U.S. patents available from 1976 to present.
U.S. patent applications available from 2005 to present.

Assays for assembly of Ebola virus nucleocapsids

Patent 7449190 Issued on November 11, 2008. Estimated Expiration Date: Icon_subject January 7, 2025. Estimated Expiration Date is calculated based on simple USPTO term provisions. It does not account for terminal disclaimers, term adjustments, failure to pay maintenance fees, or other factors which might affect the term of a patent.
Abstract Claims Description Full Text

Patent References

Hybrid particle immunogens
Patent #: 4722840
Issued on: 02/02/1988
Inventor: Valenzuela ,   et al.

Hepatitis C virus infected cell systems
Patent #: 5679342
Issued on: 10/21/1997
Inventor: Houghton, et al.

Anti-herpesviral agents and assays therefor Patent #: 6200577
Issued on: 03/13/2001
Inventor: McLauchlan, et al.

Inventors

Assignee

Application

No. 11031921 filed on 01/07/2005

US Classes:

424/204.1Virus or component thereof

Examiners

Primary: Campell, Bruce R.
Assistant: White, Nico Kinsey

Attorney, Agent or Firm

Foreign Patent References

  • WO 95/32310 WO 11/01/1995
  • WO 00/09158 WO 02/01/2000

International Class

A61K 39/00

Description

FIELD OF THE INVENTION


The present invention relates to assays for the identification of compounds that inhibit assembly of NP, VP35, and VP24, or inhibit the glycosylation of NP, required for nucleocapsid formation, for use as anti-viral agents. The invention alsorelates to assays for the identification of compounds that block glycosylation of proteins having a glycosylation domain that is substantially homologous to a glycosylation domain of NP required for polymerization. The invention further relates topseudoparticles for presentation of antigens or antigenic epitopes for immunogenic or vaccination purposes.

BACKGROUND OF THE INVENTION

Ebola viruses are enveloped, nonsegmented, negative-strand RNA viruses, which, together with Marburg viruses, are the only two known species in the family Filoviridae (Sanchez, A. et al. 2001 in: Fields Virology, D. M. Knipe and P. M. Howley,eds. Philadelphia: Lippincott Williams & Wilkens, pp. 1279-1304). Ebola and Marburg viruses have been linked to a number of lethal outbreaks of hemorrhagic fever in humans and in non-human primates (Feldmann, H. and Klenk, H.-D. 1996 Adv Virus Res47:1-52). Filoviruses replicate rapidly in monocytes/macrophages, and fibroblasts during the early stage of the disease (Geisbert, T. W. et al. 1992 J Comp Path 106:137-152; Feldmann, H. et al. 1996 J Virol 70:2208-2214). They also infect endothelialcells, and the accumulation of Ebola glycoproteins, coupled with the massive loss of endothelial cells, plays an important role in its pathogenicity during the latter stages of the disease (Schnittler, H. J. et al. 1993 J Clin Invest 91:1301-1309; Yang,Z.-Y. et al. 1998 Science 282:843; Yang, Z.-Y. et al. 2000 Nat Med 6:886-889). There are four well-documented Ebola virus subtypes: Ebola-Zaire, Ebola-Sudan, Ebola-Reston (Geisbert, T. W. and Jahrling, P. B. 1995 Virus Res 39: 129-150) and Ebola-Coted'Ivoire (Leguenno, B. et al. 1995 Lancet 345:1271-1274). New outbreaks, such as those recently in Gulu, Uganda, and presently in Gabon are still emerging.

Ebola virions have a uniform diameter of 75-80 nm, with filamentous forms of approximately 970 nm in length showing peak infectivity (Geisbert, T. W. and Jahrling, P. B. 1995 Virus Res 39:129-150). An envelope putatively derived from the hostcell membrane binds a 45-60 nm diameter nucleocapsid, and surface spikes are occasionally seen protruding from the viral envelope (Geisbert, T. W. and Jahrling, P. B. 1995 Virus Res 39:129-150). The 19 kb single negative-strand RNA genome encodes sevenviral proteins: nucleoprotein (NP), virion protein (VP) 24, VP30, VP35, VP40, glycoprotein (GP), and RNA-dependent RNA polymerase (L) (Feldmann, H. et al. 1992 Virus Res 24:1-19; Sanchez, A. et al. 1993 Virus Res 29:215-240).

Despite the limited number of Ebola virus open reading frames, little is known about viral assembly and the control of Ebola virus replication. Some studies have suggested that replication occurs in the cytoplasm, and assembly and budding of newviral particles takes place at the plasma membrane (Feldmann, H. and Kiley, M. P. 1999 Curr Top Microbiol Immunol 235:1-21; Feldmann, H. et al. 1996 J Virol 70:2208-2214; Feldmann, H. and Klenk, H.-D. 1996 Adv Virus Res 47:1-52); however, the possibilityof lytic replication and release from intracellular lysosomes cannot be excluded. Studies of Ebola and Marburg viruses using an artificial replication system based on vaccinia virus T7 expression have shown that three proteins, NP, VP35, and L, are ableto support transcription of a monocistronic mini-replicon (Muhlberger, E. et al. 1998 J Virol 72:8756-8764; Muhlberger, E. et al. 1999 J Virol 73:2333-2342). More recently, an elegant reverse genetic system was utilized to generate infectious Ebolavirus with a combination of viral genomic fragments and expression vectors derived from four cDNAs (NP, VP35, VP30, and L). This system was used to analyze the role of GP in viral cytopathicity in vitro (Volchkov, V. E. et al. 2001 Science291:1965-1969).

SEGUE TO THE INVENTION

In the present report, analysis of Ebola virus assembly has been undertaken using cDNAs encoding six of the seven open reading frames. Co-transfection of these expression vectors gave rise to intracellular virus-like particles. The viral geneproducts and biochemical interactions required for this process have been defined. These results indicate a novel mechanism that regulates the assembly of filoviruses within cells.

SUMMARY OF THE INVENTION

The present invention relates to assays for the identification of compounds that inhibit assembly of NP, VP35, and VP24, or inhibit the glycosylation of NP, required for nucleocapsid formation, for use as anti-viral agents. The invention alsorelates to assays for the identification of compounds that block glycosylation of proteins having a glycosylation domain that is substantially homologous to a glycosylation domain of NP required for polymerization. The invention further relates topseudoparticles for presentation of antigens or antigenic epitopes for immunogenic or vaccination purposes.

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1 is Ebola gene organization and transmission electron microscopy (TEM) analysis of Ebola capsid assembly. A. Schematic representation of Ebola genome organization. The genes encoding viral proteins are drawn to scale. Dotted areas denotethe coding regions and bar areas denote the noncoding sequences. From 3' to 5': NP, VP35, VP40, GP, VP30, VP24 and L gene encoding for RNA polymerase (L). B. Electron micrographs of the assembly of Ebola capsids in transfected 293T cells(magnification×7000). Two μg of each of six plasmids coding for pVR1012-GP, NP, VP40, VP35, VP30, and VP24, respectively, were used to co-transfect 3×106 293T cells, using the calcium phosphate method (12 μg total DNA pertransfection). TEM analysis was performed using the method described in Table 1, legend. C. Longitudinal section (magnification×150,000) of 293 cells cotransfected with four plasmids (2 μg each) encoding NP, VP35, VP30, and VP24, respectively,and 4 μg of the vector backbone. A total of 12 μg DNA was used for each transfection, and cells were analyzed as described below. D. Transverse section (magnification×100,000) of cells described in 1C).

FIG. 2 shows release of assembled capsids from transfected 293T cells and TEM analysis of NP mutants for Ebola capsid assembly in transfected 293T cells. A. Electron micrograph of the lysis of 293T cells transfected with NP, VP35, and VP24(magnification×19,600). 3×106 293T cells were transfected with 3 μg of each of plasmids encoding for NP, VP35 and VP24. Three days after transfection, the cells were analyzed as described in Table 1, legend. B. Gradientsedimentation and Western blot analysis of assembled capsids. C. Schematic representation of NP mutants. A.A., amino acids. Plain areas denote that the amino acid sequences were deleted. D. Western blot analysis of the expression of NP deletionmutants. The cell lysates from 293T cells transfected with NP and different mutant NPs were extracted with RIPA (radioimmunoprecipitation assay) buffer, separated with 4-15% of SDS-PAGE, transferred onto an Immobilon™-P membrane and blotted withpolyclonal anti-NP antibody (Ab). E. TEM analysis of capsid assembly of NP mutants (magnification from left to right-×40,000; ×30,000; ×20,000). 293T cells were co-transfected with 3 μg of each NP mutant, 3 μg of VP35 and VP24. Three days after transfection, TEM analysis was performed as described in Table 1, legend.

FIG. 3 shows immunoprecipitation analysis of NP, VP35 and VP24 interaction. A. Co-immunoprecipitation of VP35 and VP24 with NP. Human transcription factor Gata3 was used as an internal control. B. Immunoprecipitation of in vitro translated NPby anti-NP Ab. NPs in vitro translated either by reticulocytes lysate or E. coli S30 extract systems were immunoprecipitated by a polyclonal anti-NP Ab and protein G agarose. C. Immunoprecipitation of glycosylated or deglycosylated NP by anti-VP35 Ab. Glycosylated or deglycosylated NP in vitro translated either by reticulocytes lysate or E. coli S30 extract systems were co-immunoprecipitated by a polyclonal anti-VP35 Ab.

FIG. 4 shows post-translational modification of Ebola NP and biochemical characterization of NP glycosylation. A. Sensitivity of NP to deglycosylation. B. Relative resistance of NP in cell extracts from transfected 293 cells to digestion withEndo H in cells treated with no inhibitor (lane 9), 2.5 mM dMM (lane 10) or 16 μg/ml tunicamycin (lane 11) for 40 hours, in contrast to its sensitivity to neuramimidase (lane 6 vs. 7). C. Resistance of NP synthesis in transfected 293 cells in vivoto tunicamycin (left), in contrast to HIV gp160 (right). D. Labeling of NP with 3H-glycosamine and 3H-galactose. The methods used are identified as described below. E. Lectin precipitation and NP Western blot analysis. The identity andspecificity of each lectin is indicated and described in the text below. Control, no lectin added, other conditions were same.

FIG. 5 shows that a synthetic glycoside inhibits the biochemical interaction associated with nucleocapsid formation in vitro. A. Effect of the indicated concentrations of specific glycoside analogues on the transcription/translation of NP,determined as in FIG. 5B. DMSO (2%) was used at the highest concentration as in the diluent for the synthetic glycoside as a negative control (lane 1). B. Inhibition of NP/VP35 interaction by Manα1-OC8 by immunoprecipitation with anti-VP35with in vitro transcribed/translated NP, VP35 and VP24, as described in FIG. 5C. DMSO was used as defined in panel A. Control refers to the use of normal mouse serum in the immunoprecipitation at the same concentration as anti-VP35 (5 μl) as anegative control. C. Quantitation of inhibition by Manα1-O-octyl. Image intensity from the indicated inhibitors in FIG. 8B (square, Manα1-OC8; triangle, Ac Manα1-OC8; diamond, AcGal1,4 GlcNAc-ONM; circle, DMSO) wasdetermined from phosphorimaging relative to the DMSO control (0% inhibition).

FIG. 6 shows amino acid similarity of filoviruses and paramyxovirus nucleoproteins. A1-A10. Sequence alignments of Ebola NP with related proteins from different strains and with other viruses (EBV-P, SEQ ID NO: 6; EBV-B, SEQ ID NO: 7; EBV-G,SEQ ID NO: 8; EBV-M, SEQ ID NO: 9; EBV-Z, SEQ ID NO: 10; MBV-V, SEQ ID NO: 11; MBV-P, SEQ ID NO: 12; MBV-O, SEQ ID NO: 13; consensus sequence, SEQ ID NO: 14; C-distemper, SEQ ID NO: 15; Measles, SEQ ID NO: 16; Rinderpest, SEQ ID NO: 17; Consensussequence, SEQ ID NO: 18). B. Highly conserved motif of nucleoproteins from different filoviruses and paramyxoviruses (fragments of SEQ ID Nos: 6, 7, 8, 9, 10, 11, 112, 13, 15, 16 and 17; and Sendai, SEQ ID NO: 19; Mumps, SEQ ID NO: 20; hRSV, SEQ ID NO:21; consensus sequence, SEQ ID NO: 22).

FIG. 7 A1-A6, B1-B6, C1-C6, D1-D5 compares Ebola NP with four clones of Human Tau (SEQ ID NO: 23, 24, 25, and 27; GenBank Accession Nos: P19332, P10636, P10637, and BC000558, respectively) and one Bovine Tau (SEQ ID NO: 26, GenBank Accession No:AAA51609). Ebola NP is from GenBank Accession No. AF272001 (SEQ ID NO: 28). SEQ ID NO: 29-consensus sequence.

FIG. 8 illustrates pseudoparticles for presentation of antigens or antigenic epitopes for immunogenic or vaccination purposes.

BRIEF DESCRIPTION OF THE SEQUENCES

TABLE-US-00001 Sequence GenBank Accession No. Ebola Zaire NP AF272001 Ebola Zaire VP35 AF272001 Ebola Zaire VP24 AF272001 Ebola Sudan NP AF173836 Ebola Sudan VP35 None in Genbank Ebola Sudan VP24 None in Genbank Ebola Reston NP AB050936 EbolaReston VP35 AB050936 Ebola Reston VP24 AB050936 Ebola Cote d'Ivoire NP None in Genbank Ebola Cote d'Ivoire VP35 None in Genbank Ebola Cote d'Ivoire VP24 None in Genbank Marburg NP NC_001608 Marburg VP35 NC_001608 Marburg VP24 NC_001608

DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENT

Ebola virus encodes seven viral structural and regulatory proteins that support its high rates of replication, but little is known about nucleocapsid assembly of this virus in infected cells. In this disclosure, we report that three viralproteins are necessary and sufficient for the formation of Ebola virus particles and that intracellular post-translational modification regulates this process. Expression of the nucleoprotein (NP) and the virion-associated proteins VP35 and VP24 in theabsence of other viral sequences led to the spontaneous assembly of nucleocapsids in transfected 293T cells by transmission electron microscopy (TEM). Full-length nuclear protein was required for formation of these complexes, and a specific biochemicalinteraction of these three proteins was demonstrated in vitro and in vivo. Interestingly, post-translational modification of nucleoprotein, including O-glycosylation and sialation, was required for their interaction, and a synthetic glycoside wasidentified that inhibited their biochemical interaction in vitro. Ebola virus therefore directs nucleocapsid assembly through three viral gene products and is dependent on intracellular post-translational modification. These results demonstrate a novelmechanism of regulation for virus assembly and indicate new approaches for the achievement of Ebola viral therapies and vaccines.

Assays for Compounds that Inhibit Assembly of NP, VP35, and VP24, or Inhibit Glycosylation of NP, Required for Nucleocapsid Formation

The present invention relates to the identification and use of compounds that inhibit the assembly of NP, VP35, and VP24, or that inhibit the glycosylation of NP, required for nucleocapsid formation. Assays are described to identify compoundsthat inhibit the interaction of NP, VP35, and VP24, or that inhibit the covalent attachment of sugars to NP, remove the attached sugars from NP, or inhibit the biosynthesis of sugars, and disrupt the formation of infectious virus. Inhibitory compoundsthat are relatively non-toxic, e.g., display a good therapeutic index, may be utilized as antiviral agents for the treatment of viral infection in animals, including humans.

