtg aca gac cac acc cca atg gag attgtg gta gac atc 2523 Pro Phe Thr Val Thr Asp His Thr Pro Met Glu Ile Val Val Asp Ile 77cga aag ctt ggt ctg agg cag tgc ctt gta act cac aac gga cgc 257rg Lys Leu Gly Leu Arg Gln Cys Leu Val Thr His Asn Gly Arg 723tt ggcatt ata aca aaa aaa gat atc ctc cgt cat atg gcc cag 26Leu Gly Ile Ile Thr Lys Lys Asp Ile Leu Arg His Met Ala Gln 735 74cg gca aac caa gac ccc gct tca ata atg ttc aac tga gtcctgtaga 2668 Thr Ala Asn Gln Asp Pro Ala Ser Ile Met Phe Asn 756acaga gaggagacag aagaggaagt tcgtttgttg aatagcacaa ttctttaatc 2728 tgcgggactc gtccactttt ttcttctttc 2758 4 76us musculus 4 Met Thr Asn Gly Gly Ser Ile Asn Ser Ser Thr His Leu Leu Asp Leu Asp Glu Pro Ile Pro Gly Val GlyThr Tyr Asp Asp Phe His Thr 2 Ile Asp Trp Val Arg Glu Lys Cys Lys Asp Arg Glu Arg His Arg Arg 35 4e Asn Ser Lys Lys Lys Glu Ser Ala Trp Glu Met Thr Lys Ser Leu 5 Tyr Asp Ala Trp Ser Gly Trp Leu Val Val Thr Leu Thr Gly Leu Ala 65 7 Ser Gly Ala Leu Ala Gly Leu Ile Asp Ile Ala Ala Asp Trp Met Thr 85 9p Leu Lys Glu Gly Ile Cys Leu Ser Ala Leu Trp Tyr Asn His Glu Cys Cys Trp Gly Ser Asn Glu Thr Thr Phe Glu Glu Arg Asp Lys Pro Gln Trp Lys ThrTrp Ala Glu Leu Ile Ile Gly Gln Ala Glu Pro Gly Ser Tyr Ile Met Asn Tyr Ile Met Tyr Ile Phe Trp Ala Leu Ser Phe Ala Phe Leu Ala Val Ser Leu Val Lys Val Phe Ala Pro Ala Cys Gly Ser Gly Ile Pro Glu Ile LysThr Ile Leu Ser Gly Ile Ile Arg Gly Tyr Leu Gly Lys Trp Thr Leu Met Ile Lys Thr 2Thr Leu Val Leu Ala Val Ala Ser Gly Leu Ser Leu Gly Lys Glu 222ro Leu Val His Val Ala Cys Cys Cys Gly Asn Ile Phe Ser Tyr 225234he Pro Lys Tyr Ser Thr Asn Glu Ala Lys Lys Arg Glu Val Leu 245 25er Ala Ala Ser Ala Ala Gly Val Ser Val Ala Phe Gly Ala Pro Ile 267ly Val Leu Phe Ser Leu Glu Glu Val Ser Tyr Tyr Phe Pro Leu 275 28ys Thr LeuTrp Arg Ser Phe Phe Ala Ala Leu Val Ala Ala Phe Val 29Arg Ser Ile Asn Pro Phe Gly Asn Ser Arg Leu Val Leu Phe Tyr 33Val Glu Tyr His Thr Pro Trp Tyr Leu Phe Glu Leu Phe Pro Phe Ile 325 33eu Leu Gly Val Phe Gly Gly LeuTrp Gly Ala Phe Phe Ile Arg Ala 345le Ala Trp Cys Arg Arg Arg Lys Ser Thr Lys Phe Gly Lys Tyr 355 36ro Val Leu Glu Val Ile Ile Val Ala Ala Ile Thr Ala Val Ile Ala 378ro Asn Pro Tyr Thr Arg Leu Asn Thr Ser Glu Leu IleLys Glu 385 39Phe Thr Asp Cys Gly Pro Leu Glu Ser Ser Ser Leu Cys Asp Tyr 44Asn Asp Met Asn Ala Ser Lys Ile Val Asp Asp Ile Pro Asp Arg 423la Gly Val Gly Val Tyr Ser Ala Ile Trp Gln Leu Cys Leu Ala 435 44eu Ile Phe Lys Ile Ile Met Thr Val Phe Thr Phe Gly Ile Lys Val 456er Gly Leu Phe Ile Pro Ser Met Ala Ile Gly Ala Ile Ala Gly 465 478le Val Gly Ile Ala Val Glu Gln Leu Ala Tyr Tyr His His Asp 485 49rp Phe Ile Phe LysGlu Trp Cys Glu Val Gly Ala Asp Cys Ile Thr 55Gly Leu Tyr Ala Met Val Gly Ala Ala Ala Cys Leu Gly Gly Val 5525 Thr Arg Met Thr Val Ser Leu Val Val Ile Val Phe Glu Leu Thr Gly 534eu Glu Tyr Ile Val Pro Leu Met Ala AlaVal Met Thr Ser Lys 545 556al Gly Asp Ala Phe Gly Arg Glu Gly Ile Tyr Glu Ala His Ile 565 57rg Leu Asn Gly Tyr Pro Phe Leu Asp Ala Lys Glu Glu Phe Thr His 589hr Leu Ala Ala Asp Val Met Arg Pro Arg Arg Ser Asp Pro Pro595 6Leu Ala Val Leu Thr Gln Asp Asn Met Thr Val Asp Asp Ile Glu Asn 662le Asn Glu Thr Ser Tyr Asn Gly Phe Pro Val Ile Met Ser Lys 625 634er Gln Arg Leu Val Gly Phe Ala Leu Arg Arg Asp Leu Thr Ile 645 65la IleGlu Ser Ala Arg Lys Lys Gln Glu Gly Ile Val Gly Ser Ser 667al Cys Phe Ala Gln His Thr Pro Ser Leu Pro Ala Glu Ser Pro 675 68rg Pro Leu Lys Leu Arg Ser Ile Leu Asp Met Ser Pro Phe Thr Val 69Asp His Thr Pro Met Glu IleVal Val Asp Ile Phe Arg Lys Leu 77Gly Leu Arg Gln Cys Leu Val Thr His Asn Gly Arg Leu Leu Gly Ile 725 73le Thr Lys Lys Asp Ile Leu Arg His Met Ala Gln Thr Ala Asn Gln 745ro Ala Ser Ile Met Phe Asn 755 768 DNAHomo sapiens gene (88) CLCN4 5 tacttcttcc aggcaccttg gctggggtca tcgatctcgc cgtggactgg atg acg 56 Met Thr tg aag gag ggg gtc tgc ctg tct gcc ttc tgg tat agc cat gag Leu Lys Glu Gly Val Cys Leu Ser Ala Phe Trp Tyr Ser His Glu 5 ag tgt tgc tgg act tct aac gag acc act ttt gag gac aga gac aag Cys Cys Trp Thr Ser Asn Glu Thr Thr Phe Glu Asp Arg Asp Lys 2 tgt ccc ctg tgg cag aaa tgg tcg gag ctg ctg gtg aat cag tca gag 2Pro Leu Trp Gln Lys Trp Ser Glu Leu LeuVal Asn Gln Ser Glu 35 4 ggt gcc agt gct tac att ctg aat tac tta atg tac atc cta tgg gcg 248 Gly Ala Ser Ala Tyr Ile Leu Asn Tyr Leu Met Tyr Ile Leu Trp Ala 55 6g ctg ttt gca ttt ttg gct gtc tcc ctg gtg cgt gta ttt gca cca 296 Leu Leu PheAla Phe Leu Ala Val Ser Leu Val Arg Val Phe Ala Pro 7 tat gcc tgt ggc tct ggc ata cca gag ata aag acc att ttg agc ggc 344 Tyr Ala Cys Gly Ser Gly Ile Pro Glu Ile Lys Thr Ile Leu Ser Gly 85 9t atc atc agg ggc tac ttg ggg aag tgg acc ctg ctaatc aag aca 392 Phe Ile Ile Arg Gly Tyr Leu Gly Lys Trp Thr Leu Leu Ile Lys Thr acg ctg gtg ctg gta gtg tcc tcc ggt ctg agc ctt ggg aag gaa 44hr Leu Val Leu Val Val Ser Ser Gly Leu Ser Leu Gly Lys Glu ggg ccg ctagtg cac gtg gct tgt tgc tgt ggc aac ttc ttc agc agc 488 Gly Pro Leu Val His Val Ala Cys Cys Cys Gly Asn Phe Phe Ser Ser ttc tcc aag tac agc aag aat gag ggc aag agg cgg gag gtg ctt 536 Leu Phe Ser Lys Tyr Ser Lys Asn Glu Gly Lys Arg ArgGlu Val Leu gct gca gcg gct gct gga gtc tct gtt gcc ttt ggt gca cca att 584 Ser Ala Ala Ala Ala Ala Gly Val Ser Val Ala Phe Gly Ala Pro Ile ggc gtg ctt ttc agt cta gaa gag gtc agt tac tac ttt ccc ctg 632 Gly Gly Val LeuPhe Ser Leu Glu Glu Val Ser Tyr Tyr Phe Pro Leu acc ttg tgg agg tca ttt ttc gca gcc ctg gtg gcg gcc ttt acg 68hr Leu Trp Arg Ser Phe Phe Ala Ala Leu Val Ala Ala Phe Thr 2ctg aga tcc atc aat ccc ttt ggg aat agc cgtctc gtt ctc ttt tat 728 Leu Arg Ser Ile Asn Pro Phe Gly Asn Ser Arg Leu Val Leu Phe Tyr 2225 gtg gaa tac cac acg ccc tgg tac atg gct gaa ctc ttc ccc ttc atc 776 Val Glu Tyr His Thr Pro Trp Tyr Met Ala Glu Leu Phe Pro Phe Ile 234tt ggg gtc ttc ggg ggc ttg tgg gga acc ctc ttc atc cgc tgc 824 Leu Leu Gly Val Phe Gly Gly Leu Trp Gly Thr Leu Phe Ile Arg Cys 245 25ac atc gcc tgg tgc agg agg cgc aag acc acc agg ctg ggg aag tac 872 Asn Ile Ala TrpCys Arg Arg Arg Lys Thr Thr Arg Leu Gly Lys Tyr 267tg ctg gag gtc att gtg gtg act gcc atc act gcc atc att gcc 92al Leu Glu Val Ile Val Val Thr Ala Ile Thr Ala Ile Ile Ala 275 289cc aat ccc tac aca cgc cag agc acc agcgag ctc att tct gag 968 Tyr Pro Asn Pro Tyr Thr Arg Gln Ser Thr Ser Glu Leu Ile Ser Glu 295 3ctg ttc aat gac tgt gga gcc ctt gag tct tcc cag ctc tgt gac tac u Phe Asn Asp Cys Gly Ala Leu Glu Ser Ser Gln Leu Cys Asp Tyr 332atgac ccc aac atg act cgg cct gtg gat gac att cca gac cgg e Asn Asp Pro Asn Met Thr Arg Pro Val Asp Asp Ile Pro Asp Arg 325 33cg gct ggt gtc ggt gtt tac acg gcc atg tgg cag ctg gcc ctg gca o Ala Gly Val Gly Val Tyr Thr Ala Met Trp GlnLeu Ala Leu Ala 345tc ttc aaa atc gtc gtt acc ata ttt acc ttt ggc atg aag atc u Ile Phe Lys Ile Val Val Thr Ile Phe Thr Phe Gly Met Lys Ile 355 367cg ggc ctc ttc atc ccc agc atg gct gtg ggc gcg ata gcg ggc o SerGly Leu Phe Ile Pro Ser Met Ala Val Gly Ala Ile Ala Gly 375 38gg atg gtg gga att ggc gtg gag cag ctg gcc tac cat cac