For clarity of discussion, the invention is described in the subsections below for filoviruses. However, the principles may be analogously applied to other viruses in which interactions of analogues of these proteins, N(NP) and P proteins, havebeen seen. These viruses include paramyxoviruses (e.g., sendai virus, mumps virus, measles virus, distemper virus, rinderpest virus, and respiratory syncytial virus), arenaviruses, bornaviruses, bunyviruses, orthomyxoviruses (e.g., influenza virus), andrhabdoviruses that are negative-stranded RNA viruses capable of forming filaments.

Screening Assays

The following assays are designed to identify compounds that inhibit nucleocapsid assembly. The compounds which may be screened in accordance with the invention include, but are not limited to, small organic molecules, peptides, andpeptidomimetics that interact with (e.g., bind to) NP, VP35, or VP24, or block glycosylation of NP, and inhibit nucleocapsid assembly; as well as small organic molecules, peptides, and peptidomimetics that mimic binding domains of NP, VP35, or VP24 andact as molecular decoys to bind and "neutralize" natural ligand, or that mimic glycosylation domains of NP. In one example, peptide fragments corresponding to binding domains of NP, VP35, or VP24 compete with and inhibit the interaction of theseproteins, or peptide fragments corresponding to glycosylation domains compete with and inhibit glycosylation of NP. Inhibitory compounds identified in the foregoing screening assays that may be used in accordance with the invention, may include but arenot limited to small organic molecules, peptides, and peptidomimetics. The assays can be used to identify compounds that inhibit the interaction of NP, VP35, and VP24, or that inhibit the glycosylation of NP, by, for example, competing with domains ofNP as the recipient of sugars, or blocking the sites for sugar attachment, or by blocking the nucleocapsid assembly sites or competing with proteins as substrates for nucleocapsid assembly.

The principle of the assays used to identify compounds that bind to NP, VP35, or VP24 involves preparing a reaction mixture of NP, VP35, or VP24 and the test compound under conditions and for a time sufficient to allow the two components tointeract and bind, thus forming a complex which can be removed and/or detected in the reaction mixture. The NP, VP35, or VP24 species used can vary depending upon the goal of the screening assay. For example, the full length NP, VP35, or VP24, apeptide corresponding to the binding domain of NP, VP35, or VP24, or a fusion protein containing full length NP, VP35, or VP24, or a peptide corresponding to the binding domain of NP, VP35, or VP24, fused to a protein or polypeptide that affordsadvantages in the assay system (e.g., labeling, isolation of the resulting complex, etc.) can be utilized.

The screening assays can be conducted in a variety of ways. For example, one method to conduct such an assay would involve anchoring the NP, VP35, or VP24 protein, peptide or fusion protein or the test substance onto a solid phase and detectingNP, VP35, or VP24/test compound complexes anchored on the solid phase at the end of the reaction. In one embodiment of such a method, the NP, VP35, or VP24 reactant may be anchored onto a solid surface, and the test compound, which is not anchored, maybe labeled, either directly or indirectly.

In practice, microtiter plates may conveniently be utilized as the solid phase. The anchored component may be immobilized by non-covalent or covalent attachments. Non-covalent attachment may be accomplished by simply coating the solid surfacewith a solution of the protein and drying. Alternatively, an immobilized antibody, preferably a monoclonal antibody, specific for the protein to be immobilized may be used to anchor the protein to the solid surface. The surfaces may be prepared inadvance and stored.

In order to conduct the assay, the nonimmobilized component is added to the coated surface containing the anchored component. After the reaction is complete, unreacted components are removed (e.g., by washing) under conditions such that anycomplexes formed will remain immobilized on the solid surface. The detection of complexes anchored on the solid surface can be accomplished in a number of ways. Where the previously nonimmobilized component is pre-labeled, the detection of labelimmobilized on the surface indicates that complexes were formed. Where the previously nonimmobilized component is not pre-labeled, an indirect label can be used to detect complexes anchored on the surface; e.g., using a labeled antibody specific for thepreviously nonimmobilized component (the antibody, in turn, may be directly labeled or indirectly labeled with a labeled anti-Ig antibody).

Alternatively, a reaction can be conducted in a liquid phase, the reaction products separated from unreacted components, and complexes detected; e.g., using an immobilized antibody specific for NP, VP35, or VP24 protein, peptide or fusion proteinor the test compound to anchor any complexes formed in solution, and a labeled antibody specific for the other component of the possible complex to detect anchored complexes.

Alternatively, cell-based assays can be used to identify compounds that interact with NP, VP35, or VP24. To this end, cell lines that express NP, VP35, or VP24, or cell lines (e.g., COS cells, CHO cells, 293 cells, etc.) that have beengenetically engineered to express NP, VP35, or VP24 (e.g., by transfection or transduction of NP, VP35, or VP24 cDNA) can be used. Interaction of a cell-permeable test compound with the NP, VP35, or VP24 expressed by the host cell can be determined bycomparison or competition with native ligand.

Any method suitable for detecting protein-protein interactions may be employed for identifying compounds that inhibit nucleocapsid assembly. Among the traditional methods which may be employed are co-immunoprecipitation, crosslinking andco-purification through gradients or chromatographic columns of cell lysates or proteins obtained from cell lysates and NP, VP35, or VP24 to identify proteins in the lysate that interact with NP, VP35, or VP24. For these assays, the NP, VP35, or VP24component used can be a full length NP, VP35, or VP24, a peptide corresponding to the binding domain of NP, VP35, or VP24, or a fusion protein containing full length NP, VP35, or VP24, or a peptide corresponding to the binding domain of NP, VP35, orVP24, fused to a protein or polypeptide.

The macromolecules that interact with NP, VP35, or VP24 are referred to, for purposes of this discussion, as "binding partners" (i.e., for NP: VP35 or VP24; for VP35: NP or VP24; and for VP24: NP or VP35). The basic principle of the assaysystems used to identify compounds that inhibit the interaction between NP, VP35, or VP24 and its binding partner or partners involves preparing a reaction mixture containing full length NP, VP35, or VP24, a peptide corresponding to the binding domain ofNP, VP35, or VP24, or a fusion protein containing full length NP, VP35, or VP24, or a peptide corresponding to the binding domain of NP, VP35, or VP24, fused to a protein or polypeptide, and the binding partner under conditions and for a time sufficientto allow the two to interact and bind, thus forming a complex. In order to test a compound for inhibitory activity, the reaction mixture is prepared in the presence and absence of the test compound. The test compound may be initially included in thereaction mixture, or may be added at a time subsequent to the addition of the NP, VP35, or VP24 moiety and its binding partner. Control reaction mixtures are incubated without the test compound or with a placebo. The formation of any complexes betweenthe NP, VP35, or VP24 moiety and the binding partner is then detected. The formation of a complex in the control reaction, but not in the reaction mixture containing the test compound, indicates that the compound interferes with the interaction of NP,VP35, or VP24 and the interactive binding partner.

The assay for compounds that inhibit the interaction of NP, VP35, or VP24 and binding partners can be conducted in a heterogeneous or homogeneous format. Heterogeneous assays involve anchoring either the NP, VP35, or VP24 moiety product or thebinding partner onto a solid phase and detecting complexes anchored on the solid phase at the end of the reaction. In homogeneous assays, the entire reaction is carried out in a liquid phase. In either approach, the order of addition of reactants canbe varied to obtain different information about the compounds being tested. For example, test compounds that inhibit the interaction by competition can be identified by conducting the reaction in the presence of the test substance; i.e., by adding thetest substance to the reaction mixture prior to or simultaneously with the NP, VP35, or VP24 moiety and interactive binding partner. Alternatively, test compounds that disrupt preformed complexes, e.g., compounds with higher binding constants thatdisplace one of the components from the complex, can be tested by adding the test compound to the reaction mixture after complexes have been formed. The various formats are described briefly below.

In a heterogeneous assay system, either the NP, VP35, or VP24 moiety or the interactive binding partner, is anchored onto a solid surface, while the non-anchored species is labeled, either directly or indirectly. In practice, microtiter platesare conveniently utilized. The anchored species may be immobilized by non-covalent or covalent attachments. Non-covalent attachment may be accomplished simply by coating the solid surface with a solution of the NP, VP35, or VP24 or binding partner anddrying. Alternatively, an immobilized antibody specific for the species to be anchored may be used to anchor the species to the solid surface. The surfaces may be prepared in advance and stored.

In order to conduct the assay, the partner of the immobilized species is exposed to the coated surface with or without the test compound. After the reaction is complete, unreacted components are removed (e.g., by washing) and any complexesformed will remain immobilized on the solid surface. The detection of complexes anchored on the solid surface can be accomplished in a number of ways. Where the non-immobilized species is pre-labeled, the detection of label immobilized on the surfaceindicates that complexes were formed. Where the non-immobilized species is not pre-labeled, an indirect label can be used to detect complexes anchored on the surface; e.g., using a labeled antibody specific for the initially non-immobilized species (theantibody, in turn, may be directly labeled or indirectly labeled with a labeled anti-Ig antibody). Depending upon the order of addition of reaction components, test compounds which inhibit complex formation or which disrupt preformed complexes can bedetected.

Alternatively, the reaction can be conducted in a liquid phase in the presence or absence of the test compound, the reaction products separated from unreacted components, and complexes detected; e.g., using an immobilized antibody specific forone of the binding components to anchor any complexes formed in solution, and a labeled antibody specific for the other partner to detect anchored complexes. Again, depending upon the order of addition of reactants to the liquid phase, test compoundswhich inhibit complex or which disrupt preformed complexes can be identified.

In an alternate embodiment of the invention, a homogeneous assay can be used. In this approach, a preformed complex of the NP, VP35, or VP24 moiety and the interactive binding partner is prepared in which either the NP, VP35, or VP24 or itsbinding partner is labeled, but the signal generated by the label is quenched due to formation of the complex (see, e.g., U.S. Pat. No. 4,109,496 by Rubenstein which utilizes this approach for immunoassays). The addition of a test substance thatcompetes with and displaces one of the species from the preformed complex will result in the generation of a signal above background. In this way, test substances which disrupt NP, VP35, or VP24/binding partner interaction can be identified.

In a particular embodiment, a NP, VP35, or VP24 fusion protein can be prepared for immobilization. For example, the full length NP, VP35, or VP24, or a peptide corresponding to the binding domain of NP, VP35, or VP24, can be expressed withglutathione-S-transferase (GST) using a fusion vector, such as pGEX-5X-1, in such a manner that its binding activity is maintained in the resulting fusion protein. The interactive binding partner can be purified and used to raise a monoclonal antibody,using methods routinely practiced in the art. This antibody can be labeled with a radioactive isotope by methods routinely practiced in the art. In a heterogeneous assay, e.g., the GST-NP, VP35, or VP24 fusion protein can be anchored toglutathione-agarose beads. The interactive binding partner can then be added in the presence or absence of the test compound in a manner that allows interaction and binding to occur. At the end of the reaction period, unbound material can be washedaway, and the labeled monoclonal antibody can be added to the system and allowed to bind to the complexed components. The interaction between the NP, VP35, or VP24 and the interactive binding partner can be detected by measuring the amount ofradioactivity that remains associated with the glutathione-agarose beads. A successful inhibition of the interaction by the test compound will result in a decrease in measured radioactivity.

Alternatively, the GST-NP, VP35, or VP24 fusion protein and the interactive binding partner can be mixed together in liquid in the absence of the solid glutathione-agarose beads. The test compound can be added either during or after the speciesare allowed to interact. This mixture can then be added to the glutathione-agarose beads and unbound material is washed away. Again the extent of inhibition of the NP, VP35, or VP24/binding partner interaction can be detected by adding the labeledantibody and measuring the radioactivity associated with the beads.

In another embodiment of the invention, these same techniques can be employed using peptide fragments that correspond to the binding domains of NP, VP35, or VP24, in place of the full length proteins. Any number of methods routinely practiced inthe art can be used to identify and isolate the binding sites. These methods include, but are not limited to, mutagenesis of the gene encoding one of the proteins and screening for disruption of binding in a co-immunoprecipitation assay. Compensatingmutations in the gene encoding the second species in the complex can then be selected. Sequence analysis of the genes encoding the respective proteins will reveal the mutations that correspond to the region of the protein involved in interactivebinding. Alternatively, one protein can be anchored to a solid surface using methods described above, and allowed to interact with and bind to its labeled binding partner, which has been treated with a proteolytic enzyme, such as trypsin. Afterwashing, a short, labeled peptide comprising the binding domain may remain associated with the solid material, which can be isolated and identified by amino acid sequencing. Also, since the gene coding for the intracellular binding partner is available,short gene segments can be engineered to express peptide fragments of the protein, which can then be tested for binding activity and purified or synthesized.

For example, and not by way of limitation, NP, VP35, or VP24 can be anchored to a solid material as described, above, by making a GST-NP, VP35, or VP24 fusion protein and allowing it to bind to glutathione agarose beads. The interactive bindingpartner can be labeled with a radioactive isotope and cleaved with a proteolytic enzyme such as trypsin. Cleavage products can then be added to the anchored GST-NP, VP35, or VP24 fusion protein and allowed to bind. After washing away unbound peptides,labeled bound material, representing the binding partner binding domain, can be eluted, purified, and analyzed for amino acid sequence by well-known methods. Peptides so identified can be produced synthetically or fused to appropriate facilitativeproteins using recombinant DNA technology.

Compounds, including but not limited to binding compounds identified via assay techniques such as those described in the preceding sections above can be tested for the ability to inhibit nucleocapsid assembly. Cell-based systems can be used. Such systems can include, for example, recombinant or non-recombinant cells, such as cell lines, which express the NP, VP35, or VP24 gene. In addition, expression host cells (e.g., COS cells, CHO cells, 293 cells) genetically engineered to express afunctional NP, VP35, or VP24 protein and to respond to association by the natural ligand (such as the corresponding NP, VP35, or VP24 protein), e.g., as measured by a chemical or phenotypic change, can be used as an end point in the assay.

Additional Cell Screening and In Vitro Screening Assays

The assays described herein are designed to measure assembly of NP, VP35, and VP24, or glycosylation of NP, synthesized by genetically engineered cells. These assays are conducted in cells or in vitro, and can be used to identify substances thatinhibit assembly of NP, VP35, and VP24, or glycosylation of NP, and the production of nucleocapsids. In the assays of the invention, a protein selected from the group consisting of NP, VP35, and VP24 is reacted in cells or in vitro with a test substanceto form a reaction mixture. The mixture is then incubated to determine if nucleocapsid formation is inhibited. In one example, as the nucleocapsids are formed, the mixture will become increasingly turbid, and thus the rate of nucleocapsid formation canbe monitored by measuring the amount of light deflected or absorbed by the mixture over time. Inhibition of binding indicates the ability of the test substance to block the assembly of NP, VP35, and VP24 and inhibit the formation of infectious virus. Alternatively, NP is reacted in cells or in vitro with a sugar group or donor of a sugar group in the presence of a protein glycosylation enzyme that is responsible for glycosylation. Incorporation of the sugar group into NP is an indication ofglycosylation. Inhibition of the incorporation of the sugar group by the test substance indicates the ability of the test substance to block glycosylation of NP and inhibit the formation of infectious virus.

In the assays of the invention, assembly of NP, VP35, and VP24, and glycosylation of NP, may be detected by a variety of methods. For example, binding of NP, VP35, and VP24, or incorporation of a sugar group into NP, can be detected by a changein the mobility of the reaction product as determined by chromatographic methods, including but not limited to TLC (thin layer chromatography), HPLC (high performance liquid chromatography), or electrophoretic methods such as SDS-PAGE. Additionally, anysubstrate, NP, VP35, or VP24, or a sugar group, may be labeled so that detection of the label in the reaction product can be used as an indicator of assembly of NP, VP35, and VP24, or glycosylation of NP. To this end, a variety of signal generatingcompounds, including but not limited to radiolabels (e.g., 3H, 14C, 32P, 35S, 125I, 131I), fluorogenic compounds, colorimetric compounds, enzymes, etc., may be incorporated into the substrate using standard metaboliclabeling techniques or chemical conjugating techniques known in the art. Antibodies specific for the substrate may be used to isolate and/or capture the reaction product. Where solid supports are utilized, one of the reactants can be immobilized on thesurface of the support by non-covalent or covalent attachments. For example, the immobilization of proteins such as anti-NP, anti-VP35, or anti-VP24 can be accomplished by coating the support with a solution of the protein and drying. The coatedsupports may be prepared in advance and stored prior to use.

Assay Components

The NP, VP35, or VP24, or a sugar group, sugar group donor, or protein glycosylation enzyme, that forms the components of the reaction may be obtained in a variety of ways.

The cell screening assays utilize genetically engineered cells that express a protein selected from the group consisting of NP, VP35, or VP24 in cells, optionally which are capable of glycosylation. Such cells or cell lines may be engineered toexpress NP, VP35, and VP24 using techniques known to those skilled in the art (e.g., see Sambrook et al. 1989 Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.). Such cells provide all the componentsnecessary for assembly of NP, VP35, and VP24, or glycosylation of NP, and can be used as described herein with a labeled NP, VP35, or VP24, or with a labeled sugar, and/or with antibodies specific for NP, VP35, or VP24, or for the sugar, that can be usedto recover the reaction product from the cells and/or for detection.

Antibodies specific for NP, VP35, and VP24 may be prepared by any of a variety of well-known techniques. In a preferred embodiment, the antibodies in the assay should be directed to epitopes of NP, VP35, and VP24 that do not interfere withassembly of NP, VP35, and VP24, or glycosylation of NP.

For the production of antibodies, various host animals may be immunized by injection with NP, VP35, and VP24 or portion thereof. Such host animals may include but are not limited to rabbits, mice, and rats, to name but a few. Various adjuvantsmay be used to increase the immunological response, depending on the host species, including but not limited to Freund's (complete and incomplete), mineral gels such as aluminum hydroxide, surface active substances such as lysolecithin, pluronic polyols,polyanions, peptides, oil emulsions, keyhole limpet hemocyanin, dinitrophenol, and potentially useful human adjuvants such as BCG (bacille Calmette-Guerin) and Corynebacterium parvum.

Monoclonal antibodies may be prepared by using any technique that provides for the production of antibody molecules by continuous cell lines in culture. These include but are not limited to the hybridoma technique originally described by Kohlerand Milstein, (1975 Nature 256:495-497), the human B-cell hybridoma technique (Kosbor et al. 1983 Immunol Today 4:72; Cote et al. 1983 PNAS USA 80:2026-2030) and the EBV-hydridoma technique (Cole et al. 1985 Monoclonal Antibodies and Cancer Therapy AlanR. Liss, Inc., pp. 77-96). In addition, techniques developed for the production of "chimeric antibodies" (Morrison et al. 1984 PNAS USA 81:6851-6855; Neuberger et al. 1984 Nature 312:604-608; Takeda et al., 1985 Nature 314:452-454) by splicing thegenes from a mouse antibody molecule of appropriate antigen specificity together with genes from a human antibody molecule of appropriate biological activity can be used. Alternatively, techniques described for the production of single chain antibodies(U.S. Pat. No. 4,946,778) can be adapted to produce single chain antibodies specific to NP, VP35, and VP24.

Antibody fragments that recognize specific epitopes may be generated by known techniques. For example, such fragments include but are not limited to: the F(ab')2 fragments that can be produced by pepsin digestion of the antibody molecule and theFab fragments that can be generated by reducing the disulfide bridges of the F(ab')2 fragments. Alternatively, Fab expression libraries may be constructed (Huse et al. 1989 Science 246:1275-1281) to allow rapid and easy identification of monoclonal Fabfragments with the desired specificity.

For in vitro assays, the NP, VP35, and VP24 may comprise any recombinantly produced protein, or in the case of using NP as a substrate for glycosylation, any protein that has the required motif for glycosylation. In the latter case, such NPproteins include, but are not limited to, unprocessed NP proteins in which the NP proteins have not been post-translationally modified by the addition of a sugar group. Unprocessed NP proteins may advantageously be obtained by cloning and expressing theNP gene in any of a variety of prokaryotic expression systems, using recombinant DNA techniques well known in the art (e.g., see Sambrook, 1989, supra). The NP protein expressed in such prokaryotic systems will not be processed or post-translationallymodified, as they would be in eukaryotic systems. Alternatively, eukaryotic cell lines not capable of glycosylation may be used as expression hosts.

Alternatively, the NP, VP35, and VP24 may be chemically synthesized using techniques well known in the art (e.g., see Creighton 1983 Proteins: Structures and Molecular Principles, W.H. Freeman & Co., NY, Chapter 1).

Whether produced by molecular cloning methods or by chemical synthetic methods, the amino acid sequence of the NP, VP35, and VP24 which may be used in either the cell-based or in vitro assay of the invention need not be identical to the reportedsequence of NP, VP35, and VP24. The NP, VP35, and VP24 may comprise altered sequences in which amino acid residues are deleted, added, or substituted resulting in a functionally equivalent product that serves as a substrate for assembly orglycosylation.

For example, functionally equivalent amino acid residues may be substituted for residues within the sequence resulting in a change of sequence. Such substitutes may be selected from other members of the class to which the amino acid belongs,e.g., the nonpolar (hydrophobic) amino acids include alanine, leucine, isoleucine, valine, proline, phenylalanine, tryptophan and methionine; the polar neutral amino acids include glycine, serine, threonine, cysteine, tyrosine, asparagine, and glutamine;the positively charged (basic) amino acids include arginine, lysine and histidine; the negatively charged (acidic) amino acids include aspartic and glutamic acid.

The glycosylation enzyme used in the in vitro assay may be obtained from a variety of sources. For example, the glycosylation enzyme may be isolated from any of a variety of mammalian cells, tissues or organs using purification schemes wellknown to those skilled in the art. Alternatively, crude lysates of cells that express the glycosylation enzyme, or fractions thereof, of cells, tissues, or organs that express the glycosylation enzyme may be utilized as a component of the assay systems. Alternatively, the glycosylation enzyme could be produced using chemical methods to synthesize the amino acid sequence in whole or in part (e.g., see Creighton, 1983, supra, pp. 34-49 and 50-60).

Cell Screening Assay

This assay detects compounds that inhibit the assembly of NP, VP35, and VP24, or that inhibit the glycosylation of NP, in cells engineered to express a substrate for assembly or glycosylation. Preferably, the test compounds are cell-permeable. The general operation involves adding a test compound to the cells to form a reaction mixture, incubating the reaction mixture for sufficient time to obtain a result, and determining whether the test compound inhibits the assembly of NP, VP35, and VP24,or the glycosylation of NP, as compared to cells in the absence of the test compound.

In one embodiment, the assay is conducted by adding a labeled sugar group or a labeled precursor of the sugar group, with and without test compound, to cells engineered to express NP, recovering the NP from the cells, and detecting whether thelabeled sugar group or labeled precursor of the sugar group was incorporated into the NP recovered. The use of labeled precursors of the sugar groups allows for the detection of compounds that may inhibit the biosynthesis of sugar groups such that aselective inhibition of infectious virus formation is achieved. The use of labeled sugar groups or precursors of the sugar groups allows for detection of compounds that inhibit the attachment of sugar groups to the viral NP, such that a selectiveinhibition of infectious virus formation is achieved. Either the labeled precursor of the sugar groups or the labeled sugar groups may be used to detect compounds that remove sugar groups from NP, and inhibit the formation of infectious viruses.

In another embodiment, the test compound and the labeled sugar group or labeled precursor of the sugar group are added to a culture of cells engineered to express NP, VP35, and VP24. The use of these cells in the assay system offers anadvantage, in that inhibition of nucleocapsid assembly can also be assayed. The use of genetically engineered cells that express NP but not VP35 or VP24 will identify only those compounds that inhibit glycosylation of NP.

In another embodiment, the assay is conducted by adding a test compound to cells engineered to express a protein selected from the group consisting of NP, VP35, and VP24, recovering the recombinantly produced protein from the cells, and detectingwhether the compound binds a member of the group. Alternatively, the test compound is added to a culture of cells engineered to express all three members selected from the group consisting of NP, VP35, and VP24. The use of these cells in the assaysystem offers an advantage, in that inhibition of nucleocapsid assembly can also be assayed. The use of genetically engineered cells that express a protein selected from the group consisting of NP, VP35, and VP24 will identify only those compounds thatinhibit glycosylation of NP or bind NP, VP35, or VP24, but the use of genetically engineered cells that express all three members selected from the group consisting of NP, VP35, and VP24 will identify inhibition of nucleocapsid assembly.

The order of addition of the test compound and the sugar group or precursor of the sugar group may be varied, e.g., simultaneous or sequential additions may be performed and can provide different information. For example, the prior addition ofthe test compound will identify compounds that prevent glycosylation of NP. The addition of the test compound subsequent to the addition of labeled sugar group could be used to identify compounds that remove sugar from NP. No test compound, or aplacebo, is added to the controls.

After a suitable time period, NP, VP35, or VP24 is isolated from the culture. This may be accomplished by lysing the cells and isolating NP, VP35, or VP24 from the lysates with an anti-NP antibody, anti-VP35 antibody, or anti-VP24 antibody;e.g., an immobilized antibody that will capture and anchor. This system allows for rapid high throughput screening of test compounds. Alternatively, the NP, VP35, or VP24 can be isolated from the lysate by immunoprecipitation or immunoelectrophoresis(e.g., Western blot).

The presence or absence of labeled sugar groups incorporated into the isolated NP is then detected. If the test compound can prevent the glycosylation of viral NP, the NP will not incorporate the labeled sugar group and the assay will be scoredby the absence of the incorporation of label. If a test compound does not inhibit NP glycosylation, the protein will incorporate the label and the labeled protein will be detected by techniques such as those described above.

In another embodiment, the presence or absence of binding of the test compound to the isolated NP, VP35, or VP24 is detected. If the test compound can bind viral NP, VP35, or VP24, the assay will be scored by the presence of such binding. Ifthe test compound does not bind viral NP, VP35, or VP24, the unbound protein will be detected by techniques such as those described above.

In another embodiment, the presence or absence of nucleocapsid assembly is detected. If the test compound can prevent the assembly of NP, VP35, and VP24, unbound proteins will be detected by techniques such as those described above. If the testcompound does not inhibit the assembly of NP, VP35, and VP24, the assay will be scored by the formation of nucleocapsids.

In Vitro Screening Assay

This assay detects compounds that inhibit the assembly of NP, VP35, and VP24, or that inhibit the glycosylation of NP, in vitro. The general principle involves adding a test compound to a reaction mixture, incubating the reaction mixture forsufficient time to obtain a result, and determining whether the test compound inhibits the assembly of NP, VP35, and VP24, or the glycosylation of NP, as compared to a reaction mixture in the absence of the test compound.

In one embodiment, the assay is conducted by adding a labeled sugar group, with and without test compound, to a reaction mixture containing NP and enzyme, recovering the NP from the cells, and detecting whether the labeled sugar group wasincorporated into the NP recovered.

In another embodiment, the test compound and the labeled sugar group are added to a reaction mixture containing NP, VP35, and VP24, and enzyme. The use of this reaction mixture in the assay system offers an advantage, in that inhibition ofnucleocapsid assembly can also be assayed. The use of a reaction mixture that contains NP but not VP35 or VP24 will identify only those compounds that inhibit glycosylation of NP.

In another embodiment, the assay is conducted by adding a test compound to a reaction mixture that contains a protein selected from the group consisting of NP, VP35, and VP24, recovering the recombinantly produced protein from the cells, anddetecting whether the compound binds a member of the group. Alternatively, the test compound is added to a reaction mixture that contains all three members selected from the group consisting of NP, VP35, and VP24. The use of these reaction mixtures inthe assay system offers an advantage, in that inhibition of nucleocapsid assembly can also be assayed. The use of a reaction mixture that contains a protein selected from the group consisting of NP, VP35, and VP24 will identify only those compounds thatinhibit glycosylation of NP or bind NP, VP35, or VP24, but the use of a reaction mixture that contains all three members selected from the group consisting of NP, VP35, and VP24 will identify inhibition of nucleocapsid assembly.

As explained in the cell based assay systems, the order of addition of the test compound relative to the reactants may be varied to distinguish compounds that act by inhibiting or preventing glycosylation, and those that disrupt or remove sugarsfrom NP.

After a suitable time period, NP, VP35, or VP24 is isolated from the reaction mixture. This may be accomplished by isolating NP, VP35, or VP24 from the reaction mixture with an anti-NP antibody, anti-VP35 antibody, or anti-VP24 antibody; e.g.,an immobilized antibody that will capture and anchor. This system allows for rapid high throughput screening of test compounds. Alternatively, the NP, VP35, or VP24 can be isolated from the reaction mixture by immunoprecipitation orimmunoelectrophoresis (e.g., Western blot).

The presence or absence of labeled sugar groups incorporated into the isolated NP is then detected. If the test compound can prevent the glycosylation of viral NP, the NP will not incorporate the labeled sugar group and the assay will be scoredby the absence of the incorporation of label. If a test compound does not inhibit NP glycosylation, the protein will incorporate the label and the labeled protein will be detected by techniques such as those described above.

In another embodiment, the presence or absence of binding of the test compound to the isolated NP, VP35, or VP24 is detected. If the test compound can bind viral NP, VP35, or VP24, the assay will be scored by the presence of such binding. Ifthe test compound does not bind viral NP, VP35, or VP24, the unbound protein will be detected by techniques such as those described above.

In another embodiment, the presence or absence of nucleocapsid assembly is detected. If the test compound can prevent the assembly of NP, VP35, and VP24, unbound proteins will be detected by techniques such as those described above. If the testcompound does not inhibit the assembly of NP, VP35, and VP24, the assay will be scored by the formation of nucleocapsids.

In yet another embodiment of the invention, the NP, VP35, or VP24 may be immobilized prior to the addition of the test compound. To this end, a solution of the NP, VP35, or VP24 can be used to coat a solid support. Alternatively, an antibodymay be used to coat the support in order to anchor the NP, VP35, or VP24. The ability of the immobilized NP, VP35, or VP24 to incorporate label sugar in the presence of the test compound is scored by the retention of the label by the protein. Alternatively, the ability of immobilized NP, VP35, or VP24 to bind a labeled test compound is scored in a binding assay. The presence or absence of labeled NP, VP35, or VP24 will be detected by autoradiographic analysis of the immobilized component. The evaluation of the test compound is by reference to a control experiment in which the test compound is not added.