cat gac g Met Val Gly Ile Gly Val Glu Gln Leu Ala Tyr His His His Asp 39atc atc ttc agg aac tgg tgc aga cccggt gca gac tgt gtc acg p Ile Ile Phe Arg Asn Trp Cys Arg Pro Gly Ala Asp Cys Val Thr 44ggg ctg tac gca atg gtg gga gct gcg gcc tgc ctc ggt gga gtt o Gly Leu Tyr Ala Met Val Gly Ala Ala Ala Cys Leu Gly Gly Val 423gg atg acg gtg tca ttg gtg gtc atc atg ttt gaa tta acc ggg r Arg Met Thr Val Ser Leu Val Val Ile Met Phe Glu Leu Thr Gly 435 445tg gag tac atc gtg ccc ctg atg gcg gcg gct gtg acc agc aag y Leu Glu Tyr Ile Val Pro Leu Met AlaAla Ala Val Thr Ser Lys 455 46gg gta gct gat gca ttt ggg aaa gaa ggc atc tac gag gcc cac atc p Val Ala Asp Ala Phe Gly Lys Glu Gly Ile Tyr Glu Ala His Ile 478ta aat ggg tac cct ttc ctt gac gtg aag gac gag ttt act cac sLeu Asn Gly Tyr Pro Phe Leu Asp Val Lys Asp Glu Phe Thr His 485 49gc aca ctg gcc acc gac gtc atg cgg ccc cgg cgg gga gag ccg cca g Thr Leu Ala Thr Asp Val Met Arg Pro Arg Arg Gly Glu Pro Pro 55tcg gtg ctc acc cag gac agc atgact gtc gag gac gtg gag acg u Ser Val Leu Thr Gln Asp Ser Met Thr Val Glu Asp Val Glu Thr 5525 53tc aag gag acc gac tac aac ggc ttc ccc gtg gtg gtc tcc aga u Ile Lys Glu Thr Asp Tyr Asn Gly Phe Pro Val Val Val Ser Arg 535 54ac tcc gag cgc ctc att gga ttt gcc cag agg agg gaa ctg att ctc p Ser Glu Arg Leu Ile Gly Phe Ala Gln Arg Arg Glu Leu Ile Leu 556ta aag aac gcc aga cag agg cag gag ggc att gtg agc aat tcc a Ile Lys Asn Ala Arg Gln Arg GlnGlu Gly Ile Val Ser Asn Ser 565 57tc atg tac ttc acg gag gaa ccc ccc gag ctg ccg gcc aac agc cca e Met Tyr Phe Thr Glu Glu Pro Pro Glu Leu Pro Ala Asn Ser Pro 589cc ctg aag ctg cgg cgc atc ctg aac ctc agc ccg ttt aca gtg s Pro Leu Lys Leu Arg Arg Ile Leu Asn Leu Ser Pro Phe Thr Val 595 66gac cac act ccg atg gaa acg gtg gtg gat atc ttc cgg aaa ctg r Asp His Thr Pro Met Glu Thr Val Val Asp Ile Phe Arg Lys Leu 6625 ggg ctt cgg cag tgc ctg gtgacg cgg agc ggg aga ctt ctt ggc atc y Leu Arg Gln Cys Leu Val Thr Arg Ser Gly Arg Leu Leu Gly Ile 634ca aaa aag gat gtt ctg aga cat atg gcc cag atg gca aac cag 2 Thr Lys Lys Asp Val Leu Arg His Met Ala Gln Met Ala Asn Gln 64565ac ccc gaa tcc atc atg ttt aat tag caacaaggtg gcaattattt 2 Pro Glu Ser Ile Met Phe Asn 66cagaaaaac actgactgtg tcatttaaaa agaaataaat gatatgttat tatcccaatg 2gatcatg cattggggac agcagaaaca aaagcttttt tggaaaggcg gggaagaagg 2aaacctt taaaaacaaa aacaaaaaca tcaatgagta ggcattttat agctttaacc 225tgagt ttcaagctgt gtttcctaat gagtttgcta ctgctgtggg ggcatgtggg 23taaatg atgtaaatga tgtgatctgt acaagtatgt ggagcatgaa tgctgactca 237ctttt actccttctg ctcaaggctgatgtttgtaa cttatgaaca cacgtgaagt 243gtcca aaagacaaag gggcatcggc atgtcagcgt ccttatttat tggttcttga 249tgctg ctatgttact gaatcatact aaagacattt gcgcttactt tgttgaaaaa 255agaaa ttaaatttga acacagtgaa agctgca 2588 6 666 PRT Homo sapiens 6 MetThr Asp Leu Lys Glu Gly Val Cys Leu Ser Ala Phe Trp Tyr Ser Glu Gln Cys Cys Trp Thr Ser Asn Glu Thr Thr Phe Glu Asp Arg 2 Asp Lys Cys Pro Leu Trp Gln Lys Trp Ser Glu Leu Leu Val Asn Gln 35 4r Glu Gly Ala Ser Ala Tyr Ile LeuAsn Tyr Leu Met Tyr Ile Leu 5 Trp Ala Leu Leu Phe Ala Phe Leu Ala Val Ser Leu Val Arg Val Phe 65 7 Ala Pro Tyr Ala Cys Gly Ser Gly Ile Pro Glu Ile Lys Thr Ile Leu 85 9r Gly Phe Ile Ile Arg Gly Tyr Leu Gly Lys Trp Thr Leu Leu Ile Thr Val Thr Leu Val Leu Val Val Ser Ser Gly Leu Ser Leu Gly Glu Gly Pro Leu Val His Val Ala Cys Cys Cys Gly Asn Phe Phe Ser Leu Phe Ser Lys Tyr Ser Lys Asn Glu Gly Lys Arg Arg Glu Val Leu SerAla Ala Ala Ala Ala Gly Val Ser Val Ala Phe Gly Ala Ile Gly Gly Val Leu Phe Ser Leu Glu Glu Val Ser Tyr Tyr Phe Leu Lys Thr Leu Trp Arg Ser Phe Phe Ala Ala Leu Val Ala Ala 2Thr Leu Arg Ser Ile Asn Pro PheGly Asn Ser Arg Leu Val Leu 222yr Val Glu Tyr His Thr Pro Trp Tyr Met Ala Glu Leu Phe Pro 225 234le Leu Leu Gly Val Phe Gly Gly Leu Trp Gly Thr Leu Phe Ile 245 25rg Cys Asn Ile Ala Trp Cys Arg Arg Arg Lys Thr Thr ArgLeu Gly 267yr Pro Val Leu Glu Val Ile Val Val Thr Ala Ile Thr Ala Ile 275 28le Ala Tyr Pro Asn Pro Tyr Thr Arg Gln Ser Thr Ser Glu Leu Ile 29Glu Leu Phe Asn Asp Cys Gly Ala Leu Glu Ser Ser Gln Leu Cys 33Asp Tyr Ile Asn Asp Pro Asn Met Thr Arg Pro Val Asp Asp Ile Pro 325 33sp Arg Pro Ala Gly Val Gly Val Tyr Thr Ala Met Trp Gln Leu Ala 345la Leu Ile Phe Lys Ile Val Val Thr Ile Phe Thr Phe Gly Met 355 36ys Ile Pro Ser Gly LeuPhe Ile Pro Ser Met Ala Val Gly Ala Ile 378ly Arg Met Val Gly Ile Gly Val Glu Gln Leu Ala Tyr His His 385 39Asp Trp Ile Ile Phe Arg Asn Trp Cys Arg Pro Gly Ala Asp Cys 44Thr Pro Gly Leu Tyr Ala Met Val Gly AlaAla Ala Cys Leu Gly 423al Thr Arg Met Thr Val Ser Leu Val Val Ile Met Phe Glu Leu 435 44hr Gly Gly Leu Glu Tyr Ile Val Pro Leu Met Ala Ala Ala Val Thr 456ys Trp Val Ala Asp Ala Phe Gly Lys Glu Gly Ile Tyr Glu Ala 465478le His Leu Asn Gly Tyr Pro Phe Leu Asp Val Lys Asp Glu Phe 485 49hr His Arg Thr Leu Ala Thr Asp Val Met Arg Pro Arg Arg Gly Glu 55Pro Leu Ser Val Leu Thr Gln Asp Ser Met Thr Val Glu Asp Val 5525 Glu Thr LeuIle Lys Glu Thr Asp Tyr Asn Gly Phe Pro Val Val Val 534rg Asp Ser Glu Arg Leu Ile Gly Phe Ala Gln Arg Arg Glu Leu 545 556eu Ala Ile Lys Asn Ala Arg Gln Arg Gln Glu Gly Ile Val Ser 565 57sn Ser Ile Met Tyr Phe Thr GluGlu Pro Pro Glu Leu Pro Ala Asn 589ro His Pro Leu Lys Leu Arg Arg Ile Leu Asn Leu Ser Pro Phe 595 6Thr Val Thr Asp His Thr Pro Met Glu Thr Val Val Asp Ile Phe Arg 662eu Gly Leu Arg Gln Cys Leu Val Thr Arg Ser Gly ArgLeu Leu 625 634le Ile Thr Lys Lys Asp Val Leu Arg His Met Ala Gln Met Ala 645 65sn Gln Asp Pro Glu Ser Ile Met Phe Asn 66 2739 DNA Mus musculus gene (39) Clcn4-2 7 taaatgtgac ttaataaatg gtgcaaaatt aaattttatt gcttgaggacagacgggcat 6aaggg aaaagacatt taatgtaaag gcaacaacaa caacaacaaa actgtcccgg aggaagg catttaagtc atttcagcca agctgaacac ggagacaggg ggatgacgct cacttgc cccgccccgc ctgcctgcct gtcacccgcc tcgcgatgac gtcacacgac 24gcaga cagccgcgctgaagagagga ggatgatcta ggacgctgtc cgggtggacg 3cgccgc aagacgcggc cctgcaggag tgactagcac ggtcagggcg ggagccacga 36tctgg gaacctc atg gac ttc ctc gag gag ccc ttc cct gac gtg 4Asp Phe Leu Glu Glu Pro Phe Pro Asp Val ggg acc tac gaggac ttc cac acc ata gac tgg ctg agg gaa aag tcc 458 Gly Thr Tyr Glu Asp Phe His Thr Ile Asp Trp Leu Arg Glu Lys Ser 5 cgg gat acc gac aga cat agg aag atc acc agc aaa agt aag gag tct 5Asp Thr Asp Arg His Arg Lys Ile Thr Ser Lys Ser Lys GluSer 3 att tgg gag ttc atc aag agc ctg ctg gac gcg tgg tcg gga tgg gtg 554 Ile Trp Glu Phe Ile Lys Ser Leu Leu Asp Ala Trp Ser Gly Trp Val 45 5g atg cta ctc att ggg ctg ctg gca ggt acc tta gct gga gtc atc 6Met Leu Leu Ile Gly Leu LeuAla Gly Thr Leu Ala Gly Val Ile 6 75 gat ctc gct gtg gat tgg atg acg gac ctc aag gag ggg gtc tgt ctg 65eu Ala Val Asp Trp Met Thr Asp Leu Lys Glu Gly Val Cys Leu 8 tcc gca ttc tgg tac agc cat gaa cag tgc tgt tgg acc tcc aac gag 698Ser Ala Phe Trp Tyr Ser His Glu Gln Cys Cys Trp Thr Ser Asn Glu 95 acc act ttt gag gac agg gac aag tgt ccc ctg tgg cag aag tgg tca 746 Thr Thr Phe Glu Asp Arg Asp Lys Cys Pro Leu Trp Gln Lys Trp Ser ctt ctt ctg agc cag tca gag ggcgcc agc gct tac