Treatment of Filovirus Infection Using Compounds that Inhibit Virus Assembly

The particular compound that inhibits NP glycosylation or viral nucleocapsid assembly can be administered to a patient at therapeutically effective doses. A therapeutically effective dose refers to that amount of the compound sufficient toresult in amelioration of symptoms of viral infection.

Toxicity and therapeutic efficacy of such compounds can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., for determining the LD50 (the dose lethal to 50% of the population) and the ED50(the dose therapeutically effective in 50% of the population). The dose ratio between toxic and therapeutic effects is the therapeutic index and it can be expressed as the ratio LD50/ED50. Compounds that exhibit large therapeutic indices arepreferred. While compounds that exhibit toxic side effects may be used, care should be taken to design the delivery system that targets such compounds to the site of infection in order to minimize damage to uninfected cells and reduce side effects.

The data obtained from cell culture assays and animal studies can be used in formulating a range of dosage for use in humans. The dosage of such compounds lies preferably within a range of circulating concentrations that include the ED50with little or no toxicity. The dosage may vary within this range depending upon the dosage form employed and the route of administration utilized. For any compound used in the method of the invention, the therapeutically effective dose can beestimated initially from cell culture assays. A dose may be formulated in animal models to achieve a circulating plasma concentration range that includes the IC50 (i.e., the concentration of the test compound which achieves a half-maximal infectionor a half-maximal inhibition) as determined in cell culture. Such information can be used to more accurately determine useful doses in humans. Levels in plasma may be measured, for example, by high performance liquid chromatography.

Pharmaceutical compositions for use in accordance with the present invention may be formulated in a conventional manner using one or more physiologically acceptable carriers or excipients.

Thus, the therapeutic compounds and their physiologically acceptable salts and solvates may be formulated for administration by inhalation or insufflation (either through the mouth or the nose) or for oral, buccal, parenteral or rectaladministration.

For administration by inhalation, the compounds for use according to the present invention are conveniently delivered in the form of an aerosol spray presentation from pressurized packs or a nebulizer, with the use of a suitable propellant, e.g.,dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas. In the case of a pressurized aerosol the dosage unit may be determined by providing a valve to deliver a metered amount. Capsules andcartridges of, e.g., gelatin for use in an inhaler or insufflator may be formulated containing a powder mix of a therapeutic compound and a suitable powder base such as lactose or starch.

For oral administration, the pharmaceutical compositions may take the form of, for example, tablets or capsules prepared by conventional means with pharmaceutically acceptable excipients such as binding agents (e.g., pregelatinised maize starch,polyvinylpyrrolidone or hydroxypropylmethyl cellulose); fillers (e.g., lactose, microcrystalline cellulose or calcium hydrogen phosphate); lubricants (e.g., magnesium stearate, talc or silica); disintegrants (e.g., potato starch or sodium starchglycolate); or wetting agents (e.g., sodium lauryl sulphate). The tablets may be coated by methods well known in the art. Liquid preparations for oral administration may take the form of, for example, solutions, syrups or suspensions, or they may bepresented as a dry-product for constitution with water or other suitable vehicle before use. Such liquid preparations may be prepared by conventional means with pharmaceutically acceptable additives such as suspending agents (e.g., sorbitol syrup,cellulose derivatives or hydrogenated edible fats); emulsifying agents (e.g., lecithin or acacia); non-aqueous vehicles (e.g., almond oil, oily esters, ethyl alcohol or fractionated vegetable oils); and preservatives (e.g., methyl orpropyl-p-hydroxybenzoates or sorbic acid). The preparations may also contain buffer salts, flavoring, coloring and sweetening agents as appropriate.

Preparations for oral administration may be suitably formulated to give controlled release of the active compound.

For buccal administration the compositions may take the form of tablets or lozenges formulated in conventional manner.

The therapeutic compounds may be formulated for parenteral administration by injection e.g., by bolus injection or continuous infusion. Formulations for injection may be presented in unit dosage form, e.g., in ampoules or in multi-dosecontainers, with an added preservative. The compositions may take such forms as suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents. Alternatively,the active ingredient may be in powder form for constitution with a suitable vehicle, e.g., sterile pyrogen-free water, before use.

The therapeutic compounds may also be formulated in rectal compositions such as suppositories or retention enemas, e.g., containing conventional suppository bases such as cocoa butter or other glycerides.

In addition to the formulations described previously, the compounds may also be formulated as a depot preparation. Such long acting formulations may be administered by implantation (for example, subcutaneously or intramuscularly) or byintramuscular injection. Thus, for example, the therapeutic compounds may be formulated with suitable polymeric or hydrophobic materials (for example as an emulsion in an acceptable oil) or ion exchange resins, or as sparingly soluble derivatives, forexample, as a sparingly soluble salt.

The compositions may, if desired, be presented in a pack or dispenser device which may contain one or more unit dosage forms containing the active ingredient. The pack may for example, comprise metal or plastic foil, such as a blister pack. Thepack or dispenser device may be accompanied by instructions for administration.

Assays for Compounds that Inhibit Glycosylation of Other Proteins Having a Glycosylation Domain that is Substantially Homologous to a Glycosylation Domain of NP Required for Polymerization

In another embodiment, the invention relates to the identification and use of compounds that inhibit the glycosylation of other proteins (e.g., Tau) having a glycosylation domain that is substantially homologous to a glycosylation domain of NPrequired for polymerization. The assays described above to identify compounds that inhibit glycosylation of NP may be analogously applied to identify compounds that inhibit glycosylation of these other proteins (e.g., Tau). Inhibitory compounds thatare relatively non-toxic, e.g., display a good therapeutic index, may be utilized as agents for the treatment of diseases (e.g., neurodegenerative diseases) mediated by polymerization due to glycosylation of these proteins (e.g., Tau) in animals,including humans.

As used herein, two proteins (or a region of the proteins) are substantially homologous when the amino acid sequences are at least about 15-20%, 20-50%, 50-70%, typically as least about 70-75%, more typically at least about 80-85%, and mosttypically at least about 90-95% or more homologous. As a practical matter, whether any particular polypeptide (or a region of the polypeptide) is substantially homologous to, for instance, the amino acid sequence of NP shown in GenBank Accession No.AF272001 (or a region of the amino acid sequence) can be determined conventionally using known computer programs such as Vector NTI alignment to do a comparison under the default parameters.

Comparison of Ebola NP (GenBank Accession No. AF272001) with four clones of Human Tau (GenBank Accession Nos: P19332, P10636, P10637, BC000558) and one Bovine Tau (GenBank Accession No. AAA51609) reveals that a glycosylation domain of NP issubstantially homologous to a region that is present in Tau. FIG. 7. The homology region is amino acid 401 to 739 of NP and Tau's C-terminal domain. The comparison shows about 18.2% homology and 11.3% identity with Tau-BC000558. Accordingly, asequence substantially homologous to a glycosylation domain in NP is present in Human Tau. Consequently, the invention also relates to assays for the identification of compounds that block glycosylation of proteins, like Tau, having a glycosylationdomain that is substantially homologous to a glycosylation domain of NP required for polymerization for use in treatment of diseases mediated by polymerization due to glycosylation of these proteins, like diseases mediated by Tau, such asneurodegenerative diseases, e.g., Alzheimer's disease.

Mechanism of Ebola Virus Assembly

The assembly of Ebola virus nucleocapsid requires virion associated proteins 35 and 24 and post-translational modifications of nucleoprotein.

Assembly of Ebola in Human 293T Cells from Recombinant cDNAs

To determine whether Ebola capsids could assemble in a cell line expressing the appropriate recombinant viral cDNA gene products, expression vectors encoding multiple viral genes were co-transfected into the highly transfectable 293 human renalepithelial cell line. When six plasmids, encoding Ebola GP, NP, VP40, VP35, VP30, and VP24 respectively (FIG. 1A) were co-transfected, substantial accumulation of intracellular Ebola virus-like particles was observed by TEM (FIG. 1B). Aggregates ofwell-formed tubular viral nucleocapsids were seen within the cytoplasm of transfected cells. The structures are similar to infectious virions produced from Vero cells (Geisbert, T. W. and Jahrling, P. B. 1995 Virus Res 39:129-150).

Co-expression of NP, VP35, VP30, and VP24 retained the ability to support capsid formation (FIG. 1C, D), as evidenced by the presence of filamentous strands in cross-section, or bundled hexamers in longitudinal sections. The length of theparticles ranged from 1-4 μm (FIG. 1C). The cross-sectional diameter appeared uniform, approximately 45-50 nm (FIG. 1D), similar to that of Ebola virus described in previous ultrastructural studies (Geisbert, T. W. and Jahrling, P. B. 1995 Virus Res39:129-150; Zaki, S. R. and Goldsmith, C. S. 1999 in: Current Topics in Microbiology and Immunology, H.-D. Klenk, ed. New York: Springer, pp. 97-116). The absence of the negative strand viral genomic RNA and viral RNA polymerase (L) from the cellsindicated that they were not essential for the formation of Ebola nucleocapsid.

NP, VP35 and VP24 are Necessary and Sufficient for Ebola Assembly

To examine the minimum gene requirements for capsid assembly, different combinations of viral genes were systematically analyzed in transfection studies. Formation of the nucleocapsid structure did not occur in the absence of VP24, VP35 or NP(Table 1). No gene product alone, nor any combination of two, supported assembly, indicating that all three proteins were necessary for capsid assembly (Table 1). Similar levels of NP were detected in the presence or absence of other cotransfectedgenes, suggesting that NP protein expression was not sufficient for capsid assembly.

TABLE-US-00002 TABLE 1 Examination of viral capsid formation by scanning TEM CO-TRANSFECTION OF EBOLA GENES FOR VIRAL CAPSID FORMATION EBOLA GENES CAPSID NP VP35 VP40 VP30 VP24 GP FORMATION - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -

3×106 293T cells were transfected with the plasmids containing indicated genes as described below. The presence of specific viral genes (left) and formation of nucleocapsids by scanning TEM (right) is indicated ( or -).

To characterize the Ebola capsids in 293T cells transfected with NP, VP35, and VP24 further, we performed buoyant density gradient sedimentation. The preformed nucleocapsid core failed to bud from the transfected cells, but was released fromtransfected 293T cells that were frozen and thawed (FIG. 2A). Fractions from a gradient of clarified cell lysates obtained after three freeze-thaw cycles were analyzed by Western blot analysis, and the peak of activity was detected at a density of1.16-1.18 g/ml (FIG. 2B, lane 11), comparable but slightly less buoyant than previously described intact virions of 1.14 g/ml (Kiley, M. P. et al. 1988 J Gen Virol 69:1956-1967). By this analysis, NP and VP35 were found to be the major components in theparticle, raising the possibility that VP24 catalyzed particle formation but remained more weakly associated (FIG. 2B, lanes 1 to 13). This finding is similar to those with purified Marburg virus used to isolate the nucleocapsids (Becker, S. et al. 1998Virology 249:406-417).

Role of Specific Domains of NP in Particle Formation

The role of specific domains in the NP gene for Ebola capsid assembly was analyzed by using deletion mutations (FIG. 2C). Expression of these NP mutants was confirmed by Western blotting (FIG. 2D). Despite comparable levels of proteinsynthesis, deletion of the NP NH2-terminal and middle regions abolished capsid assembly, and removal of the 234 amino acids from the COOH-terminus modified the shape of the assembled capsids (FIG. 2E, left), indicating that most of the NP codingregion is essential for particle formation.

Post-translational Modification of NP is Required for NP-VP35 Interaction

The interactions among NP, VP35, and VP24 were examined by co-immunoprecipitation of these proteins following in vitro transcription and translation. VP35 and VP24 could be co-immunoprecipitated with an anti-NP antibody (FIG. 3A, lanes 6-8),indicating that NP interacts directly with the two proteins. VP24 co-immunoprecipitated with NP and VP35 more weakly in vitro (FIG. 3A, lane 6), and it did not co-distribute with them in buoyant density sedimentation fractions (FIG. 2B), suggesting thatit may play an important role in formation of the NP-VP35 complex during capsid formation, but may not be as stably incorporated into viral capsids.

Although the Ebola NP gene encodes 739 amino acids, with a calculated molecular weight of 83 kDa, its migration by SDS-PAGE is consistent with a molecular weight of approximately 115 kDa. While the protein may undergo phosphorylation that mightslightly increase its apparent molecular weight (MW), the possibility existed that another modification, such as glycosylation, accounted for this large size difference (Elliott, L. H. et al. 1985 Virology 147:169-176; Kiley, M. P. et al. 1988 J GenVirol 69:1956-1967; Becker, S. et al. 1994 J Gen Virol 75:809-818). O-linked N-acetylglucosamine (O-GlcNAc) has been found in the nucleus and cytoplasm of eukaryotic cells. Rabbit reticulocyte lysates contain sufficient enzymes and cofactors toglycosylate translated products efficiently (Starr, C. M. and Hanover, J. A. 1990 J Biol Chem 265:6868-6873; Roquemore, E. P. et al. 1994 Meth Enzymol 230:443-460). We hypothesized that NPs translated from reticulocyte and E. coli expression systemsshould differ in their electrophoretic mobility. To test this hypothesis, we performed in vitro translation and analyzed NP post-translational modification as well as its interaction with VP35 and VP24. As expected, NP translated in the reticulocytesystem was of higher MW than that translated from the E. coli S30 system (≥20 kDa), though both NPs were able to immunoprecipitate with anti-NP serum (FIG. 3B, lanes 13, 14). However, NP derived from the reticulocyte system was able toco-precipitate with VP35 whereas NP translated from E. coli S30 extracts did not interact with VP35 (FIG. 3C, lanes 17, 19, 21). These findings suggest that NP is extensively altered by post-translational modification, and this change is necessary forthe interaction of NP with VP35 and VP24 required for particle formation.

Deglycosylation enzymes were used to digest the His-tagged purified NP from transfected 293 cells. After treatment, the migration of NP was altered, and a prominent band appeared on the gel consistent with a molecular weight of 85 kDa, asdetected by polyclonal anti-NP antisera (FIG. 4A, lanes 3, 5). This effect was observed under both denaturing and non-denaturing conditions. Further analysis showed that treatment with α2-3,6,8,9 neuramimidase alone could produce a similar effect(FIG. 4B, lane 7), indicating the presence of sugars containing terminal sialic acid. The presence of additional lower molecular weight bands suggests possible contamination or sensitivity to other enzymes in the digestion reaction, for example,proteases. Treatment with N-acetylglucosidase or N-glycosidase failed to reduce the size of the band generated by neuramimidase. No effect was observed when NP-transfected 293 cells were incubated with tunicamycin and deoxymannojirimycin (dMM), andmigration of this band did not change after digestion in vitro with endoglycosidase H (Endo H), suggesting that NP was primarily O-glycosylated rather than N-linked (FIG. 4B, lanes 9-11). This finding was again confirmed in vivo by treatment ofNP-transfected 293 cells with tunicamycin, where synthesis of NP was unaffected at concentrations that abolished expression of HIV gp160 (FIG. 4C), which shows a high degree of N-linked glycosylation. In addition, point mutation of the four consensusN-linked glycosylation sites did not alter NP migration by SDS-PAGE.

The glycosylation of NP was further confirmed by 3H-glucosamine labeling. Glucosamine is converted by cells into N-acetyl-galactosamine (GalNAc), N-acetyl-neuraminic acid (sialic acid), and N-acetyl-glucosamine (GlcNAc). NP in transfectedcells incorporated 3H-glucosamine and 3H-galactose at levels 53-fold and 18-fold higher than 3H-thymidine (FIG. 4D, left panel). These labels were immunoprecipitated with antibodies to NP, in contrast to 3H-thymidine (FIG. 4D,middle, lane 1), despite comparable levels of NP proteins detected by silver staining (FIG. 4D, right, lane 4).

To confirm the specificity of these carbohydrate moieties in NP, a lectin pull-down assay was performed. The following lectins were used for analysis: Arachis hypogaea (peanut) agglutinin (PNA), which recognizes unsubstituted galactoseβ(1-3)N-acetylgalactosamine cores in O-glycans; Datura stramonium agglutinin (DSA), which binds specifically to galactose β(1-4) glucosamine in complex or in hybrid type glycans; Galantus nivalis agglutinin (GNA), which recognizes terminalmannose-linked α(1-3)-, α(1-6)- or α(1-2)-mannose found in N-glycans; Maackia amurensis agglutinin (MAA) or Sanbucus nigra agglutinin (SNA) which react specifically with α(2-3)-linked or α(2-6)-linked sialic acids,respectively. After washing vigorously four times, NP reacted with four out of five lectins by Western blot analysis (FIG. 4E, lanes 8, 9, 10, 12). The strong reactions to MAA and SNA confirmed the presence of sialic acid on NP. It also reacted withDSA, indicating that NP may contain individual N-acetyl-glucosamine residues with O-glycosidic links to serine or threonine. The failure to react with PNA demonstrated that the disaccharide, galactose (1,3)-acetylgalactosamine, was well-substituted withsialic acid. The weakest reaction to NP was observed with the mannose-specific lectin, GNA.

Pharmacologic Inhibition of the NP/VP35 Interaction

The reactivity of NP with several carbohydrate-specific lectins raised the possibility that this post-translational modification was required for the formation of the nucleocapsid. To test this hypothesis, several potential inhibitors ofserine/threonine sites and/or cytoplasmic glycosylation were tested for their ability to inhibit the interaction of NP with VP35 using in vitro transcription/translation and immunoprecipitation with antisera to VP35. Among the compounds tested, noneaffected the synthesis of modified NP in rabbit reticulocyte lysates in vitro as determined by SDS-PAGE (FIG. 5A, lanes 2-10), though minor changes in molecular weight would not be detected by this method. In the association assay (FIG. 5B), onesynthetic glycoside, mannose α1-O-octyl (Manα1-OC8) substantially reduced the interaction of NP with VP35 at 2 mM (FIG. 5B, lane 16). This inhibition was specific, not seen with the acetylated version of this compound,AcManα1-OC8 (FIG. 5B, lanes 19-21), and the effect was dose-dependent as determined by quantitative densitometry (FIG. 5C). Addition of Manα1-OC8 after the in vitro translation of NP, just prior to incubation with VP35/24, did notinhibit the interaction, suggesting that the synthetic glycoside modifies post-translational glycosylation, disrupting critical determinants required for binding to VP35. This compound may therefore function as a prototype to develop anti-viral agentsthat inhibit Ebola virus assembly.

Minimum Requirements of Ebola Viral Proteins for Capsid Assembly

In this disclosure, we have shown that Ebola viral nucleocapsids are efficiently produced in 293T cells transfected with expression vectors encoding three viral gene products: NP, VP35 and VP24. In this transfected human cell line, Ebola capsidsassembled in the cytoplasm and formed filamentous structures similar to the intact virus (FIG. 1B-D). Co-transfection of NP, VP35 and VP24 supported capsid formation, and omission of any one of these three genes abolished the effect, demonstrating thatthey are necessary and sufficient for viral particle formation. In the assembly of retroviruses and lentiviruses, expression of the Gag precursor polyprotein is sufficient to assemble virion-like particles (Gheysen, D. et al. 1989 Cell 59:103-112;Delchambre, M. et al. 1989 EMBO J 8:2653-2660; Luo, L. et al. 1994 Virology 205:496-502; Smith, A. J. et al. 1993 J Virol 67:2266-2275; Wills, J. W. et al. 1989 J Virol 63:4331-4343; Huang, Y. et al. 2001 J Virol 75:4947-4951). In this regard, Ebolaviral assembly differs in several respects from other negative-strand viruses and retroviruses (Garoff, H. et al. 1998 Microbiol Mol Biol Rev 62:1171-1190). Such studies in retroviral and lentiviral models have led to the successful generation of HIV-1particles in vitro and greater knowledge of HIV capsid biogenesis and structure.

The observations related to Ebola virus expression and NP post-translational modification may promote a better understanding of filovirus assembly. Previous studies have suggested that VP40, a viral matrix protein, plays a role in the formationof mature virus (Ruigrok, R. W. et al. 2000 J Mol Biol 300:103-112; Dessen, A. et al. 2000 EMBO J. 19:4228-4236). A careful examination of these structures reveals that VP40 facilitates the formation of hollow tubular membranes that may facilitate theformation of the surrounding envelope (Jasenosky, L. D. et al. 2001 J Virol 75:5205-5214; Timmins, J. et al. 2001 Virology 283:1-6; Martin-Serrano, J. et al. 2001 Nat Med 7:1313-1319), but there is no evidence that VP40 contributes to the generation ofthe filamentous viral capsid.

Post-translational Modification of Ebola NP is Required for Viral Assembly

There is increasing evidence that glycan structures play important roles in differential protein-protein interaction and immune responses (Han, I. and Kudlow, J. E. 1997 Mol Cell Biol 17: 2550-2558; Wells, L. et al. 2001 Science 291:2376-2378;Lowe, J. B. 2001 Cell 104:809-812; Moody, A. M. et al. 2001 Cell 107:501-512; Hanover, J. A. 2001 FASEB J 15:1865-1876). Here, we have found a novel role for O-glycosylation and sialation of Ebola NP, showing that it is required for the interaction ofNP and VP35. The importance of NP and VP35 in viral replication has been shown previously in artificial replication assays (Muhlberger, E. et al. 1998 J Virol 72:8756-8764; Muhlberger, E. et al. 1999 J Virol 73:2333-2342), and though its involvement incapsid formation has not been previously shown, VP35 is also tightly associated with Ebola viruses produced from infected cells (Becker, S. et al. 1998 Virology 249:406-417). The interactions of analogues of these proteins, N(NP) and P protein, havebeen seen in paramyxo-, rhabdo- and bornaviruses, where they also play essential roles in their replication (Huber, M. et al. 1991 Virology 185:299-308; Horikami, S. M. et al. 1992 J Virol 66:4901-4908; Schwemmle, M. et al. 1998 J Biol Chem273:9007-9012). We envision that this similarity is also related to their roles in capsid assembly for these viruses.

It is not clear how Ebola virus is released from cells during infection. Based on ultrastructure, apparent budding structures have been defined in infected cells and in tissues from patients (Geisbert, T. W. and Jahrling, P. B. 1995 Virus Res39: 129-150; Zaki, S. R. and Goldsmith, C. S. 1999 in: Current Topics in Microbiology and Immunology, H.-D. Klenk, ed. New York: Springer, pp. 97-116); however, no budding or extracellular particles were observed here in 293 cells transfected withplasmids. This finding could reflect the fact that the transfected cells lack cellular factors or viral proteins, such as VP40, that are required for budding. The possibility remains, however, that the release of Ebola virus progeny could proceedthrough an alternative mechanism, such as cell lysis. A previous study has shown that Ebola virus infection of macrophages is associated with budding into the ER (Feldmann, H. et al. 1996 J Virol 70:2208-2214), consistent with this alternative.

Conserved Domains and Common Mechanisms of Viral Assembly

The mechanism described here provides insight into the assembly of filamentous viruses in general, including other filoviruses and a number of paramyxoviruses. Sequence comparison of the nucleoprotein between the various Ebola and Marburg NPsreveals a high degree of sequence conservation of these viral nucleoproteins. Interestingly, this sequence similarity is most striking within the filoviruses (FIG. 6A), but it is also seen in several paramyxoviruses, especially measles virus, the classmost closely related to the filoviruses. An additional subsequence that is common to filoviruses, measles, rinderpest, and respiratory syncytial virus is also evident (FIG. 6B), suggesting that specific negative-stranded RNA viruses capable of formingfilaments may use common mechanisms of assembly. The post-translational modification observed in Ebola virus represents a distinguishing feature that that may underlie the unique morphology of these viruses. Thus, the mechanism described in thisdisclosure provides insight into viral assembly, explains the unique properties of their structure, and provides a specific target for antiviral therapy (FIG. 5).

In another embodiment, the invention relates to pseudoparticles for presentation of antigens or antigenic epitopes for immunogenic or vaccination purposes. Referring to FIG. 8, pseudoparticles are generated by using an in vivo or in vitroapproach. Referring to FIG. 8A, DNA plasmids (or adenoviral vectors or other gene-based vectors) encoding NP, VP35, VP24, and optionally VP40, as well as DNA plasmids (or adenoviral vectors or other gene-based vectors) encoding an antigen (possiblyfused to Ebola GP transmembrane and cytoplasmic domains) are injected in vivo (into mice, or any other animal, including human) to generate pseudoparticles by an in vivo approach. Referring to FIG. 8B, these plasmids are alternatively transfected intoproducer cells, e.g., 293 cells, and the pseudoparticles are then harvested, to generate pseudoparticles by an in vitro approach, upon which the pseudoparticles are injected into recipients with or without adjuvant.

In conclusion, our data has demonstrated that it is achievable to assemble a large number of well-formed Ebola nucleocapsids in a human cell line with a minimum of three Ebola genes: NP, VP35 and VP24. Moreover, Ebola NP is O-glycosylated, whichis required for protein-protein interactions. Though this critical step in the viral life cycle is catalyzed by normal cellular proteins, Ebola virus replication is acute and limited in duration. It is therefore envisioned as representing a target forantiviral therapies that may be common to different filoviruses. Alternatively, we envision targeting the VP35- or VP24-dependent steps of this process. These observations are therefore envisioned as helping to understand the pathogenesis of Ebolavirus infection and disease as they facilitate the achievement of alternative antiviral targets and vaccines.

Plasmids

Plasmids containing GP, NP, VP40, VP35, VP30, and VP24 cDNA, provided by A. Sanchez (Sanchez, A. et al. 1993 Virus Res 29:215-240) were subcloned into the mammalian expression vector pVR1012 (Tooze, J. et al. 1988 J Cell Biol 106:1475-1487);pVR1012-NPΔ5', ΔM, and Δ3' were created by mutagenesis PCR (Stratagene) using primers: CTGGATCCAGATCGATCCGAGTATGGATCATATCCTACAAAAGACA (SEQ ID NO: 1) and its antisense for Δ5', primers CAAAACAGTACTTGATGATCTAGACGAGGACGACGAGGACACT(SEQ ID NO: 2) and its antisense for ΔM, and primers CTTGGTCCTATTCGATCTAAATTCATGGCAATCCTGCAACATCATCAG (SEQ ID NO: 3) and its antisense for Δ3'.

pcDNA-NP-his was created by removal of the stop codon of NP by PCR using primers CGGATCCAGATCGATCCGAGTATG (SEQ ID NO: 4) and GAAGGGCCCCTGATGATGTTGCAGGATTGCCA (SEQ ID NO: 5), and subcloned into the BamHI and ApaI sites of pcDNA-his-A (Invitrogen). All mutations have been confirmed by sequencing. pVR1012-VP35 and -V24 were digested with XbaI/BglII and subcloned into the XbaI/BamHI sites of pAdapt CMV to create pAd-VP35 and pAD-V24 for recombinant adenovirus production.

Transient Transfection and Electron Microscopy (EM)

293T cells were maintained in Dulbecco's Modified Eagle Medium (DMEM; Gibco-BRL), supplemented with 10% fetal bovine serum (FBS). Plasmid DNAs were purified using double cesium chloride sedimentation gradients. Approximately 3×106293T cells were placed in a 10 cm dish one day before transfection. Two μg of each plasmid (each containing one of the Ebola genes) were mixed and used to transfect 293T cells, using the calcium phosphate method (Chen, C. and Okayama, H. 1987 MolCell Biol 7:2745-2752). The vector backbone was used as filler DNA to maintain the same amount of DNA in each transfection. Sixty three hours after transfection, the cells were lifted from plates by resuspending with DMEM, and then pelleted in a 15 mlconical tube by centrifugation at 1000 rpm. The supernatant was removed and a 10-fold volume of fixing solution was added (3% glutaraldehyde and 3% formaldehyde, cacodylate buffer, pH 7.3; Tousimis Research Corporation, Rockville, Md.). The specimenswere mixed gently, and analyzed in the EM laboratory at the University of Michigan.

Immunoprecipitation and Western Blot Analysis

Recombinant adenoviruses containing VP35 and VP24 were produced for antibody production (Aoki, K. et al. 1999 Mol Med 5: 224-231). Polyclonal anti-NP, VP35 and VP24 were produced by the regimen described in (Sullivan, N. J. et al. 2000 Nature408:605-609). The RNAs of NP, VP35 and VP24 were in vitro synthesized from plasmids of pcDNA-NP-his, pGEMgem-VP35, and pCR-VP24 by RiboMax RNA production system (Promega), and the 35S-labeled proteins were in vitro translated individually fromthese RNAs by Flexi Rabbit reticulocytes lysate or E. coli S30 extract systems from Promega, according to the user's manuals. Ten μl of each of 35S-methionine-labeled proteins were mixed and incubated at room temperature for 1 hour, thenimmunoprecipitated with 10 μl of antibody in 500 μl of immunoprecipitation buffer containing 50 mM Tris-HCl pH 7.4, 150 mM NaCl, 1% NP40, 1 mM DTT plus proteinase inhibitor cocktail for 1 hour at 4° C. Five μl of three-times washedProtein G agarose (Invitrogen) was added and incubated for another 1 hour. After washing five times with the buffer described above, the pellets were boiled in SDS gel loading buffer and resolved by SDS-PAGE with autoradiography. Western blot wasperformed as described (Friborg, J. et al. 1999 Nature 402:889-894).

Viral Capsid Production and Buoyant Density Gradient Analysis

3×106 293T cells were transfected with 3 μg of each of pVR1012-NP, VP35 and VP24 in a 100 mm tissue culture dish with DMEM medium. The cells were harvested after three days and freeze-thawed three times in PBS with 0.05% Tween 20. The cleared lysates were mixed with 60% of an Optipre™ (IODIXANOL) medium (Invitrogen) and final concentration of Optipre was adjusted to 30%. Density gradient was formed by centrifugation at 45K for 6 hours with a VTI50 rotor (according to themanufacturer's instructions; Invitrogen). The collected fractions were weighted at 1 ml of each fraction and plotted with density by fractions. Twenty μl of each fraction were separated on a 4-15% SDS-PAGE gel, transferred onto an Immobilon™-Pmembrane and blotted with mouse polyclonal anti-VP24, VP35 or NP. Each lane of Western blot represents and fits with one fraction of self-gradient OptiPre containing the cell lysates.