att ctg aat 794 Glu Leu Leu Leu Ser Gln Ser Glu Gly Ala Ser Ala Tyr Ile Leu Asn tta atg tac att cta tgg gcg ttg ctg ttt gca ttt ctg gct gtc 842 Tyr Leu Met Tyr Ile Leu Trp Ala Leu Leu Phe Ala Phe Leu Ala Val tcc ctg gta cgt gtg ttc gca ccg tat gcc tgt ggc tct ggc ata ccc 89eu Val Arg Val Phe Ala Pro Tyr Ala Cys Gly Ser Gly Ile Pro ata aag act att ttg agt ggc ttt atc atc agg ggc tac ttg ggg 938 Glu Ile Lys Thr Ile Leu Ser Gly PheIle Ile Arg Gly Tyr Leu Gly tgg act ctt cta atc aag act gtc acc ctc gtg ctc gtc gta tcc 986 Lys Trp Thr Leu Leu Ile Lys Thr Val Thr Leu Val Leu Val Val Ser 2ggc ctg agc ctt ggc aaa gag ggc cca ctg gtg cat gtg gca tgt r Gly Leu Ser Leu Gly Lys Glu Gly Pro Leu Val His Val Ala Cys 22tgt ggc aac ttc ttc agc agc ctt ttc tcc aag tat agc aag aat s Cys Gly Asn Phe Phe Ser Ser Leu Phe Ser Lys Tyr Ser Lys Asn 223aa ggc aag agg cgt gag gtgctt tca gct gca gct gct gct ggt gtc u Gly Lys Arg Arg Glu Val Leu Ser Ala Ala Ala Ala Ala Gly Val 245tg gcc ttt ggt gct ccg ata gga ggt gtg ctc ttc agt cta gag r Val Ala Phe Gly Ala Pro Ile Gly Gly Val Leu Phe Ser Leu Glu 25526ag gtc agt tac tac ttt ccc ttg aaa acc ttg tgg agg tca ttc ttt u Val Ser Tyr Tyr Phe Pro Leu Lys Thr Leu Trp Arg Ser Phe Phe 278cc ctg gtg gct gcc ttc aca ctg cgc tcc atc aac ccc ttt gga a Ala Leu Val Ala Ala Phe ThrLeu Arg Ser Ile Asn Pro Phe Gly 285 29at agc cgc ctg gtt ctc ttt tac gtg gag tat cat aca ccc tgg tac n Ser Arg Leu Val Leu Phe Tyr Val Glu Tyr His Thr Pro Trp Tyr 33atg gct gaa ctc ttc cct ttc atc ctg ctt gga gtc ttt ggg ggttta t Ala Glu Leu Phe Pro Phe Ile Leu Leu Gly Val Phe Gly Gly Leu 323ga acc ctc ttc aca cgc tgc aac att gct tgg tgc agg agg cgt p Gly Thr Leu Phe Thr Arg Cys Asn Ile Ala Trp Cys Arg Arg Arg 335 34ag acc acc agg ctg ggcagg tac cca gtg ttg gag gtt att gcg gtg s Thr Thr Arg Leu Gly Arg Tyr Pro Val Leu Glu Val Ile Ala Val 356cc gtc acc gcc atc gtg gcc tac ccc aat ccc tac act cgc cag r Ala Val Thr Ala Ile Val Ala Tyr Pro Asn Pro Tyr Thr Arg Gln365 37gc acc agt gag ctc atc tct gag ctc ttc aac gat tgt ggg gct ctc r Thr Ser Glu Leu Ile Ser Glu Leu Phe Asn Asp Cys Gly Ala Leu 389ag tct tct cag ctc tgt gac tac atc aac gac ccc aac atg act cgg u Ser Ser Gln Leu CysAsp Tyr Ile Asn Asp Pro Asn Met Thr Arg 44gtg gat gac att ccg gac cgg ccg gct ggg gtt gga gtt tac aca o Val Asp Asp Ile Pro Asp Arg Pro Ala Gly Val Gly Val Tyr Thr 4425 gcc atg tgg cag ctg gcc ttg gca ctg tac ttc aaa ata gtcatt act a Met Trp Gln Leu Ala Leu Ala Leu Tyr Phe Lys Ile Val Ile Thr 434tt acc ttt ggc atg aag att ccc tca ggt ctc ttc atc ccc agt e Phe Thr Phe Gly Met Lys Ile Pro Ser Gly Leu Phe Ile Pro Ser 445 45tg gct gtc gga gccatg gca ggc cgg atg gtg gga atc ggt gtg gag t Ala Val Gly Ala Met Ala Gly Arg Met Val Gly Ile Gly Val Glu 467ag ctg gcc tac cat cac cat gac tgg atc atc ttc agg aac tgg tgc n Leu Ala Tyr His His His Asp Trp Ile Ile Phe Arg AsnTrp Cys 489ct gga gcg gac tgt gtc aca cca ggg ctt tat gcg atg gtg gga g Pro Gly Ala Asp Cys Val Thr Pro Gly Leu Tyr Ala Met Val Gly 495 5gct gca gcc tgt cta ggt ggg gtg act agg atg aca gtg tct cta gtg a Ala Ala Cys LeuGly Gly Val Thr Arg Met Thr Val Ser Leu Val 552tt atg ttt gaa ctg act gga ggt ctg gag tat att gta ccc cta l Ile Met Phe Glu Leu Thr Gly Gly Leu Glu Tyr Ile Val Pro Leu 525 53tg gca gct gct gtc acc agc aag tgg gtg gct gat gccttt ggg aaa 2 Ala Ala Ala Val Thr Ser Lys Trp Val Ala Asp Ala Phe Gly Lys 545aa ggg att tat gaa gcc cac atc cat ctg aat ggg tac cca ttt ctt 2 Gly Ile Tyr Glu Ala His Ile His Leu Asn Gly Tyr Pro Phe Leu 567tg aaggat gag ttc acc cac cgt acg ctg gcc act gat gtg atg 2 Val Lys Asp Glu Phe Thr His Arg Thr Leu Ala Thr Asp Val Met 575 58gg ccc cgg agg gag gaa ccg cca tta tcg gta cta acc cag gac agc 2 Pro Arg Arg Glu Glu Pro Pro Leu Ser Val LeuThr Gln Asp Ser 59act gtg gag gac gtg gag act ctc atc aag gag aca gac tac aac 2234 Met Thr Val Glu Asp Val Glu Thr Leu Ile Lys Glu Thr Asp Tyr Asn 66ttt cct gtg ctc gtc tcc aga gac tcg gag cgt ctc atc ggg ttt 2282 Gly Phe ProVal Leu Val Ser Arg Asp Ser Glu Arg Leu Ile Gly Phe 623cc cag agg cgg gag cta atc ttg gct ata aaa aat gcc agg cag agg 233ln Arg Arg Glu Leu Ile Leu Ala Ile Lys Asn Ala Arg Gln Arg 645ag ggc att gtg agc aat tcc atc atgtac ttc aca gag gag cct 2378 Gln Glu Gly Ile Val Ser Asn Ser Ile Met Tyr Phe Thr Glu Glu Pro 655 66ct gag ctg cct gcc aac agc cca cat cca ctg aag ctg agg cgc att 2426 Pro Glu Leu Pro Ala Asn Ser Pro His Pro Leu Lys Leu Arg Arg Ile 678ac ctg agc cct ttc acg gtc aca gat cac acc ccc atg gag acg 2474 Phe Asn Leu Ser Pro Phe Thr Val Thr Asp His Thr Pro Met Glu Thr 685 69tg gtg gac att ttc cgg aaa ctg ggg ctc cga caa tgc ctg gtg aca 2522 Val Val Asp Ile Phe Arg Lys Leu Gly Leu ArgGln Cys Leu Val Thr 77cgg agt ggg aga ctt ctt ggg atc atc aca aaa aag gat gtt ctg aga 257er Gly Arg Leu Leu Gly Ile Ile Thr Lys Lys Asp Val Leu Arg 723tg gcc cag atg gca aac cag gac cct gaa tcc atc atg ttt aat 26Met Ala Gln Met Ala Asn Gln Asp Pro Glu Ser Ile Met Phe Asn 735 74ag cactaagatg ggcattattt tgagaagtca ataattatat catttttaaa 267aacca agtgatatat tatgatccta atgaaaaaac ttgcactgaa ggcaaaaaaa 273aaa 2739 8 747 PRT Mus musculus 8 Met AspPhe Leu Glu Glu Pro Phe Pro Asp Val Gly Thr Tyr Glu Asp His Thr Ile Asp Trp Leu Arg Glu Lys Ser Arg Asp Thr Asp Arg 2 His Arg Lys Ile Thr Ser Lys Ser Lys Glu Ser Ile Trp Glu Phe Ile 35 4s Ser Leu Leu Asp Ala Trp Ser Gly TrpVal Val Met Leu Leu Ile 5 Gly Leu Leu Ala Gly Thr Leu Ala Gly Val Ile Asp Leu Ala Val Asp 65 7 Trp Met Thr Asp Leu Lys Glu Gly Val Cys Leu Ser Ala Phe Trp Tyr 85 9r His Glu Gln Cys Cys Trp Thr Ser Asn Glu Thr Thr Phe Glu Asp Asp Lys Cys Pro Leu Trp Gln Lys Trp Ser Glu Leu Leu Leu Ser Ser Glu Gly Ala Ser Ala Tyr Ile Leu Asn Tyr Leu Met Tyr Ile Trp Ala Leu Leu Phe Ala Phe Leu Ala Val Ser Leu Val Arg Val Phe Ala Pro TyrAla Cys Gly Ser Gly Ile Pro Glu Ile Lys Thr Ile Ser Gly Phe Ile Ile Arg Gly Tyr Leu Gly Lys Trp Thr Leu Leu Lys Thr Val Thr Leu Val Leu Val Val Ser Ser Gly Leu Ser Leu 2Lys Glu Gly Pro Leu Val His Val AlaCys Cys Cys Gly Asn Phe 222er Ser Leu Phe Ser Lys Tyr Ser Lys Asn Glu Gly Lys Arg Arg 225 234al Leu Ser Ala Ala Ala Ala Ala Gly Val Ser Val Ala Phe Gly 245 25la Pro Ile Gly Gly Val Leu Phe Ser Leu Glu Glu Val Ser TyrTyr 267ro Leu Lys Thr Leu Trp Arg Ser Phe Phe Ala Ala Leu Val Ala 275 28la Phe Thr Leu Arg Ser Ile Asn Pro Phe Gly Asn Ser Arg Leu Val 29Phe Tyr Val Glu Tyr His Thr Pro Trp Tyr Met Ala Glu Leu Phe 33ProPhe Ile Leu Leu Gly Val Phe Gly Gly Leu Trp Gly Thr Leu Phe 325 33hr Arg Cys Asn Ile Ala Trp Cys Arg Arg Arg Lys Thr Thr Arg Leu 345rg Tyr Pro Val Leu Glu Val Ile Ala Val Thr Ala Val Thr Ala 355 36le Val Ala Tyr Pro Asn ProTyr Thr Arg Gln Ser Thr Ser Glu Leu 378er Glu Leu Phe Asn Asp Cys Gly Ala Leu Glu Ser Ser Gln Leu 385 39Asp Tyr Ile Asn Asp Pro Asn Met Thr Arg Pro Val Asp Asp Ile 44Asp Arg Pro Ala Gly Val Gly Val Tyr Thr AlaMet Trp Gln Leu 423eu Ala Leu Tyr Phe Lys Ile Val Ile Thr Ile Phe Thr Phe Gly 435 44et Lys Ile Pro Ser Gly Leu Phe Ile Pro Ser Met