Biochemical Interactions Among Ebola Gene Products

In vitro translated and 35S-labeled NP, VP35 and VP24 were pulled down with anti-NP. The RNAs of NP, VP35 and VP24 were in vitro synthesized from plasmids of pcDNA-NP-his, pGEM-VP35, and pCR-VP24 by RiboMax RNA production system (Promega),and the 35S-labeled proteins were in vitro translated individually from these RNAs by Flexi Rabbit reticulocytes lysate. Ten μl of each of 35S-methionine-labeled proteins were mixed and incubated at room temperature for 1 hour to allow theinteractions to occur, then immunoprecipitated with 10 μl of mouse polyclonal anti-NP in 500 μl of immunoprecipitation buffer containing 50 mM Tris-HCl pH 7.4, 150 mM NaCl, 1% NP40, 1 mM DTT plus proteinase inhibitor cocktail for 1 hour at4° C. Five μl of three-times washed Protein G agarose (Invitrogen) were added and incubated for another 1 hour. After washing five times with the buffer described above, the pellets were boiled in 30 μl of Laemmli's sample buffer andresolved by SDS-PAGE with autoradiography.

Analysis of NP Sensitivity to Glycosylation

His-tagged NP was purified from pcDNA-NP-his-transfected 293T cells by the Xpress system (Invitrogen) and digested with a deglycosylation kit (CalBiochem) under denaturing and non-denaturing conditions. Five μg of purified NP was denatured at100° C. for 5 minutes in 37.5 μl of buffer containing 35.7 mM sodium phosphate, 0.15% SDS and 70 mM β-mercaptoethanol, pH 7.0. It was then cooled to room temperature, 2.5 μl of TRITON X-100 solution was added, gently mixed, 1 μleach of N-Glycosidase F, α2-3,6,8,9-Neuramimidase, Endo-α-N-acetylgalactosamimidase, β1,4-galactosidase, and β-N-acetylglucosamimidase was added, and incubated for 3 hours at 37° C. Ten μl of the digested reactions weremixed with the same volume of Laemmli's sample buffer, separated with a 4-15% SDS-PAGE gel, and analyzed by Western blot with a mouse polyclonal anti-NP.

0.5×106 293T cells were transfected with 2 μg of pVR1012-NP in six-well plates. Six hours after transfection, glycosylation inhibitor deoxymannojirimycin (dMM) was added to final concentration of 2.5 mM and tunicamycin to 16μg/ml. After 48 hours incubation, the cells were extracted with 300 μl of RIPA (radioimmunoprecipitation) buffer. Ten μl of the cleared cell lysates were denatured at 100° C. for 5 minutes in 37.5 μl of buffer containing 35.7 mMsodium phosphate, 0.15% SDS and 70 mM β-mercaptoethanol, pH 7.0. They were cooled to room temperature, 2.5 ml TRITON X-100 solution was added, and mixed gently. Then, 1 μl each of α2-3,6,8,9-neuramimidase, 0.5% SDS, 1%β-mercaptoethanol, and 50 mM sodium citrate, pH 5.5, for Endoglycosidase H was added. The controls were treated without adding the enzymes. After incubation for 1 hour at 37° C., 10 μl of the reactions were separated with a 4-15%SDS-PAGE gel and analyzed by Western blot with a polyclonal anti-NP.

Radiolabeling of Carbohydrates and Lectin Precipitation/Western Blotting

0.5×106 293T cells were transfected with 2 μg of pcDNA-NP-his in six well plates. Sixteen hours later, the cells were labeled with 100 μCi each of 3H-thymidine, 3H-glycosamine, or 3H-galactose overnight in 3 ml ofDMEM with 10% FCS and 100 μg/ml of D-glucose. The cells were extracted with RIPA buffer and equal amounts of cell lysates were used to pull out labeled NP with 50 μl of ProBond™ resin. After washing three times with 20 mM sodium phosphate,500 mM sodium chloride and 100 mM Imidazole at pH 6.0, and then washing twice with the concentration of Imidazole at 200 mM, NP-his was eluted by heating at 100° C. for 5 minutes in 80 μl Laemmli's sample buffer. 3H incorporation wasmeasured in a Liquid Scintillation Analyzer TRI-CARB-3100TR (Packard) using 5 μl of each sample mixed with 5 ml of MICROSCINT™ 20. SDS-PAGE was performed with 20 μl of Laemmli's sample buffer containing NP-his separated on a 4-15% gel. Afterincubation with 100 ml of fixation buffer (50% methanol, 10% acetic acid) for 30 minutes, soaking with Amplifer™ (Amersham) for 30 minutes, and drying for 120 minutes, the gel was exposed to Hyperfilm™ MP film (Amersham) at minus 75° C.for one week. Protein expression was detected with a Silver StainPlus kit (BioRad) on 20 μl of the same eluted sample was separated with 5-15% SDS-PAGE.

3×106 293T cells were transfected with 10 μg of pVR1012-NP in 100 mm dishes (FIG. 4B). Three days later, the cells were lifted from plates by resuspending with PBS, then pelleted in an Eppendorf tube by centrifugation at 3000 rpm. The cells were extracted in 1 ml of RIPA buffer. Fifty μl of cell lysates were mixed with H2O and 2× binding buffer and adjusted to final 1× binding buffer (50 mM Tris-HCl, 150 mM NaCl, 1 mM MgCl2, 1 mM MnCl2, and 1 mMCaCl2). Digoxigenin-labeled lectins (Roche Molecular Biochemicals) used for each reaction: GNA 25 μg, SNA 25 μg, DSA 25 μg, MAA 125 μg, PNA 250 μg. After 1 hour incubated at room temperature with agitation, Anti-Digoxigenin magneticparticles (Roche Molecular Biochemicals) were washed three times with 1× binding buffer and 30 μl was added to each reaction. After another one hour incubation, the particles were washed four times with 1× binding buffer, and recoveredin 60 μl of Laemmli's sample buffer by heating at 100° C. for 5 minutes. Twenty five μl were separated with a 4-15% SDS-PAGE gel, and analyzed by Western blot with a mouse polyclonal anti-NP.

Synthetic Glycoside Analogues

Several potential inhibitors of the NP/VP35 interaction were tested for their ability to inhibit the synthesis of NP or the association of NP with VP35 and VP24. The inhibitor compounds under investigation are a variety of synthetic mono- anddisaccharides. Manα1-O-octyl (Manα1-OC8), acetylated Manα1-O-octyl (AcManα1-OC8) and acetylated Manα1-3Manα-O-methyl (AcMan1-3Manα1-OMe) were prepared according to published procedures (Oscarson, S.and Tiden, A. K. 1993 Carbohydr Res 247:323-328; Brown, J. R. et al. 1997 Glycobiology 7:549-558). Acetylated Manα1-6Manα-O-dec-9-enyl (AcMan1-6Manα1-OC10) was synthesized as described by Nikolaev and co-workers for thecorresponding dec-9-enyl synthetic oligomer (Nikolaev, A. V. et al. 1995 J Chem Soc Perkin Trans 1:1977-1987.). Acetylated Galβ1-4GlcNAcβ-O-naphthalemethanol (AcGalβ1-4GlcNAcβ1-NM) was prepared according to published procedures(Sarkar, A. K. et al. 2000 Carbohydr Res 329:287-300). Per-O-acetylation is achieved with acetic anhydride and pyridine. All reaction products were analyzed by analytical thin-layer chromatography and Silica Gel 60254 (E. Merck) plates anddetection by charring by UV light or by charring with 5% (v/v) sulfuric acid in ethanol. Column chromatography was performed on Silica Gel 60254 (Aldrich). All synthetic compounds that were subjected to biological testing gave electrospray massspectra consistent with their proposed structures (Brown, J. R. et al. 2001 Bioorg Med Chem 9:815-824; Brown, J. R. et al. 1997 Glycobiology 7:549-558; Sarkar, A. K. et al. 2000 Carbohydr Res 329:287-300. These synthetic glycosides were added to theradiolabeled in vitro transcription/translation reaction prior to translation at 0.5, 1.0, or 2.0 mM concentrations and analyzed by SDS-PAGE or by co-immunoprecipitation with an antiserum to VP35 as described above.

Additional compounds tested in this system without any effect included benzyl 2-acetamido-2-deoxy-a-D-galactopyranoside, benzyl 2-acetamido-2-deoxy-3-O-b-D-galactopyranosyl-a-D-galactopyranoside, phenyl N-acetyl-a-D-galactosaminide, benzylZ-a-D-glucosaminide, benzyl Z-b-D-glucosaminide, benzyl 2-acetamido-2-deoxy-b-D-glucopyranoside (Sigma, St. Louis, Mo.); and Brefeldin A (Calbiochem, San Diego, Calif.).

While the present invention has been described in some detail for purposes of clarity and understanding, one skilled in the art will appreciate that various changes in form and detail can be made without departing from the true scope of theinvention. All figures, tables, and appendices, as well as patents, applications, and publications, referred to above, are hereby incorporated by reference.