Ala Val Gly Ala 456la Gly Arg Met Val Gly Ile Gly Val Glu Gln Leu Ala Tyr His 465 478is Asp Trp Ile Ile Phe Arg Asn Trp Cys Arg Pro Gly Ala Asp 485 49ys Val Thr Pro Gly Leu Tyr Ala Met Val Gly Ala Ala Ala Cys Leu 55Gly Val Thr Arg Met Thr Val Ser Leu Val Val Ile Met Phe Glu 5525 Leu Thr Gly GlyLeu Glu Tyr Ile Val Pro Leu Met Ala Ala Ala Val 534er Lys Trp Val Ala Asp Ala Phe Gly Lys Glu Gly Ile Tyr Glu 545 556is Ile His Leu Asn Gly Tyr Pro Phe Leu Asp Val Lys Asp Glu 565 57he Thr His Arg Thr Leu Ala Thr AspVal Met Arg Pro Arg Arg Glu 589ro Pro Leu Ser Val Leu Thr Gln Asp Ser Met Thr Val Glu Asp 595 6Val Glu Thr Leu Ile Lys Glu Thr Asp Tyr Asn Gly Phe Pro Val Leu 662er Arg Asp Ser Glu Arg Leu Ile Gly Phe Ala Gln Arg ArgGlu 625 634le Leu Ala Ile Lys Asn Ala Arg Gln Arg Gln Glu Gly Ile Val 645 65er Asn Ser Ile Met Tyr Phe Thr Glu Glu Pro Pro Glu Leu Pro Ala 667er Pro His Pro Leu Lys Leu Arg Arg Ile Phe Asn Leu Ser Pro 675 68heThr Val Thr Asp His Thr Pro Met Glu Thr Val Val Asp Ile Phe 69Lys Leu Gly Leu Arg Gln Cys Leu Val Thr Arg Ser Gly Arg Leu 77Leu Gly Ile Ile Thr Lys Lys Asp Val Leu Arg His Met Ala Gln Met 725 73la Asn Gln Asp Pro GluSer Ile Met Phe Asn 74 554omo sapiens CDS (27)..(2636) ClC-6 9 gtccagagtg gcagtaaagg aggaag atg gcg ggg tgc agg ggg tct ctg tgc 53 Met Ala Gly Cys Arg Gly Ser Leu Cys tgc tgc agg tgg tgc tgc tgc tgc ggt gag cgt gag acc cgc acc Cys Cys Arg Trp Cys Cys Cys Cys Gly Glu Arg Glu Thr Arg Thr c gag gag ctg acc atc ctt gga gaa aca cag gag gag gag gat gag Glu Glu Leu Thr Ile Leu Gly Glu Thr Gln Glu Glu Glu Asp Glu 3 att ctt cca agg aaa gac tat gag agtttg gat tat gat cgc tgt atc Leu Pro Arg Lys Asp Tyr Glu Ser Leu Asp Tyr Asp Arg Cys Ile 45 5t gac cct tac ctg gaa gtt ttg gag acc atg gat aat aag aaa ggt 245 Asn Asp Pro Tyr Leu Glu Val Leu Glu Thr Met Asp Asn Lys Lys Gly 6 cga agatat gag gcg gtg aag tgg atg gtg gtg ttt gcc att gga gtc 293 Arg Arg Tyr Glu Ala Val Lys Trp Met Val Val Phe Ala Ile Gly Val 75 8c act ggc ctg gtg ggt ctc ttt gtg gac ttt ttt gtg cga ctc ttc 34hr Gly Leu Val Gly Leu Phe Val Asp Phe Phe ValArg Leu Phe 9cc caa ctc aag ttc gga gtg gta cag aca tcg gtg gag gag tgc agc 389 Thr Gln Leu Lys Phe Gly Val Val Gln Thr Ser Val Glu Glu Cys Ser aaa ggc tgc ctc gct ctg tct ctc ctt gaa ctc ctg ggt ttt aac 437 Gln Lys Gly CysLeu Ala Leu Ser Leu Leu Glu Leu Leu Gly Phe Asn acc ttt gtc ttc ctg gca agc ctc ctt gtt ctc att gag ccg gtg 485 Leu Thr Phe Val Phe Leu Ala Ser Leu Leu Val Leu Ile Glu Pro Val gca ggt tcc ggg ata ccc gag gtc aaa tgc tatctg aat ggc gta 533 Ala Ala Gly Ser Gly Ile Pro Glu Val Lys Cys Tyr Leu Asn Gly Val gtg cca gga atc gtc cgt ctc cgg acc ctg ctc tgc aag gtc ctt 58al Pro Gly Ile Val Arg Leu Arg Thr Leu Leu Cys Lys Val Leu gga gtgctg ttc agt gtg gct gga ggg ctc ttc gtg ggg aag gaa ggc 629 Gly Val Leu Phe Ser Val Ala Gly Gly Leu Phe Val Gly Lys Glu Gly 2atg atc cac agt ggt tcg gtg gtg gga gct ggc ctc cct cag ttt 677 Pro Met Ile His Ser Gly Ser Val Val Gly Ala GlyLeu Pro Gln Phe 22agc atc tcc tta cgg aag atc cag ttt aac ttc ccc tat ttc cga 725 Gln Ser Ile Ser Leu Arg Lys Ile Gln Phe Asn Phe Pro Tyr Phe Arg 223ac aga gac aag aga gac ttt gta tca gca gga gcg gct gct gga 773 Ser Asp ArgAsp Lys Arg Asp Phe Val Ser Ala Gly Ala Ala Ala Gly 235 24tt gct gca gct ttc ggg gcg cca atc ggg ggt acc ttg ttc agt cta 82la Ala Ala Phe Gly Ala Pro Ile Gly Gly Thr Leu Phe Ser Leu 256ag gag ggt tcg tcc ttc tgg aac caa gggctc acg tgg aaa gtg ctc 869 Glu Glu Gly Ser Ser Phe Trp Asn Gln Gly Leu Thr Trp Lys Val Leu 278gt tcc atg tct gcc acc ttc acc ctc aac ttc ttc cgt tct ggg 9Cys Ser Met Ser Ala Thr Phe Thr Leu Asn Phe Phe Arg Ser Gly 285 29ttcag ttt gga agc tgg ggt tcc ttc cag ctc cct gga ttg ctg aac 965 Ile Gln Phe Gly Ser Trp Gly Ser Phe Gln Leu Pro Gly Leu Leu Asn 33ggc gag ttt aag tgc tct gac tct gat aaa aaa tgt cat ctc tgg e Gly Glu Phe Lys Cys Ser Asp Ser Asp LysLys Cys His Leu Trp 3325 aca gct atg gat ttg ggt ttc ttc gtc gtg atg ggg gtc att ggg ggc r Ala Met Asp Leu Gly Phe Phe Val Val Met Gly Val Ile Gly Gly 334tc ctg gga gcc aca ttc aac tgt ctg aac aag agg ctt gca aag tac uLeu Gly Ala Thr Phe Asn Cys Leu Asn Lys Arg Leu Ala Lys Tyr 356tg cga aac gtg cac ccg aaa cct aag ctc gtc aga gtc tta gag g Met Arg Asn Val His Pro Lys Pro Lys Leu Val Arg Val Leu Glu 365 37gc ctc ctt gtg tct ctg gta acc accgtg gtg gtg ttt gtg gcc tcg r Leu Leu Val Ser Leu Val Thr Thr Val Val Val Phe Val Ala Ser 389tg tta gga gaa tgc cga cag atg tcc tct tcg agt caa atc ggt t Val Leu Gly Glu Cys Arg Gln Met Ser Ser Ser Ser Gln Ile Gly 395 4aat gac tca ttc cag ctc cag gtc aca gaa gat gtg aat tca agt atc n Asp Ser Phe Gln Leu Gln Val Thr Glu Asp Val Asn Ser Ser Ile 442ag aca ttt ttt tgt ccc aat gat acc tac aat gac atg gcc aca ctc s Thr Phe Phe Cys Pro Asn Asp ThrTyr Asn Asp Met Ala Thr Leu 434tc aac ccg cag gag tct gcc atc ctc cag ctc ttc cac cag gat e Phe Asn Pro Gln Glu Ser Ala Ile Leu Gln Leu Phe His Gln Asp 445 45gt act ttc agc ccc gtc act ctg gcc ttg ttc ttc gtt ctc tat ttc y Thr Phe Ser Pro Val Thr Leu Ala Leu Phe Phe Val Leu Tyr Phe 467tt gca tgt tgg act tac ggc att tct gtt cca agt ggc ctt ttt u Leu Ala Cys Trp Thr Tyr Gly Ile Ser Val Pro Ser Gly Leu Phe 475 48tg cct tct ctg ctg tgt gga gctgct ttt gga cgt tta gtt gcc aat l Pro Ser Leu Leu Cys Gly Ala Ala Phe Gly Arg Leu Val Ala Asn 49gtc cta aaa agc tac att gga ttg ggc cac atc tat tcg ggg acc ttt l Leu Lys Ser Tyr Ile Gly Leu Gly His Ile Tyr Ser Gly Thr Phe 552tg att ggt gca gcg gct ttc ttg ggc ggg gtg gtc cgc atg acc a Leu Ile Gly Ala Ala Ala Phe Leu Gly Gly Val Val Arg Met Thr 525 53tc agc ctc acg gtc atc ctg atc gag tcc acc aat gag atc acc tac e Ser Leu Thr Val Ile Leu IleGlu Ser Thr Asn Glu Ile Thr Tyr 545tc ccc atc atg gtc aca ctg atg gtg gcc aaa tgg aca ggg gac y Leu Pro Ile Met Val Thr Leu Met Val Ala Lys Trp Thr Gly Asp 555 56tt ttc aat aag ggc att tat gat atc cac gtg ggc ctg cga ggc gtge Phe Asn Lys Gly Ile Tyr Asp Ile His Val Gly Leu Arg Gly Val 578cg ctt ctg gaa tgg gag aca gag gtg gaa atg gac aag ctg aga gcc o Leu Leu Glu Trp Glu Thr Glu Val Glu Met Asp Lys Leu Arg Ala 59gac atc atg gag cccaac ctg acc tac gtc tac ccg cac acc cgc r Asp Ile Met Glu Pro Asn Leu Thr Tyr Val Tyr Pro His Thr Arg 66cag tct ctg gtg agc atc ctg cgc acc acg gtc cac cat gcc ttc e Gln Ser Leu Val Ser Ile Leu Arg Thr Thr Val His His Ala Phe623tg gtc aca gag aac cgc ggt aac gag aag gag ttc atg aag ggc o Val Val Thr Glu Asn Arg Gly Asn Glu Lys Glu Phe Met Lys Gly 635 64ac cag ctc atc agc aac aac atc aag ttc aag aaa tcc agc atc ctc 2 Gln Leu Ile Ser Asn AsnIle Lys Phe Lys Lys Ser Ser Ile Leu 656cc cgg gct ggc gag cag cgc aaa cgg agc cag tcc atg aag tcc tac 2 Arg Ala Gly Glu Gln Arg Lys Arg Ser Gln Ser Met Lys Ser Tyr 678cc agc gag cta cgg aac atg tgt gat gag cac atc gcctct gag 2 Ser Ser Glu Leu Arg Asn Met Cys Asp Glu His Ile Ala Ser Glu 685 69ag cca gcc gag aag gag gac ctc ctg cag cag atg ctg gaa agg aga 2 Pro Ala Glu Lys Glu Asp Leu Leu Gln Gln Met Leu Glu Arg Arg 77act ccc tac cccaac cta tac cct gac cag tcc cca agt gaa gac 22Thr Pro Tyr Pro Asn Leu Tyr Pro Asp Gln Ser Pro Ser Glu Asp 7725 tgg acc atg gag gag cgg ttc cgc cct ctg acc ttc cac ggc ctg atc 226hr Met Glu Glu Arg Phe Arg Pro Leu Thr Phe His Gly LeuIle 734tt cgg tcg cag ctt gtc acc ctg ctt gtc cga gga gtt tgt tac tct 23Arg Ser Gln Leu Val Thr Leu Leu Val Arg Gly Val Cys Tyr Ser 756gc cag tcg agc gcc agc cag ccg cgc ctc tcc tat gcc gag atg 2357 Glu Ser Gln Ser SerAla Ser Gln Pro Arg Leu Ser Tyr Ala Glu Met 765 77cc gag gac tac ccg cgg tac ccc gac atc cac gac ctg gac ctg acg 24Glu Asp Tyr Pro Arg Tyr Pro Asp Ile His Asp Leu Asp Leu Thr 789tc aac ccg cgc atg atc gtg gat gtc acc cca tacatg aac cct 2453 Leu Leu Asn Pro Arg Met Ile Val Asp Val Thr Pro Tyr Met Asn Pro 795 8tcg cct ttc acc gtc tcg ccc aac acc cac gtc tcc caa gtc ttc aac 25Pro Phe Thr Val Ser Pro Asn Thr His Val Ser Gln Val Phe Asn 882tg ttc agaacg atg ggc ctg cgc cac ctg ccc gtg gtg aac gct gtg 2549 Leu Phe Arg Thr Met Gly Leu Arg His Leu Pro Val Val Asn Ala Val 834ag atc gtg ggg atc atc aca cgg cac aac ctc acc tat gaa ttt 2597 Gly Glu Ile Val Gly Ile Ile Thr Arg His Asn Leu Thr Tyr Glu Phe 845 85tg cag gcc cgg ctg agg cag cac tac cag acc atc tga cagcccagcc 2646 Leu Gln Ala Arg Leu Arg Gln His Tyr Gln Thr Ile 86accctctcc tggtgctgcc tggggaggca aatcatgctc actccggcgg gcacagctgg 27ggctgt tccggggcat ggaagattcc cagttaccca ctcactcaga aagccgggag 2766 tcatcggaca ccttgctggt cagaggccct gggggtggtt ttgaaccatc agagcttgga 2826 cttttctgac ttccccagca aggatcttcc cacttcctgc tccctgtgtt cccaccctcc 2886 agtgttggca caggcccacc cctggctccaccagagccag aagcagaggt agaatcaggc 2946 gggccccggg ctgcactccg agcagtgttc ctggccatct ttgctacttt cctagagaac 3gctgttg ccttaaatgt gtgagaggga cttggccaag gcaaaagctg gggagatgcc 3gacaaca tacagttcat gactaggttt aggaattggg cactgagaaa attctcaata 3cagagag tccttccctt atttgggact cctaacacgg tatcctcgct agtttgtttt 3ggaaaca ctctgctcct gggtgtgagc agaggctctg gtcttgccct gtggtttgac 3246 tctccttaga accaccgccc accagaaaca taaaggatta aaatcacact aataacccct 33ggtcaa tctgataata ggatcagatttacgtctacc ctaattctta acattgcagc 3366 tttctctcca tctgcagatt attcccagtc tcccagtaac acgtttctac ccagatcctt 3426 tttcatttcc ttaagttttg atctccgtct tcctgatgaa gcaggcagag ctcagaggat 3486 cttggcatca cccaccaaag ttagctgaaa gcagggcact cctggataaa gcagcttcac 3546tcaactctgg ggaatgctac catttttttt ccaaagtaga aaggaagcac ttctgagcca 36ccactg aaaggtatgt gctatgataa agcagatggc ctatttgagg aagagggtgt 3666 ctgcccttca caaacacctc tctctcccct gcactagctg tcccaagctt acatacagag 3726 gcccttcagg agggcctcct gtgccgcagggagggtgcgt ggggaagatg cttcctgcca 3786 gcacgtgcct gaaggtttca catgaagcat gggaagcgca ccctgtcgtt cagtgacgtc 3846 attcttctcc aggctggccc gccccctctg actaggcacc caaagtgagc atctgggcat 39cattca tgcttatctt cccccacctt ctacatggta tcagtcccag caggcatccc 3966tggggcagac gtgctttggc tcaagatggc cttcatttac gtttagtttt ttttaaaacc 4gaggttg cccacgggcc tcggcacctg gccctggcag cacagctctc aggcccagcc 4ggcgacc tccttggcca agtctgcctt tcaccctggg gtgagcatca gtcctggctc 4tggtcca gatcttgcgc tcagcacactctagggaata attccactcc agagatgggg 42ttcaag gtcttttcta gctgattgtg gcccctccat tttccccatt ttcttatctc 4266 cctgaccaaa attgctttga cttctaaatg tttctgcttc ccagaatgca cctgacttat 4326 gaaatgggga taatactccc aggaaatagc gcaggacatc acaaggacca aaaaggcaat 4386tcttatttaa atgttactat ttggccagct gctgctgtgt tttatggcag tgttcagagc 4446 ttgatcacgt tatttcttcc ttttattaag aaggaagcca attgtccaag tcaggagaat 45tgatca cctgtcacag acactttgtc ccctctcccc gccccttcct ggagctggca 4566 gagctaacgc cctgcaggag gaccccggcctctcgagggc tggatcagca gccgcctgcc 4626 ctgaggctgc cccggtgaat gttattggaa ttcatccctc gtgcacatcc tgttgtgttt 4686 aagtcaccag atattttgtt cccatcagtt tagcccagag atagacagta gaatgcaaat 4746 acctccctcc cctaaactga ctggacggct gccaaggagg ccccaaaccc aggccccatg 48ggcacg tggtttcctt ttctcctctc tctgcatctg cgctttccag ataagcccaa 4866 agacagcaac ttctccactc atgacaaatc aactgtgacc ctcgctcctt ccatttctgt 4926 ccattagaaa ccagcctttt cagcatctca cccattagca gccccatcac ccagtgatca 4986 gtcgcctcag taaagcagat ctgtggatggggagcctacg ggtggtaaga agtggtgttt 5gtttcat ctccagcttg gtgttccatg gcccctaggc gaggtgatca gggagtgggg 5atgggcc cccggccctg gctttgggac cttgtgctga gggatgattt gctcctgacc 5attaact taacagttcc cagctggaag ggacactttc aggacccagt ccactgtatg 5226gcatttgtga tgcagaatta tgcactgaca tgaccctggg tgacaggaaa gcctttcgag 5286 aggcccaagg tggcctcgcc agccctgcag tattgatgtg cagtattgca ccacagctct 5346 gcggaccttg gccattgccg cagtcgcagc ttcctttttt ctgtttgcac tgtttgtttg 54atgtta gctaattcca ctgtgtatataaattgtatt ttttttaatt tgtaaaatgc 5466 tatttttatt tgaacctttg gaacttggga gttctcattg taaccctaac atgtgagaat 5526 aaaatgtctt ctgtc 5549 PRT Homo sapiens Ala Gly Cys Arg Gly Ser Leu Cys Cys Cys Cys Arg Trp Cys Cys Cys Gly Glu ArgGlu Thr Arg Thr Pro Glu Glu Leu Thr Ile Leu 2 Gly Glu Thr Gln Glu Glu Glu Asp Glu Ile Leu Pro Arg Lys Asp Tyr 35 4u Ser Leu Asp Tyr Asp Arg Cys Ile Asn Asp Pro Tyr Leu Glu Val 5 Leu Glu Thr Met Asp Asn Lys Lys Gly Arg Arg Tyr Glu AlaVal Lys 65 7 Trp Met Val Val Phe Ala Ile Gly Val Cys Thr Gly Leu Val Gly Leu 85 9e Val Asp Phe Phe Val Arg Leu Phe Thr Gln Leu Lys Phe Gly Val Gln Thr Ser Val Glu Glu Cys Ser Gln Lys Gly Cys Leu Ala Leu LeuLeu Glu Leu Leu Gly Phe Asn Leu Thr Phe Val Phe Leu Ala Leu Leu Val Leu Ile Glu Pro Val Ala Ala Gly Ser Gly Ile Pro Glu Val Lys Cys Tyr Leu Asn Gly Val Lys Val Pro Gly Ile Val Arg Arg Thr Leu Leu Cys LysVal Leu Gly Val Leu Phe Ser Val Ala Gly Leu Phe Val Gly Lys Glu Gly Pro Met Ile His Ser Gly Ser 2Val Gly Ala Gly Leu Pro Gln Phe Gln Ser Ile Ser Leu Arg Lys 222ln Phe Asn Phe Pro Tyr Phe Arg Ser Asp Arg AspLys Arg Asp 225 234al Ser Ala Gly Ala Ala Ala Gly Val Ala Ala Ala Phe Gly Ala 245 25ro Ile Gly Gly Thr Leu Phe Ser Leu Glu Glu Gly Ser Ser Phe Trp 267ln Gly Leu Thr Trp Lys Val Leu Phe Cys Ser Met Ser Ala Thr 275 28he Thr Leu Asn Phe Phe Arg Ser Gly Ile Gln Phe Gly Ser Trp Gly 29Phe Gln Leu Pro Gly Leu Leu Asn Phe Gly Glu Phe Lys Cys Ser 33Asp Ser Asp Lys Lys Cys His Leu Trp Thr Ala Met Asp Leu Gly Phe 325 33he Val Val MetGly Val Ile Gly Gly Leu Leu Gly Ala Thr Phe Asn 345eu Asn Lys Arg Leu Ala Lys Tyr Arg Met Arg Asn Val His Pro 355 36ys Pro Lys Leu Val Arg Val Leu Glu Ser Leu Leu Val Ser Leu Val 378hr Val Val Val Phe Val Ala Ser MetVal Leu Gly Glu Cys Arg 385 39Met Ser Ser Ser Ser Gln Ile Gly Asn Asp Ser Phe Gln Leu Gln 44Thr Glu Asp Val Asn Ser Ser Ile Lys Thr Phe Phe Cys Pro Asn 423hr Tyr Asn Asp Met Ala Thr Leu Phe Phe Asn Pro Gln GluSer 435 44la Ile Leu Gln Leu Phe His Gln Asp Gly Thr Phe Ser Pro Val Thr 456la Leu Phe Phe Val Leu Tyr Phe Leu Leu Ala Cys Trp Thr Tyr 465 478le Ser Val Pro Ser Gly Leu Phe Val Pro Ser Leu Leu Cys Gly 485 49laAla Phe Gly Arg Leu Val Ala Asn Val Leu Lys Ser Tyr Ile Gly 55Gly His Ile Tyr Ser Gly Thr Phe Ala Leu Ile Gly Ala Ala Ala 5525 Phe Leu Gly Gly Val Val Arg Met Thr Ile Ser Leu Thr Val Ile Leu 534lu Ser Thr Asn Glu IleThr Tyr Gly Leu Pro Ile Met Val Thr 545 556et Val Ala Lys Trp Thr Gly Asp Phe Phe Asn Lys Gly Ile Tyr 565 57sp Ile His Val Gly Leu Arg Gly