>

29 A Artificial Sequence synthetic primer tccagatcgatccga gtatggatca tatcctacaa aagaca 46 2 43 DNA Artificial Sequence synthetic primer 2 caaaacagta cttgatgatc tagacgagga cgacgaggac act 43 3 48 DNA Artificial Sequence synthetic primer 3 cttggtccta ttcgatctaa attcatggca atcctgcaac atcatcag 48 4 24 DNAArtificial Sequence synthetic primer 4 cggatccaga tcgatccgag tatg 24 5 32 DNA Artificial Sequence synthetic primer 5 gaagggcccc tgatgatgtt gcaggattgc ca 32 6 384 PRT Ebola virus P 6 Met Asp Ser Arg Pro Gln Lys Ile Trp Met Ala Pro Ser Leu Thr Glu Asp Met Asp Tyr His Lys Ile Leu Thr Ala Gly Leu Ser Val Gln 2 Gln Gly Ile Val Arg Gln Arg Val Ile Pro Val Tyr Gln Val Asn Asn 35 4u Glu Glu Ile Cys Gln Leu Ile Ile Gln Ala Phe Glu Ala Gly Val 5 Asp Phe Gln Glu Ser Ala Asp SerPhe Leu Leu Met Leu Cys Leu His 65 7 His Ala Tyr Gln Gly Asp Tyr Lys Leu Phe Leu Glu Ser Gly Ala Val 85 9s Tyr Leu Glu Gly His Gly Phe Arg Phe Glu Val Lys Lys Arg Asp Val Lys Arg Leu Glu Glu Leu Leu Pro Ala Val Ser Ser GlyLys Ile Lys Arg Thr Leu Ala Ala Met Pro Glu Glu Glu Thr Thr Glu Asn Ala Gly Gln Phe Leu Ser Phe Ala Ser Leu Phe Leu Pro Lys Leu Val Val Gly Glu Lys Ala Cys Leu Glu Lys Val Gln Arg Gln Ile Val His Ala Glu Gln Gly Leu Ile Gln Tyr Pro Thr Ala Trp Gln Val Gly His Met Met Val Ile Phe Arg Leu Met Arg Thr Asn Phe 2Ile Lys Phe Leu Leu Ile His Gln Gly Met His Met Val Ala Gly 222sp Ala Asn Asp Ala ValIle Ser Asn Ser Val Ala Gln Ala Arg 225 234er Gly Leu Leu Ile Val Lys Thr Val Leu Asp His Ile Leu Gln 245 25ys Thr Glu Arg Gly Val Arg Leu His Pro Leu Ala Arg Thr Ala Lys 267ys Asn Glu Val Asn Ser Phe Lys Ala Ala LeuSer Ser Leu Ala 275 28ys His Gly Glu Tyr Ala Pro Phe Ala Arg Leu Leu Asn Leu Ser Gly 29Asn Asn Leu Glu His Gly Leu Phe Pro Gln Leu Ser Ala Ile Ala 33Leu Gly Val Ala Thr Ala His Gly Ser Thr Leu Ala Gly Val Asn Val 32533ly Glu Gln Tyr Gln Gln Leu Arg Glu Ala Ala Thr Glu Ala Glu Lys 345eu Gln Gln Tyr Ala Glu Ser Arg Glu Leu Asp His Leu Gly Leu 355 36sp Asp Gln Glu Lys Lys Ile Leu Met Asn Phe His Gln Lys Lys Asn 378 PRT Ebolavirus B 7 Met Asp Arg Gly Thr Arg Arg Ile Trp Val Ser Gln Asn Gln Gly Asp Asp Leu Asp Tyr His Lys Ile Leu Thr Ala Gly Leu Thr Val Gln 2 Gln Gly Ile Val Arg Gln Lys Ile Ile Ser Val Tyr Leu Val Asp Asn 35 4u Glu Ala Met Cys GlnLeu Val Ile Gln Ala Phe Glu Ala Gly Ile 5 Asp Phe Gln Glu Asn Ala Asp Ser Phe Leu Leu Met Leu Cys Leu His 65 7 His Ala Tyr Gln Gly Asp Tyr Lys Leu Phe Leu Glu Ser Asn Ala Val 85 9n Tyr Leu Glu Gly His Gly Phe Lys Phe Glu Leu Arg LysLys Asp Val Asn Arg Leu Glu Glu Leu Leu Pro Ala Ala Thr Ser Gly Lys Ile Arg Arg Thr Leu Ala Ala Leu Pro Glu Glu Glu Thr Thr Glu Asn Ala Gly Gln Phe Leu Ser Phe Ala Ser Leu Phe Leu Pro Lys Leu Val Val Gly Glu Lys Ala Cys Leu Glu Lys Val Gln Arg Gln Ile Val His Ala Glu Gln Gly Leu Ile Gln Tyr Pro Thr Ala Trp Gln Val Gly His Met Met Val Ile Phe Arg Leu Met Arg Thr Asn Phe 2Ile Lys Tyr Leu LeuIle His Gln Gly Met His Met Val Ala Gly 222sp Ala Asn Asp Ala Val Ile Ala Asn Ser Val Ala Gln Ala Arg 225 234er Gly Leu Leu Ile Val Lys Thr Val Leu Asp His Ile Leu Gln 245 25ys Thr Asp Gln Gly Val Arg Leu His Pro LeuAla Arg Thr Ala Lys 267rg Asn Glu Val Asn Ala Phe Lys Ala Ala Leu Ser Ser Leu Ala 275 28ys His Gly Glu Tyr Ala Pro Phe Ala Arg Leu Leu Asn Leu Ser Gly 29Asn Asn Leu Glu His Gly Leu Tyr Pro Gln Leu Ser Ala Ile Ala 33Leu Gly Val Ala Thr Ala His Gly Ser Thr Leu Ala Gly Val Asn Val 325 33ly Glu Gln Tyr Gln Gln Leu Arg Glu Ala Ala Thr Glu Ala Glu Lys 345eu Gln Gln Tyr Ala Glu Ser Arg Glu Leu Asp Ser Leu Gly Leu 355 36sp Asp GlnGlu Arg Arg Ile Leu Met Asn Phe His Gln Lys Lys Asn 378 PRT Ebola virs G 8 Met Asp Ser Arg Pro Gln Lys Val Trp Met Thr Pro Ser Leu Thr Glu Asp Met Asp Tyr His Lys Ile Leu Thr Ala Gly Leu Ser Val Gln 2 Gln Gly Ile ValArg Gln Arg Val Ile Pro Val Tyr Gln Val Asn Asn 35 4u Glu Glu Ile Cys Gln Leu Ile Ile Gln Ala Phe Glu Ala Gly Val 5 Asp Phe Gln Glu Ser Ala Asp Ser Phe Leu Leu Met Leu Cys Leu His 65 7 His Ala Tyr Gln Gly Asp Tyr Lys Leu Phe Leu GluSer Gly Ala Val 85 9s Tyr Leu Glu Gly His Gly Phe Arg Phe Glu Val Lys Lys Arg Asp Val Lys Arg Leu Glu Glu Leu Leu Pro Ala Val Ser Ser Gly Lys Ile Lys Arg Thr Leu Ala Ala Met Pro Glu Glu Glu Thr Thr Glu Asn Ala Gly Gln Phe Leu Ser Phe Ala Ser Leu Phe Leu Pro Lys Leu Val Val Gly Glu Lys Ala Cys Leu Arg Lys Val Gln Arg Gln Ile Val His Ala Glu Gln Gly Leu Ile Gln Tyr Pro Thr Ala Trp Gln Val Gly His MetMet Val Ile Phe Arg Leu Met Arg Thr Asn Phe 2Ile Lys Phe Leu Leu Ile His Gln Gly Met His Met Val Ala Gly 222sp Ala Asn Asp Ala Val Ile Ser Asn Ser Val Ala Gln Ala Arg 225 234er Gly Leu Leu Ile Val Lys Thr ValLeu Asp His Ile Leu Gln 245 25ys Thr Gln Arg Gly Val Arg Leu His Pro Leu Ala Arg Thr Ala Lys 267ys Asn Glu Val Asn Ser Leu Lys Ala Ala Leu Ser Ser Leu Ala 275 28ys His Gly Glu Tyr Ala Pro Phe Ala Arg Leu Leu Asn Leu Ser Gly29Asn Asn Leu Glu His Gly Leu Phe Pro Gln Leu Ser Ala Ile Ala 33Leu Gly Val Ala Thr Ala His Gly Ser Thr Leu Ala Gly Val Asn Val 325 33ly Glu Gln Tyr Gln Gln Leu Arg Glu Ala Ala Thr Glu Ala Glu Lys 345euGln Gln Tyr Ala Glu Ser Arg Glu Leu Asp His Leu Gly Leu 355 36sp Asp Gln Glu Lys Lys Ile Leu Met Asn Phe His Gln Lys Lys Asn 378 PRT Ebola virus M 9 Met Asp Ser Arg Pro Gln Lys Ile Trp Met Ala Pro Ser Leu Thr Glu AspMet Asp Tyr His Lys Ile Leu Thr Ala Gly Leu Ser Val Gln 2 Gln Gly Ile Val Arg Gln Arg Val Ile Pro Val Tyr Gln Val Asn Asn 35 4u Glu Glu Ile Cys Gln Leu Ile Ile Gln Ala Phe Glu Ala Gly Val 5 Asp Phe Gln Glu Ser Ala Asp Ser Phe Leu LeuMet Leu Cys Leu His 65 7 His Ala Tyr Gln Gly Asp Tyr Lys Leu Phe Leu Glu Ser Gly Ala Val 85 9s Tyr Leu Glu Gly His Gly Phe Arg Phe Glu Val Lys Lys Arg Asp Val Lys Arg Leu Glu Glu Leu Leu Pro Ala Val Ser Ser Gly Lys Ile Lys Arg Thr Leu Ala Ala Met Pro Glu Glu Glu Thr Thr Glu Asn Ala Gly Gln Phe Leu Ser Phe Ala Ser Leu Phe Leu Pro Lys Leu Val Val Gly Glu Lys Ala Cys Leu Arg Lys Val Gln Arg Gln Ile Val His AlaGlu Gln Gly Leu Ile Gln Tyr Pro Thr Ala Trp Gln Val Gly His Met Met Val Ile Phe Arg Leu Met Arg Thr Asn Phe 2Ile Lys Phe Leu Leu Ile His Gln Gly Met His Met Val Ala Gly 222sp Ala Asn Asp Ala Val Ile Ser AsnSer Val Ala Gln Ala Arg 225 234er Gly Leu Leu Ile Val Lys Thr Val Leu Asp His Ile Leu Gln 245 25ys Thr Glu Arg Gly Val Arg Leu His Pro Leu Ala Arg Thr Ala Lys 267ys Asn Glu Val Asn Ser Leu Lys Ala Ala Leu Ser Ser LeuAla 275 28ys His Gly Glu Tyr Ala Pro Phe Ala Arg Leu Leu Asn Leu Ser Gly 29Asn Asn Leu Glu His Gly Leu Phe Pro Gln Leu Ser Ala Ile Ala 33Leu Gly Val Ala Thr Ala His Gly Ser Thr Leu Ala Gly Val Asn Val 325 33lyGlu Gln Tyr Gln Gln Leu Arg Glu Ala Ala Thr Glu Ala Glu Lys 345eu Gln Gln Tyr Ala Glu Ser Arg Glu Leu Asp His Leu Gly Leu 355 36sp Asp Gln Glu Lys Lys Ile Leu Met Asn Phe His Gln Lys Lys Asn 3784 PRT Ebola virus Z Asp Ser Arg Pro Gln Lys Val Trp Met Thr Pro Ser Leu Thr Glu Asp Met Asp Tyr His Lys Ile Leu Thr Ala Gly Leu Ser Val Gln 2 Gln Gly Ile Val Arg Gln Arg Val Ile Pro Val Tyr Gln Val Asn Asn 35 4u Glu Glu Ile Cys Gln Leu IleIle Gln Ala Phe Glu Ala Gly Val 5 Asp Phe Gln Glu Ser Ala Asp Ser Phe Leu Leu Met Leu Cys Leu His 65 7 His Ala Tyr Gln Gly Asp Tyr Lys Leu Phe Leu Glu Ser Gly Ala Val 85 9s Tyr Leu Glu Gly His Gly Phe Arg Phe Glu Val Lys Lys Arg Asp Val Lys Arg Leu Glu Glu Leu Leu Pro Ala Val Ser Ser Gly Lys Ile Lys Arg Thr Leu Ala Ala Met Pro Glu Glu Glu Thr Thr Glu Asn Ala Gly Gln Phe Leu Ser Phe Ala Ser Leu Phe Leu Pro Lys Leu ValVal Gly Glu Lys Ala Cys Leu Glu Lys Val Gln Arg Gln Ile Val His Ala Glu Gln Gly Leu Ile Gln Tyr Pro Thr Ala Trp Gln Val Gly His Met Met Val Ile Phe Arg Leu Met Arg Thr Asn Phe 2Ile Lys Phe Leu Leu Ile HisGln Gly Met His Met Val Ala Gly 222sp Ala Asn Asp Ala Val Ile Ser Asn Ser Val Ala Gln Ala Arg 225 234er Gly Leu Leu Ile Val Lys Thr Val Leu Asp His Ile Leu Gln 245 25ys Thr Glu Arg Gly Val Arg Leu His Pro Leu Ala ArgThr Ala Lys 267ys Asn Glu Val Asn Ser Phe Lys Ala Ala Leu Ser Ser Leu Ala 275 28ys His Gly Glu Tyr Ala Pro Phe Ala Arg Leu Leu Asn Leu Ser Gly 29Asn Asn Leu Glu His Gly Leu Phe Pro Gln Leu Ser Ala Ile Ala 33Leu Gly Val Ala Thr Ala His Gly Ser Thr Leu Ala Gly Val Asn Val 325 33ly Glu Gln Tyr Gln Gln Leu Arg Glu Ala Ala Thr Glu Ala Glu Lys 345eu Gln Gln Tyr Ala Glu Ser Arg Glu Leu Asp His Leu Gly Leu 355 36sp Asp Gln Glu LysLys Ile Leu Met Asn Phe His Gln Lys Lys Asn 3786 PRT MBV-V Asp Leu His Ser Leu Leu Glu Leu Gly Thr Lys Pro Thr Ala Pro Val Arg Asn Lys Lys Val Ile Leu Phe Asp Thr Asn His Gln Val 2 Ser Ile Cys Asn Gln Ile Ile AspAla Ile Asn Ser Gly Ile Asp Leu 35 4y Asp Leu Leu Glu Gly Gly Leu Leu Thr Leu Cys Val Glu His Tyr 5 Tyr Asn Ser Asp Lys Asp Lys Phe Asn Thr Ser Pro Val Ala Lys Tyr 65 7 Leu Arg Asp Ala Gly Tyr Glu Phe Asp Val Ile Lys Asn Ala Asp Ala85 9r Arg Phe Leu Asp Val Ser Pro Asn Glu Pro His Tyr Ser Pro Leu Leu Ala Leu Lys Thr Leu Glu Ser Thr Glu Ser Gln Arg Gly Arg Gly Leu Phe Leu Ser Phe Cys Ser Leu Phe Leu Pro Lys Leu Val Gly Asp ArgAla Ser Ile Glu Lys Ala Leu Arg Gln Val Thr Val His Gln Glu Gln Gly Ile Val Thr Tyr Pro Asn His Trp Leu Thr Thr His Met Lys Val Ile Phe Gly Ile Leu Arg Ser Ser Phe Ile Leu Phe Val Leu Ile His Gln Gly ValAsn Leu Val Thr Gly His Asp 2Tyr Asp Ser Ile Ile Ser Asn Ser Val Gly Gln Thr Arg Phe Ser 222eu Leu Ile Val Lys Thr Val Leu Glu Phe Ile Leu Gln Lys Thr 225 234er Gly Val Thr Leu His Pro Leu Val Arg Thr Ser LysVal Lys 245 25sn Glu Val Ala Ser Phe Lys Gln Ala Leu Ser Asn Leu Ala Arg His 267lu Tyr Ala Pro Phe Ala Arg Val Leu Asn Leu Ser Gly Ile Asn 275 28sn Leu Glu His Gly Leu Tyr Pro Gln Leu Ser Ala Ile Ala Leu Gly 29Ala Thr Ala His Gly Ser Thr Leu Ala Gly Val Asn Val Gly Glu 33Gln Tyr Gln Gln Leu Arg Glu Ala Ala His Asp Ala Glu Val Lys Leu 325 33ln Arg Arg His Glu His Gln Glu Ile Gln Ala Ile Ala Glu Asp Asp 345lu Arg Lys Ile LeuGlu Gln Phe His Leu Gln Lys Thr 355 362 366 PRT MBV-P Asp Leu His Ser Leu Leu Glu Leu Gly Thr Lys Pro Thr Ala Pro Val Arg Asn Lys Lys Val Ile Leu Phe Asp Thr Asn His Gln Val 2 Ser Ile Cys Asn Gln Ile Ile Asp Ala Ile AsnSer Gly Ile Asp Leu 35 4y Asp Leu Leu Glu Gly Gly Leu Leu Thr Leu Cys Val Glu His Tyr 5 Tyr Asn Ser Asp Lys