Val Pro Leu Leu Glu Trp Glu Thr 589al Glu Met Asp Lys Leu Arg Ala Ser Asp IleMet Glu Pro Asn 595 6Leu Thr Tyr Val Tyr Pro His Thr Arg Ile Gln Ser Leu Val Ser Ile 662rg Thr Thr Val His His Ala Phe Pro Val Val Thr Glu Asn Arg 625 634sn Glu Lys Glu Phe Met Lys Gly Asn Gln Leu Ile Ser Asn Asn 64565le Lys Phe Lys Lys Ser Ser Ile Leu Thr Arg Ala Gly Glu Gln Arg 667rg Ser Gln Ser Met Lys Ser Tyr Pro Ser Ser Glu Leu Arg Asn 675 68et Cys Asp Glu His Ile Ala Ser Glu Glu Pro Ala Glu Lys Glu Asp 69Leu Gln GlnMet Leu Glu Arg Arg Tyr Thr Pro Tyr Pro Asn Leu 77Tyr Pro Asp Gln Ser Pro Ser Glu Asp Trp Thr Met Glu Glu Arg Phe 725 73rg Pro Leu Thr Phe His Gly Leu Ile Leu Arg Ser Gln Leu Val Thr 745eu Val Arg Gly Val Cys Tyr SerGlu Ser Gln Ser Ser Ala Ser 755 76ln Pro Arg Leu Ser Tyr Ala Glu Met Ala Glu Asp Tyr Pro Arg Tyr 778sp Ile His Asp Leu Asp Leu Thr Leu Leu Asn Pro Arg Met Ile 785 79Asp Val Thr Pro Tyr Met Asn Pro Ser Pro Phe Thr ValSer Pro 88Thr His Val Ser Gln Val Phe Asn Leu Phe Arg Thr Met Gly Leu 823is Leu Pro Val Val Asn Ala Val Gly Glu Ile Val Gly Ile Ile 835 84hr Arg His Asn Leu Thr Tyr Glu Phe Leu Gln Ala Arg Leu Arg Gln 856yr Gln Thr Ile 865 DNA Rattus norvegicus CDS (69)..(2487 cgcggg tcacgggaac gctgccgggc tgccggctgt tcttgtggag tttggtcctc 6gcc atg gcc aac gtt tct aag aaa gtg tct tgg tcc ggc cga gat Ala Asn Val Ser Lys Lys Val Ser TrpSer Gly Arg Asp cgc gat gac gag gag ggg gcg ccg ctg ctt cga agg acg ggg caa cct Asp Asp Glu Glu Gly Ala Pro Leu Leu Arg Arg Thr Gly Gln Pro 5 3ag gag acg ccg ctg ctg aac gga gcc ggg ccg ggc gcg cgc cag 2Glu Glu Thr ProLeu Leu Asn Gly Ala Gly Pro Gly Ala Arg Gln 35 4t cat tct gca ctt ttc cga att gga cag atg aac aac gtg gag ctg 254 Ser His Ser Ala Leu Phe Arg Ile Gly Gln Met Asn Asn Val Glu Leu 5 gat gat gaa ctc ctg gac ccg gaa gtg gac cct cct cac acc ttcccc 3Asp Glu Leu Leu Asp Pro Glu Val Asp Pro Pro His Thr Phe Pro 65 7g gag att cca cac aac gag aag ctc ctc tcc ctc aag tat gag agc 35lu Ile Pro His Asn Glu Lys Leu Leu Ser Leu Lys Tyr Glu Ser 8 ctg gac tat gac aat agt gag aatcag ctc ttc ctg gag gag gaa aga 398 Leu Asp Tyr Asp Asn Ser Glu Asn Gln Leu Phe Leu Glu Glu Glu Arg 95 atc aac cac acg gct ttc cgg aca gtg gag atc aag cgc tgg gtt 446 Arg Ile Asn His Thr Ala Phe Arg Thr Val Glu Ile Lys Arg Trp Val tgt gcc ctc att gga atc ctc aca ggc cta gta gcc tgc ttc att 494 Ile Cys Ala Leu Ile Gly Ile Leu Thr Gly Leu Val Ala Cys Phe Ile att gta gtg gag aac ctg gca ggc ctc aag tac cga gtc atc aag 542 Asp Ile Val Val Glu Asn Leu Ala GlyLeu Lys Tyr Arg Val Ile Lys aac atc gac aag ttc aca gag aag ggc ggc ctg tcc ttc tcc ctc 59sn Ile Asp Lys Phe Thr Glu Lys Gly Gly Leu Ser Phe Ser Leu ctg tgg gcc aca ctg aac tct gcc ttc gtg ctc gtg ggg tct gtg 638Leu Leu Trp Ala Thr Leu Asn Ser Ala Phe Val Leu Val Gly Ser Val att gtg gcc ttc ata gag cca gtt gct gct ggc agc gga atc cct cag 686 Ile Val Ala Phe Ile Glu Pro Val Ala Ala Gly Ser Gly Ile Pro Gln 2aag tgc ttc ctc aat ggggtg aag atc ccc cac gtg gtg cgg ctc 734 Ile Lys Cys Phe Leu Asn Gly Val Lys Ile Pro His Val Val Arg Leu 222cg ctg gtg atc aag gtg tct ggc gtg att ctg tct gtg gta ggg 782 Lys Thr Leu Val Ile Lys Val Ser Gly Val Ile Leu Ser Val Val Gly 22523ga ctg gct gtg gga aag gaa ggg cca atg atc cac tca gga tcc gtg 83eu Ala Val Gly Lys Glu Gly Pro Met Ile His Ser Gly Ser Val 245ct gca ggg att tca cag gga agg tcg acg tca ctc aag cga gat 878 Ile Ala Ala Gly Ile Ser Gln GlyArg Ser Thr Ser Leu Lys Arg Asp 255 267ag atc ttt gaa tat ttc cgc aga gat aca gag aag cgg gat ttt 926 Phe Lys Ile Phe Glu Tyr Phe Arg Arg Asp Thr Glu Lys Arg Asp Phe 275 28tc tca gct gga gct gca gct gga gtg tct gct gcg ttt gga gcacct 974 Val Ser Ala Gly Ala Ala Ala Gly Val Ser Ala Ala Phe Gly Ala Pro 29ggt ggg gtc ctg ttc agc ctg gaa gag ggc gcc tcc ttc tgg aat l Gly Gly Val Leu Phe Ser Leu Glu Glu Gly Ala Ser Phe Trp Asn 33ttc ctg aca tgg agaatt ttc ttt gct tcc atg att tcg acc ttt n Phe Leu Thr Trp Arg Ile Phe Phe Ala Ser Met Ile Ser Thr Phe 323tg aat ttt gtt ctg agc atc tac cat gga aac atg tgg gac ctg r Leu Asn Phe Val Leu Ser Ile Tyr His Gly Asn Met Trp Asp Leu335 345gc cct ggc ctc ata aat ttt gga aga ttc gac tca gag aaa atg r Ser Pro Gly Leu Ile Asn Phe Gly Arg Phe Asp Ser Glu Lys Met 355 36cc tac aca atc cat gag att cct gtc ttc atc gcc atg ggt gtg gtg a Tyr Thr Ile His GluIle Pro Val Phe Ile Ala Met Gly Val Val 378gc att ctt gga gcc gtg ttc aat gcc ttg aat tac tgg cta act y Gly Ile Leu Gly Ala Val Phe Asn Ala Leu Asn Tyr Trp Leu Thr 385 39tg ttt cga atc agg tac atc cac cgg ccc tgc ctc caa gtgatt gag t Phe Arg Ile Arg Tyr Ile His Arg Pro Cys Leu Gln Val Ile Glu 44atg ctg gtg gca gct gtc aca gcc aca gtt gca ttt gtc ttg att a Met Leu Val Ala Ala Val Thr Ala Thr Val Ala Phe Val Leu Ile 4425 43cg tct cgagat tgc cag ccc ctg cag ggg agc tcc atg tcc tac r Ser Ser Arg Asp Cys Gln Pro Leu Gln Gly Ser Ser Met Ser Tyr 435 44ca ctc cag ctc ttc tgt gca gat ggc gaa tac aac tca atg gcc gca o Leu Gln Leu Phe Cys Ala Asp Gly Glu Tyr Asn Ser MetAla Ala 456tc ttt aac acc cct gag aag agc gtc gtc agc ctg ttc cac gac a Phe Phe Asn Thr Pro Glu Lys Ser Val Val Ser Leu Phe His Asp 465 47ca cca ggc tcc tat aat ccc atg act ctc ggc ctg ttc acc ctg gtc o Pro Gly Ser TyrAsn Pro Met Thr Leu Gly Leu Phe Thr Leu Val 489tc ttc ctg gcc tgc tgg acc tat ggc ctc aca gta tct gct ggt r Phe Phe Leu Ala Cys Trp Thr Tyr Gly Leu Thr Val Ser Ala Gly 495 55ttc atc cca tcc ctg ctc att ggg gct gcc tggggc cga ctc ttt l Phe Ile Pro Ser Leu Leu Ile Gly Ala Ala Trp Gly Arg Leu Phe 5525 ggc atc tcc atg tcc tac ctc aca gga gca gcg atc tgg gca gat ccg y Ile Ser Met Ser Tyr Leu Thr Gly Ala Ala Ile Trp Ala Asp Pro 534aa tacgcc ctg atg gga gct gct gct cag ctt ggt ggg atc gtg y Lys Tyr Ala Leu Met Gly Ala Ala Ala Gln Leu Gly Gly Ile Val 545 55gg atg acc ctt agc ctg aca gtc atc atg atg gag gcc acc agc aac g Met Thr Leu Ser Leu Thr Val Ile Met Met Glu AlaThr Ser Asn 567cc tac ggt ttt ccc atc atg ttg gtg ctg atg act gcc aag att l Thr Tyr Gly Phe Pro Ile Met Leu Val Leu Met Thr Ala Lys Ile 575 589gt gat gtc ttc att gag ggc ctc tat gac atg cac atc cag ctg l Gly AspVal Phe Ile Glu Gly Leu Tyr Asp Met His Ile Gln Leu 595 6caa agt gtg ccc ttc cta cac tgg gaa gcc ccg gtc acc tca cat tcg n Ser Val Pro Phe Leu His Trp Glu Ala Pro Val Thr Ser His Ser 662ct gcc agg gaa gta atg agc acg cct gtgacc tgc ctg agg agg u Thr Ala Arg Glu Val Met Ser Thr Pro Val Thr Cys Leu Arg Arg 625 63ga gag aag gtt ggc atc atc gtg gat gtc cta agt gac aca gcg tct 2 Glu Lys Val Gly Ile Ile Val Asp Val Leu Ser Asp Thr Ala Ser 64BR> 645 65ac aat ggg ttc cct gtg gtg gag gat gta gga gac acc cag cca 2 His Asn Gly Phe Pro Val Val Glu Asp Val Gly Asp Thr Gln Pro 655 667ga ctc caa ggc cta atc ctg cgt tcc cag ctc atc gtg ctc ctg 2 Arg Leu Gln GlyLeu Ile Leu Arg Ser Gln Leu Ile Val Leu Leu 675 68ag cac aag gtg ttt gtg gag agg tcc aac atg ggt ttg gtg cag cgg 2 His Lys Val Phe Val Glu Arg Ser Asn Met Gly Leu Val Gln Arg 69ctg agg ctg aaa gac ttt cgc gat gcc tac cca cgcttc ccc cca 2222 Arg Leu Arg Leu Lys Asp Phe Arg Asp Ala Tyr Pro Arg Phe Pro Pro 77cag tcc atc cac gta tcc cag gat gag cgg gag tgc acc atg gac 227ln Ser Ile His Val Ser Gln Asp Glu Arg Glu Cys Thr Met Asp 723ct gag ttcatg aac cct tct ccc tac act gtg cca cag gag gca 23Ser Glu Phe Met Asn Pro Ser Pro Tyr Thr Val Pro Gln Glu Ala 735 745tt cct cga gtg ttc aag ctg ttc cgg gct ctg ggc ctg agg cac 2366 Ser Leu Pro Arg Val Phe Lys Leu Phe Arg Ala Leu GlyLeu Arg His 755 76tg gtc gta gta gac aac cac aat cag gtg gtc ggg ctg gtg acc agg 24Val Val Val Asp Asn His Asn Gln Val Val Gly Leu Val Thr Arg 778ac cta gca aga tac cgc cta gga aaa gga ggc cta gaa gag ctt 2462 Lys Asp Leu AlaArg Tyr Arg Leu Gly Lys Gly Gly Leu Glu Glu Leu 785 79ca ctg gcc cag acg tga gggctggccc ccacccttgg gcagcggcac 25Leu Ala Gln Thr 8gcccct ctgcacctcc tcccagggtc cctggtctca gccaaagcct tgccctgggc 257agcaa caggagcaaa tgccctccccgggcttggct ggtgtggggc ccagaccctt 263tgggc agttggttta catcatcagc atttccctat tccctgaacc tgcagtcctc 269tgtcc cactcctggg tcccttctcc caggatgtaa agtgtgtttt cacacccctt 2753 PRT Rattus norvegicus Ala Asn Val Ser Lys Lys Val Ser TrpSer Gly Arg Asp Arg Asp Glu Glu Gly Ala Pro Leu Leu Arg Arg Thr Gly Gln Pro Asp Glu 2 Glu Thr Pro Leu Leu Asn Gly Ala Gly Pro Gly Ala Arg Gln Ser His 35 4r Ala Leu Phe Arg Ile Gly Gln Met Asn Asn Val Glu Leu Asp Asp 5Glu Leu Leu Asp Pro Glu Val Asp Pro Pro His Thr Phe Pro Lys Glu 65 7 Ile Pro His Asn Glu Lys Leu Leu Ser Leu Lys Tyr Glu Ser Leu Asp 85 9r Asp Asn Ser Glu Asn Gln Leu Phe Leu Glu Glu Glu Arg Arg Ile His Thr Ala Phe Arg ThrVal Glu Ile Lys Arg Trp Val Ile Cys Leu Ile Gly Ile Leu Thr Gly Leu Val Ala Cys Phe Ile Asp Ile Val Glu Asn Leu Ala Gly Leu Lys Tyr Arg Val Ile Lys Asp Asn Ile Asp Lys Phe Thr Glu Lys Gly Gly Leu Ser PheSer Leu Leu Leu Ala Thr Leu Asn Ser Ala Phe Val Leu Val Gly Ser Val Ile Val Phe Ile Glu Pro Val Ala Ala Gly Ser Gly Ile Pro Gln Ile Lys 2Phe Leu Asn Gly Val Lys Ile Pro His Val Val Arg Leu Lys Thr 222al Ile Lys Val Ser Gly Val Ile Leu Ser Val Val Gly Gly Leu 225 234al Gly Lys Glu Gly Pro Met Ile His Ser Gly Ser Val Ile Ala 245 25la Gly Ile Ser Gln Gly Arg Ser Thr Ser Leu Lys Arg Asp Phe Lys 267he Glu TyrPhe Arg Arg Asp Thr Glu Lys Arg Asp Phe Val Ser 275 28la Gly Ala Ala Ala Gly Val Ser Ala Ala Phe Gly Ala Pro Val Gly 29Val Leu Phe Ser Leu Glu Glu Gly Ala Ser Phe Trp Asn Gln Phe 33Leu Thr Trp Arg Ile Phe Phe Ala SerMet Ile Ser Thr Phe Thr Leu 325 33sn Phe Val Leu Ser Ile Tyr His Gly Asn Met Trp Asp Leu Ser Ser 345ly Leu Ile Asn Phe Gly Arg Phe Asp Ser Glu Lys Met Ala Tyr 355 36hr Ile His Glu Ile Pro Val Phe Ile Ala Met Gly Val Val GlyGly 378eu Gly Ala Val Phe Asn Ala Leu Asn Tyr Trp Leu Thr Met Phe 385 39Ile Arg Tyr Ile His Arg Pro Cys Leu Gln Val Ile Glu Ala Met 44Val Ala Ala Val Thr Ala Thr Val Ala Phe Val Leu Ile Tyr Ser 423rg Asp Cys Gln Pro Leu Gln Gly Ser Ser Met Ser Tyr Pro Leu 435 44ln Leu Phe Cys Ala Asp Gly Glu Tyr Asn Ser Met Ala Ala Ala Phe 456sn Thr Pro Glu Lys Ser Val Val Ser Leu Phe His Asp Pro Pro 465 478er Tyr Asn Pro MetThr Leu Gly Leu Phe Thr Leu Val Tyr Phe 485 49he Leu Ala Cys Trp Thr Tyr Gly Leu Thr Val Ser Ala Gly Val Phe 55Pro Ser Leu Leu Ile Gly Ala Ala Trp Gly Arg Leu Phe Gly Ile 5525 Ser Met Ser Tyr Leu Thr Gly Ala Ala Ile Trp AlaAsp Pro Gly Lys 534la Leu Met Gly Ala Ala Ala Gln Leu Gly Gly Ile Val Arg Met 545 556eu Ser Leu Thr Val Ile Met Met Glu Ala Thr Ser Asn Val Thr 565 57yr Gly Phe Pro Ile Met Leu Val Leu Met Thr Ala Lys Ile Val Gly 589al Phe Ile Glu Gly Leu Tyr Asp Met His Ile Gln Leu Gln Ser 595 6Val Pro Phe Leu His Trp Glu Ala Pro Val Thr Ser His Ser Leu Thr 662rg Glu Val Met Ser Thr Pro Val Thr Cys Leu Arg Arg Arg Glu 625 634al GlyIle Ile Val Asp Val Leu Ser Asp Thr Ala Ser Asn His 645 65sn Gly Phe Pro Val Val Glu Asp Val Gly Asp Thr Gln Pro Ala Arg 667ln Gly Leu Ile Leu Arg Ser Gln Leu Ile Val Leu Leu Lys His 675 68ys Val Phe Val Glu Arg Ser Asn MetGly Leu Val Gln Arg Arg Leu 69Leu Lys Asp Phe Arg Asp Ala Tyr Pro Arg Phe Pro Pro Ile Gln 77Ser Ile His Val Ser Gln Asp Glu Arg Glu Cys Thr Met Asp Leu Ser 725 73lu Phe Met Asn Pro Ser Pro Tyr Thr Val Pro Gln Glu AlaSer Leu 745rg Val Phe Lys Leu Phe Arg Ala Leu Gly Leu Arg His Leu Val 755 76al Val Asp Asn His Asn Gln Val Val Gly Leu Val Thr Arg Lys Asp 778la Arg Tyr Arg Leu Gly Lys Gly Gly Leu Glu Glu Leu Ser Leu 785 79Gln Thr DNA Homo sapiens CDS (77 gag gag gcg gcg ccg ctg ctg cgg agg acg gcg cgg ccc ggc ggg 48 Asp Glu Glu Ala Ala Pro Leu Leu Arg Arg Thr Ala Arg Pro Gly Gly acg ccg ctg ctg aac ggg gct ggg ccc ggg gct gcgcgc cag tca 96 Gly Thr Pro Leu Leu Asn Gly Ala Gly Pro Gly Ala Ala Arg Gln Ser 2 cca cgt tct gcg ctt ttc cga gtc gga cat atg agc agc gtg gag ctg Arg Ser Ala Leu Phe Arg Val Gly His Met Ser Ser Val Glu Leu 35 4t gat gaa ctt ttg gacccg gat atg gac cct cca cat ccc ttc ccc Asp Glu Leu Leu Asp Pro Asp Met Asp Pro Pro His Pro Phe Pro 5 aag gag atc cca cac aac gag aag ctc ctg tcc ctc aag tat gag agc 24lu Ile Pro His Asn Glu Lys Leu Leu Ser Leu Lys Tyr Glu Ser 65 7 ttg gac tat gac aac agt gag aac cag ctg ttc ctg gag gag gag cgg 288 Leu Asp Tyr Asp Asn Ser Glu Asn Gln Leu Phe Leu Glu Glu Glu Arg 85 9g atc aat cac acg gcc ttc cgg acg gtg gag atc aag cgc tgg gtc 336 Arg Ile Asn His Thr Ala Phe Arg Thr ValGlu Ile Lys Arg Trp Val tgc gcc ctc att ggg atc ctc acg ggc ctc gtg gcc tgc ttc att 384 Ile Cys Ala Leu Ile Gly Ile Leu Thr Gly Leu Val Ala Cys Phe Ile atc gtg gtg gaa aac ctg gct ggc ctc aag tac agg gtc atc aag 432 AspIle Val Val Glu Asn Leu Ala Gly Leu Lys Tyr Arg Val Ile Lys aat atc gac aag ttc aca gag aag ggc gga ctg tcc ttc tcc ctg 48sn Ile Asp Lys Phe Thr Glu Lys Gly Gly Leu Ser Phe Ser Leu ttg ctg tgg gcc acg ctg aac gccgcc ttc gtg ctc gtg ggc tct gtg 528 Leu Leu Trp Ala Thr Leu Asn Ala Ala Phe Val Leu Val Gly Ser Val gtg gct ttc ata gag ccg gtg gct gct ggc agc gga atc ccc cag 576 Ile Val Ala Phe Ile Glu Pro Val Ala Ala Gly Ser Gly Ile Pro Gln aag tgc ttc ctc aac ggg gtg aag atc ccc cac gtg gtg cgg ctc 624 Ile Lys Cys Phe Leu Asn Gly Val Lys Ile Pro His Val Val Arg Leu 2acg ttg gtg atc aaa gtg tcc ggt gtg atc ctg tcc gtg gtc ggg 672 Lys Thr Leu Val Ile Lys Val Ser GlyVal Ile Leu Ser Val Val Gly 222tg gcc gtg gga aag gaa ggg ccg atg atc cac tca ggt tca gtg 72eu Ala Val Gly Lys Glu Gly Pro Met Ile His Ser Gly Ser Val 225 234cc gcc ggg atc tct cag gga agg tca agc tca ctg aaa cga gat768 Ile Ala Ala Gly Ile Ser Gln Gly Arg Ser Ser Ser Leu Lys Arg Asp 245 25tc aag atc ttc gag tac ctc cgc aga gac aca gag aag cgg gac ttc 8Lys Ile Phe Glu Tyr Leu Arg Arg Asp Thr Glu Lys Arg Asp Phe 267cc gca ggg gct gcg gccgga gtg tca gcg gcg ttt gga gcc ccc 864 Val Ser Ala Gly Ala Ala Ala Gly Val Ser Ala Ala Phe Gly Ala Pro 275 28tg ggt ggg gtc ctg ttc agc ttg gag gag ggt gcg tcc ttc tgg aac 9Gly Gly Val Leu Phe Ser Leu Glu Glu Gly Ala Ser Phe Trp Asn 29ttc ctg acc tgg agg atc ttc ttt gct tcc atg atc tcc acg ttc 96he Leu Thr Trp Arg Ile Phe Phe Ala Ser Met Ile Ser Thr Phe 33acc ctg aat ttt gtt ctg agc att tac cac ggg aac atg tgg gac ctg r Leu Asn Phe Val Leu SerIle Tyr His Gly Asn Met Trp Asp Leu 325 33cc agc cca ggc ctc atc aac ttc gga agg ttt gac tcg gag aaa atg r Ser Pro Gly Leu Ile Asn Phe Gly Arg Phe Asp Ser Glu Lys Met 345ac acg atc cac gag atc ccg gtc ttc atc gcc atg ggc gtggtg a Tyr Thr Ile His Glu Ile Pro Val Phe Ile Ala Met Gly Val Val 355 36gc ggt gtg ctt gga gca gtg ttc aat gcc ttg aac tac tgg ctg acc y Gly Val Leu Gly Ala Val Phe Asn Ala Leu Asn Tyr Trp Leu Thr 378tt cga atc agg tacatc cac cgg ccc tgc ctg cag gtg att gag t Phe Arg Ile Arg Tyr Ile His Arg Pro Cys Leu Gln Val Ile Glu 385 39gtg ctg gtg gcc gcc gtc acg gcc aca gtt gcc ttc gtg ctg atc a Val Leu Val Ala Ala Val Thr Ala Thr Val Ala Phe Val LeuIle 44tcg tcg cgg gat tgc cag ccc ctg cag ggg ggc tcc atg tcc tac r Ser Ser Arg Asp Cys Gln Pro Leu Gln Gly Gly Ser Met Ser Tyr 423tg cag ctc ttt tgt gca gat ggc gag tac aac tcc atg gct gcg o Leu Gln Leu Phe CysAla Asp Gly Glu Tyr Asn Ser Met Ala Ala 435 44cc ttc ttc aac acc ccg gag aag agc gtg gtg agc ctc ttc cac gac a Phe Phe Asn Thr Pro Glu Lys Ser Val Val Ser Leu Phe His Asp 456ca ggc tcc tac aac ccc ctg acc ctc ggc ctg ttc acgctg gtc o Pro Gly Ser Tyr Asn Pro Leu Thr Leu Gly Leu Phe Thr Leu Val 465 478tc ttc ctg gcc tgc tgg acc tac ggg ctc acg gtg tct gcc ggg r Phe Phe Leu Ala Cys Trp Thr Tyr Gly Leu Thr Val Ser Ala Gly 485 49tc ttc atc ccgtcc ctg ctc atc ggg gct gcc tgg ggc cgg ctc ttt l Phe Ile Pro Ser Leu Leu Ile Gly Ala Ala Trp Gly Arg Leu Phe 55atc tcc ctg tcc tac ctc acg ggg gcg gcg atc tgg gcg gac ccc y Ile Ser Leu Ser Tyr Leu Thr Gly Ala Ala Ile Trp AlaAsp Pro 5525 ggc aaa tac gcc ctg atg gga gct gct gcc cag ctg ggc ggg att gtg y Lys Tyr Ala Leu Met Gly Ala Ala Ala Gln Leu Gly Gly Ile Val 534tg aca ctg agc ctg acc gtc atc atg atg gag gcc acc agc aac g Met Thr Leu SerLeu Thr Val Ile Met Met Glu Ala Thr Ser Asn 545 556cc tac ggc ttc ccc atc atg ctg gtg ctc atg acc gcc aag atc l Thr Tyr Gly Phe Pro Ile Met Leu Val Leu Met Thr Ala Lys Ile 565 57tg ggc gac gtc ttc att gag ggc ctg tac gac atgcac att cag ctg l Gly Asp Val Phe Ile Glu Gly Leu Tyr Asp Met His Ile Gln Leu 589gt gtg ccc ttc ctg cac tgg gag gcc ccg gtc acc tca cac tca n Ser Val Pro Phe Leu His Trp Glu Ala Pro Val Thr Ser His Ser 595 6ctc act gccagg gag gtg atg agc aca cca gtg acc tgc ctg agg cgg u Thr Ala Arg Glu Val Met Ser Thr Pro Val Thr Cys Leu Arg Arg 662ag aag gtc ggc gtc att gtg gac gtg ctg agc gac acg gcg tcc g Glu Lys Val Gly Val Ile Val Asp Val Leu Ser AspThr Ala Ser 625 634ac aac ggc ttc ccc gtg gtg gag cat gcc gat gac acc cag cct n His Asn Gly Phe Pro Val Val Glu His Ala Asp Asp Thr Gln Pro 645 65cc cgg ctc cag ggc ctg atc ctg cgc tcc cag ctc atc gtt ctc cta 2 Arg LeuGln Gly Leu Ile Leu Arg Ser Gln Leu Ile Val Leu Leu 667ac aag gtg ttt gtg gag cgg tcc aac ctg ggc ctg gta cag cgg 2 His Lys Val Phe Val Glu Arg Ser Asn Leu Gly Leu Val Gln Arg 675 68gc ctg agg ctg aag gac ttc cga gac gcc tacccg cgc ttc cca ccc 2 Leu Arg Leu Lys Asp Phe Arg Asp Ala Tyr Pro Arg Phe Pro Pro 69cag tcc atc cac gtg tcc cag gac gag cgg gag tgc acc atg gac 2 Gln Ser Ile His Val Ser Gln Asp Glu Arg Glu Cys Thr Met Asp 77ctctcc gag ttc atg aac ccc tcc ccc tac acg gtg ccc cag gag gcg 22Ser Glu Phe Met Asn Pro Ser Pro Tyr Thr Val Pro Gln Glu Ala 725 73cg ctc cca cgg gtg ttc aag ctg ttc cgg gcc ctg ggc ctg cgg cac 2256 Ser Leu Pro Arg Val Phe Lys Leu Phe Arg AlaLeu Gly Leu Arg His 745tg gtg gtg gac aac cgc aat cag gtt gtc ggg ttg gtg acc agg 23Val Val Val Asp Asn Arg Asn Gln Val Val Gly Leu Val Thr Arg 755 76ag gac ctc gcc agg tac cgc ctg gga aag aga ggc ttg gag gag ctc 2352 Lys AspLeu Ala Arg Tyr Arg Leu Gly Lys Arg Gly Leu Glu Glu Leu 778tg gcc cag acg tga ggcccagccc tgcccataat ggg 2393 Ser Leu Ala Gln Thr 785 PRT Homo sapiens Glu Glu Ala Ala Pro Leu Leu Arg Arg Thr Ala Arg Pro Gly Gly Thr Pro Leu Leu Asn Gly Ala Gly Pro Gly Ala Ala Arg Gln Ser 2 Pro Arg Ser Ala Leu Phe Arg Val Gly His Met Ser Ser Val Glu Leu 35 4p Asp Glu Leu Leu Asp Pro Asp Met Asp Pro Pro His Pro Phe Pro 5 Lys Glu Ile Pro His Asn Glu Lys Leu Leu Ser Leu Lys Tyr Glu Ser 65 7 Leu Asp Tyr Asp Asn Ser Glu Asn Gln Leu Phe Leu Glu Glu Glu Arg 85 9g Ile Asn His Thr Ala Phe Arg Thr Val Glu Ile Lys Arg Trp Val Cys Ala Leu Ile Gly Ile Leu Thr Gly Leu ValAla Cys Phe Ile Ile Val Val Glu Asn Leu Ala Gly Leu Lys Tyr Arg Val Ile Lys Asn Ile Asp Lys Phe Thr Glu Lys Gly Gly Leu Ser Phe Ser Leu Leu Leu Trp Ala Thr Leu Asn Ala Ala Phe Val Leu Val Gly Ser Val Val Ala Phe Ile Glu Pro Val Ala Ala Gly Ser Gly Ile Pro Gln Lys Cys Phe Leu Asn Gly Val Lys Ile Pro His Val Val Arg Leu 2Thr Leu Val Ile Lys Val Ser Gly Val Ile Leu Ser Val Val Gly 222eu Ala ValGly Lys Glu Gly Pro Met Ile His Ser Gly Ser Val 225 234la Ala Gly Ile Ser Gln Gly Arg Ser Ser Ser Leu Lys Arg Asp 245 25he Lys Ile Phe Glu Tyr Leu Arg Arg Asp Thr Glu Lys Arg Asp Phe 267er Ala Gly Ala Ala Ala Gly ValSer Ala Ala Phe Gly Ala Pro 275 28al Gly Gly Val Leu Phe Ser Leu Glu Glu Gly Ala Ser Phe Trp Asn 29Phe Leu Thr Trp Arg Ile Phe Phe Ala Ser Met Ile Ser Thr Phe 33Thr Leu Asn Phe Val Leu Ser Ile Tyr His Gly Asn Met TrpAsp Leu 325 33er Ser Pro Gly Leu Ile Asn Phe Gly Arg Phe Asp Ser Glu Lys Met 345yr Thr Ile His Glu Ile Pro Val Phe Ile Ala Met Gly Val Val 355 36ly Gly Val Leu Gly Ala Val Phe Asn Ala Leu Asn Tyr Trp Leu Thr 378he Arg Ile Arg Tyr Ile His Arg Pro Cys Leu Gln Val Ile Glu 385 39Val Leu Val Ala Ala Val Thr Ala Thr Val Ala Phe Val Leu Ile 44Ser Ser Arg Asp Cys Gln Pro Leu Gln Gly Gly Ser Met Ser Tyr 423eu Gln Leu Phe CysAla Asp Gly Glu Tyr Asn Ser Met Ala Ala 435 44la Phe Phe Asn Thr Pro Glu Lys Ser Val Val Ser Leu Phe His Asp 456ro Gly Ser Tyr Asn Pro Leu Thr Leu Gly Leu Phe Thr Leu Val 465 478he Phe Leu Ala Cys Trp Thr Tyr Gly LeuThr Val Ser Ala Gly 485 49al Phe Ile Pro Ser Leu Leu Ile Gly Ala Ala Trp Gly Arg Leu Phe 55Ile Ser Leu Ser Tyr Leu Thr Gly Ala Ala Ile Trp Ala Asp Pro 5525 Gly Lys Tyr Ala Leu Met Gly Ala Ala Ala Gln Leu Gly Gly Ile Val 534et Thr Leu Ser Leu Thr Val Ile Met Met Glu Ala Thr Ser Asn 545 556hr Tyr Gly Phe Pro Ile Met Leu Val Leu Met Thr Ala Lys Ile 565 57al Gly Asp Val Phe Ile Glu Gly Leu Tyr Asp Met His Ile Gln Leu 589er ValPro Phe Leu His Trp Glu Ala Pro Val Thr Ser His Ser 595 6Leu Thr Ala Arg Glu Val Met Ser Thr Pro Val Thr Cys Leu Arg Arg 662lu Lys Val Gly Val Ile Val Asp Val Leu Ser Asp Thr Ala Ser 625 634is Asn Gly Phe Pro Val ValGlu His Ala Asp Asp Thr Gln Pro 645 65la Arg Leu Gln Gly Leu Ile Leu Arg Ser Gln Leu Ile Val Leu Leu 667is Lys Val Phe Val Glu Arg Ser Asn Leu Gly Leu Val Gln Arg 675 68rg Leu Arg Leu Lys Asp Phe Arg Asp Ala Tyr Pro Arg PhePro Pro 69Gln Ser Ile His Val Ser Gln Asp Glu Arg Glu Cys Thr Met Asp 77Leu Ser Glu Phe Met Asn Pro Ser Pro Tyr Thr Val Pro Gln Glu Ala 725 73er Leu Pro Arg Val Phe Lys Leu Phe Arg Ala Leu Gly Leu Arg His 745al Val Val Asp Asn Arg Asn Gln Val Val Gly Leu Val Thr Arg 755 76ys Asp Leu Ala Arg Tyr Arg Leu Gly Lys Arg Gly Leu Glu Glu Leu 778eu Ala Gln Thr 785 Other References
|