Asp Lys Phe Asn Thr Ser Pro Val Ala Lys Tyr 65 7 Leu Arg Asp Ala Gly Tyr Glu Phe Asp Val Ile Lys Asn Ala Asp Ala 85 9r Arg Phe Leu Asp Val Ser Pro Asn Glu Pro His Tyr Ser Pro Leu Leu Ala Leu Lys Thr Leu Glu Ser ThrGlu Ser Gln Arg Gly Arg Gly Leu Phe Leu Ser Phe Cys Ser Leu Phe Leu Pro Lys Leu Val Gly Asp Arg Ala Ser Ile Glu Lys Ala Leu Arg Gln Val Thr Val His Gln Glu Gln Gly Ile Val Thr Tyr Pro Asn His Trp Leu ThrThr His Met Lys Val Ile Phe Gly Ile Leu Arg Ser Ser Phe Ile Leu Phe Val Leu Ile His Gln Gly Val Asn Leu Val Thr Gly His Asp 2Tyr Asp Ser Ile Ile Ser Asn Ser Val Gly Gln Thr Arg Phe Ser 222euLeu Ile Val Lys Thr Val Leu Glu Phe Ile Leu Gln Lys Thr 225 234er Gly Val Thr Leu His Pro Leu Val Arg Thr Ser Lys Val Lys 245 25sn Glu Val Ala Ser Phe Lys Gln Ala Leu Ser Asn Leu Ala Arg His 267lu Tyr Ala Pro Phe AlaArg Val Leu Asn Leu Ser Gly Ile Asn 275 28sn Leu Glu His Gly Leu Tyr Pro Gln Leu Ser Ala Ile Ala Leu Gly 29Ala Thr Ala His Gly Ser Thr Leu Ala Gly Val Asn Val Gly Glu 33Gln Tyr Gln Gln Leu Arg Glu Ala Ala His Asp AlaGlu Val Lys Leu 325 33ln Arg Arg His Glu His Gln Glu Ile Gln Ala Ile Ala Glu Asp Asp 345lu Arg Lys Ile Leu Glu Gln Phe His Leu Gln Lys Thr 355 363 366 PRT MBV-O Asp Leu His Ser Leu Leu Glu Leu Gly Thr Lys Pro Thr AlaPro Val Arg Asn Lys Lys Val Ile Leu Phe Asp Thr Asn His Gln Val 2 Ser Ile Cys Asn Gln Ile Ile Asp Ala Ile Asn Ser Gly Ile Asp Leu 35 4y Asp Leu Leu Glu Gly Gly Leu Leu Thr Leu Cys Val Glu His Tyr 5 Tyr Asn Ser Asp LysAsp Lys Phe Asn Thr Ser Pro Ile Ala Lys Tyr 65 7 Leu Arg Asp Ala Gly Tyr Glu Phe Asp Val Val Lys Asn Ala Asp Ala 85 9r Arg Phe Leu Asp Val Ile Pro Asn Glu Pro His Tyr Ser Pro Leu Leu Ala Leu Lys Thr Leu Glu Ser Thr Glu SerGln Arg Gly Arg Gly Leu Phe Leu Ser Phe Cys Ser Leu Phe Leu Pro Lys Leu Val Gly Asp Arg Ala Ser Ile Glu Lys Ala Leu Arg Gln Val Thr Val His Gln Glu Gln Gly Ile Val Thr Tyr Pro Asn His Trp Leu Thr Thr His Met Lys Val Ile Phe Gly Ile Leu Arg Ser Ser Phe Ile Leu Phe Val Leu Ile His Gln Gly Val Asn Leu Val Thr Gly His Asp 2Tyr Asp Ser Ile Ile Ser Asn Ser Val Gly Gln Thr Arg Phe Ser 222eu Leu IleVal Lys Thr Val Leu Glu Phe Ile Leu Gln Lys Thr 225 234er Gly Val Thr Leu His Pro Leu Val Arg Thr Ser Lys Val Lys 245 25sn Glu Val Ala Ser Phe Lys Gln Ala Leu Ser Asn Leu Ala Arg His 267lu Tyr Ala Pro Phe Ala Arg ValLeu Asn Leu Ser Gly Ile Asn 275 28sn Leu Glu His Gly Leu Tyr Pro Gln Leu Ser Ala Ile Ala Leu Gly 29Ala Thr Ala His Gly Ser Thr Leu Ala Gly Val Asn Val Gly Glu 33Gln Tyr Gln Gln Leu Arg Glu Ala Ala His Asp Ala Glu IleLys Leu 325 33ln Arg Arg His Glu His Gln Glu Ile Gln Ala Ile Ala Glu Asp Asp 345lu Arg Lys Ile Leu Glu Gln Phe His Leu Gln Lys Thr 355 364 384 PRT Artificial Sequence Consensus sequence Asp Ser Arg Pro Gln Lys Ile TrpMet Xaa Pro Ser Leu Thr Glu Asp Met Asp Tyr His Lys Ile Leu Thr Ala Gly Leu Ser Val Gln 2 Gln Gly Ile Val Arg Gln Lys Val Ile Pro Val Tyr Gln Val Asn Asn 35 4u Glu Glu Ile Cys Gln Leu Ile Ile Gln Ala Phe Glu Ala Gly Ile 5 Asp Phe Gln Glu Ser Ala Asp Ser Phe Leu Leu Met Leu Cys Leu His 65 7 His Ala Tyr Gln Gly Asp Tyr Lys Leu Phe Leu Glu Ser Gly Ala Val 85 9s Tyr Leu Glu Gly His Gly Phe Arg Phe Glu Val Lys Lys Arg Asp Val Lys Arg Leu GluGlu Leu Leu Pro Ala Val Ser Ser Gly Lys Ile Lys Arg Thr Leu Ala Ala Leu Pro Glu Glu Glu Thr Thr Glu Asn Ala Gly Gln Phe Leu Ser Phe Ala Ser Leu Phe Leu Pro Lys Leu Val Val Gly Glu Lys Ala Cys Leu Glu LysVal Gln Arg Gln Ile Val His Ala Glu Gln Gly Leu Ile Gln Tyr Pro Thr Ala Trp Gln Val Gly His Met Met Val Ile Phe Arg Leu Met Arg Thr Asn Phe 2Ile Lys Phe Leu Leu Ile His Gln Gly Met His Met Val Ala Gly 222sp Ala Asn Asp Ala Val Ile Ser Asn Ser Val Ala Gln Ala Arg 225 234er Gly Leu Leu Ile Val Lys Thr Val Leu Asp His Ile Leu Gln 245 25ys Thr Asp Arg Gly Val Arg Leu His Pro Leu Ala Arg Thr Ala Lys 267ys AsnGlu Val Asn Ser Phe Lys Ala Ala Leu Ser Ser Leu Ala 275 28ys His Gly Glu Tyr Ala Pro Phe Ala Arg Leu Leu Asn Leu Ser Gly 29Asn Asn Leu Glu His Gly Leu Phe Pro Gln Leu Ser Ala Ile Ala 33Leu Gly Val Ala Thr Ala His GlySer Thr Leu Ala Gly Val Asn Val 325 33ly Glu Gln Tyr Gln Gln Leu Arg Glu Ala Ala Thr Glu Ala Glu Lys 345eu Gln Gln Tyr Ala Glu Ser Arg Glu Leu Asp His Leu Gly Leu 355 36sp Asp Gln Glu Lys Lys Ile Leu Met Asn Phe His Gln LysLys Asn 3785 PRT C-Distemper virus VARIANT (75) Xaa = Any Amino Acid Lys Arg Thr Arg Asp Gln Pro Pro Leu Ala Ser Gly Ser Gly Gly Ile Arg Gly Ile Lys His Val Ile Ile Val Leu Ile Pro Gly Asp 2 Ser Ser IleVal Thr Arg Ser Arg Leu Leu Asp Arg Leu Val Arg Leu 35 4l Gly Asp Pro Lys Ile Asn Gly Pro Lys Leu Thr Gly Ile Leu Ile 5 Ser Ile Leu Ser Leu Phe Val Glu Ser Pro Gly Gln Leu Ile Gln Arg 65 7 Ile Ile Asp Xaa Pro Asp Val Ser Ile Lys LeuVal Glu Val Ile Pro 85 9r Ile Asn Ser Val Cys Gly Leu Thr Phe Ala Ser Arg Gly Ala Ser Asp Ser Glu Ala Asp Glu Phe Phe Lys Ile Val Asp Glu Gly Ser Ala Gln Gly Gln Leu Gly Trp Leu Glu Asn Lys Glu Gln Phe Asn Leu Leu Ala Ser Ile Leu Ala Gln Ile Trp Ile Leu Leu Ala Lys Ala Val Thr Ala Pro Asp Thr Ala Ala Asp Ser Glu Met Arg Arg Trp Lys Tyr Thr Gln Gln Gly Glu Phe Arg Met Asn Lys Ile Trp Leu Ile Val ArgAsn Arg Ile Ala Glu Asp Leu Ser Leu Arg Arg Phe 2Val Ala Leu Ile Leu Asp Ile Lys Ser Pro Gly Asn Lys Pro Arg 222la Glu Met Ile Cys Asp Ile Asp Asn Tyr Ile Val Glu Ala Gly 225 234la Ser Phe Ile Leu Thr Ile LysPhe Gly Ile Glu Thr Met Tyr 245 25ro Ala Leu Gly Leu His Glu Phe Ser Gly Glu Leu Thr Thr Ile Glu 267eu Met Met Leu Tyr Gln Gln Met Gly Glu Thr Ala Pro Tyr Met 275 28al Ile Leu Glu Asn Ser Val Gln Asn Lys Phe Ser Ala Gly SerTyr 29Leu Leu Trp Ser Tyr Ala Met Gly Val Gly Val Glu Leu Glu Asn 33Ser Met Gly Gly Leu Asn Phe Glu Ser Ser Tyr Phe Asp Pro Ala Tyr 325 33he Arg Leu Gly Gln Glu Met Val Arg Arg Ser Ala Gly Lys Val Ser 345la Ala Glu Leu Gly Ile Thr Lys Glu Glu Ala Gln Leu Val Ser 355 36lu Ile Ala Ser Lys Thr Thr 376 376 PRT Measles virus Lys Arg Asn Lys Asp Lys Pro Pro Ile Thr Ser Gly Ser Gly Gly Ile Arg Gly Ile Lys Met Ile Ile Ile ValPro Ile Pro Gly Asp 2 Ser Ser Ile Thr Thr Arg Ser Arg Leu Leu Asp Arg Leu Val Arg Leu 35 4e Gly Asn Pro Asp Val Ser Gly Pro Lys Leu Thr Gly Ala Leu Ile 5 Gly Ile Leu Ser Leu Phe Val Glu Ser Pro Gly Gln Leu Ile Gln Arg 65 7 IleThr Asp Asp Pro Asp Val Ser Ile Arg Leu Leu Glu Val Val Gln 85 9r Asp Gln Ser Gln Ser Gly Leu Thr Phe Ala Ser Arg Gly Thr Asn Glu Asp Glu Ala Asp Gln Tyr Phe Ser His Asp Asp Pro Ile Ser Asp Gln Ser Arg Phe Gly TrpPhe Glu Asn Lys Glu Gly Phe Asn Ile Leu Gly Thr Ile Leu Ala Gln Ile Trp Val Leu Val Ala Lys Ala Val Thr Ala Pro Asp Thr Ala Ala Asp Ser Glu Leu Arg Arg Trp Lys Tyr Thr Gln Gln Gly Glu Phe Arg Leu Glu ArgLys Trp Leu Val Val Arg Asn Arg Ile Ala Glu Asp Leu Ser Leu Arg Arg Phe 2Val Ala Leu Ile Leu Asp Ile Lys Arg Thr Pro Gly Asn Lys Pro 222le Ala Glu Met Ile Cys Asn Ile Asp Thr Tyr Ile Val Glu Ala 225 234eu Ala Ser Phe Ile Leu Thr Ile Lys Phe Gly Ile Glu Thr Met 245 25yr Pro Ala Leu Gly Leu Asn Glu Phe Asp Gly Glu Leu Ser Thr Leu 267er Leu Met Asn Leu Tyr Gln Gln Met Gly Glu Thr Ala Pro Tyr 275 28et Val Ile Leu GluAsn Ser Ile Gln Asn Lys Phe Ser Ala Gly Ser 29Pro Leu Leu Trp Ser Tyr Ala Met Gly Val Gly Val Glu Leu Glu 33Asn Ser Met Gly Gly Leu Asn Phe Gly Arg Ser Tyr Phe Asp Pro Ala 325 33yr Phe Arg Leu Gly Gln Glu Met Val ArgArg Ser Ala Gly Lys Val 345er Ala Ser Glu Leu Gly Ile Thr Ala Glu Asp Ala Arg Leu Val 355 36er Glu Ile Ala Met His Thr Thr 377 376 PRT Rinderpest Lys Lys Asn Lys Asp Lys Pro Pro Leu Ala Ala Gly Ser Gly Gly Ile Arg Gly Ile Lys His Val Ile Ile Val Pro Ile Pro Gly Asp 2 Ser Ser Ile Thr Thr Arg Ser Arg Leu Leu Asp Cys Leu Val Lys Met 35 4l Gly Asp Pro Asp Ile Ser Gly Pro Lys Leu Thr Gly Ala Leu Ile 5 Ser Ile Leu Ser Leu Phe Val Glu Ser ProGly Gln Leu Ile Gln Arg 65 7 Ile Thr Asp Asp Pro Asp Ile Ser Ile Lys Leu Val Glu Val Ile Gln 85 9r Asp Lys Thr Gln Ser Gly Leu Thr Phe Ala Ser Arg Gly Ala Ser Asp Asp Glu Ala Gln Arg Tyr Phe Thr Tyr Asp Glu Pro Asn Gly Glu Glu Arg Gln Ser Tyr Trp Phe Glu Asn Arg Glu Gly Phe Asn Ile Leu Ala Thr Ile Leu Ala Gln Ile Trp Ile Leu Leu Ala Lys Ala Val Thr Thr Pro Asp Thr Ala Ala Asp Ser Glu Leu Arg Arg Trp Lys TyrThr Gln Gln Gly Glu Phe Arg Leu Asp Lys Gly Trp Leu Thr Val Arg Asn Arg Ile Ala Glu Asp Leu Ser Leu Arg Arg Phe 2Val Ala Leu Ile Leu Asp Ile Lys Arg Thr Pro Gly Asn Lys Pro 222le Ala Glu Met Ile Cys Asp IleAsp Thr Tyr Ile Val Glu Ala 225 234eu Ala Ser Phe Ile Leu Thr Ile Lys Phe Gly Ile Glu Thr Met 245 25yr Pro Ala Leu Gly Leu His Glu Phe Ala Gly Glu Leu Ser Thr Ile 267er Leu Met Asn Leu Tyr Gln Gln Met Gly Glu Leu AlaPro Tyr 275 28et Val Ile Leu Glu Asn Ser Ile Gln Asn Lys Phe Ser Ala Gly Ala 29Pro Leu Leu Trp Ser Tyr Ala Met Gly Val Gly Val Glu Leu Glu 33Ser Ser Met Gly Gly Leu Asn Phe Gly Arg Ser Tyr Phe Asp Pro Ala 325 33yr Phe Arg Leu Gly Gln Glu Met Val Arg Arg Ser Ala Gly Lys Val 345er Ala Ser Glu Leu Gly Ile Thr Glu Glu Glu Ala Lys Leu Val 355 36er Glu Ile Ala Ala Tyr Thr Gly 378 376 PRT Artificial Sequence Consensus sequence AspXaa Xaa Xaa Xaa Lys Ile Trp Met Xaa Xaa Xaa Xaa Xaa Glu Asp Met Asp Tyr His Lys Ile Leu Thr Ala Gly Leu Ser Val Gln 2 Gln Gly Ile Val Arg Gln Lys Val Ile Ile Val Tyr Xaa Val Asn Asn 35 4u Glu Glu Ile Cys Gln Leu Ile Ile GlnAla Phe Glu Ala Gly Ile 5 Asp Phe Gln Glu Leu Ala Asp Ser Phe Leu Leu Met Leu Cys Leu His 65 7 His Gln Tyr Gln Gly Asp Tyr Lys Leu Phe Leu Glu Ser Xaa Ala Val 85 9s Tyr Leu Glu Gly His Gly Phe Arg Phe Glu Val Lys Lys Arg Asp Val Xaa Arg Leu Glu Glu Leu Leu Pro Ala Val Ser Ser Gly Lys Ile Lys Arg Thr Leu Ala Ala Leu Pro Glu Glu Glu Thr Thr Glu Asn Ala Gly Gln Phe Leu Ser Phe Ala Ser Leu Phe Leu Pro Lys Leu Val Val GlyGlu Lys Ala Cys Leu Glu Lys Val Gln Arg Gln Ile Val His Ala Glu Gln Gly Leu Ile Gln Tyr Pro Thr Ala Trp Gln Val Gly His Met Met Val Ile Phe Arg Leu Met Arg Thr Asn Phe 2Ile Lys Phe Leu Leu Ile His Gln AspAla Asn Asp Ala Val Ile 222sn Ser Val Ala Gln Ala Arg Phe Ser Gly Leu Leu Ile Val Lys 225 23BR>
24al Leu Asp His Ile Leu Gln Lys Thr Asp Xaa Gly Val Thr Leu 245 25is Pro Leu Ala Arg Thr Ala Lys Val Lys Asn Glu Val Asn Ser Phe 267la Ala Leu Ser Ser Leu Ala Lys His Gly Glu Tyr Ala Pro Phe 275 28la Arg LeuLeu Asn Leu Ser Gly Val Asn Asn Leu Glu His Gly Leu 29Pro Gln Leu Ser Ala Ile Ala Leu Gly Val Ala Thr Ala His Gly 33Ser Thr Leu Ala Gly Val Asn Val Gly Glu Gln Tyr Gln Gln Leu Arg 325 33lu Ala Ala Thr Glu Ala Glu LysGln Leu Gln Gln Tyr Ala Glu Ser 345lu Leu Asp Xaa Leu Gly Leu Asp Asp Gln Glu Lys Lys Ile Leu 355 36et Asn Phe His Gln Lys Lys Asn 379 4endai virus Leu Ser Lys Gly Pro Arg Ala Pro Phe Ile Cys Ile Leu Lys Asp Val His Gly Glu Phe Ala Pro Gly Asn Tyr Pro Ala Leu Trp Ser 2 Tyr Ala Met Gly Val Ala Val Val 35 4 PRT Mumps virus 2rg Gly Leu Gly Glu Gln Ala Arg Tyr Leu Ala Leu Leu Glu Ala Gln Ile Met Asp Phe Ala Pro GlyGly Tyr Pro Leu Ile Phe Ser 2 Tyr Ala Met Gly Val Gly Thr Val 35 4 PRT Human respirotory syncitial virus 2ln Lys Leu Gly Gly Glu Ala Gly Phe Tyr His Ile Leu Asn Asn Lys Ala Ser Leu Leu Ser Leu Thr Gln Phe Pro Asn PheSer Ser 2 Val Val Leu Gly Asn Ala Ala Gly 35 4 PRT Artificial Sequence Consensus sequence 22 Leu Ala Lys His Gly Glu Tyr Ala Pro Phe Ala Arg Leu Leu Asn Leu Gly Val Asn Asn Leu Glu His Gly Leu Tyr Pro Gln Leu Ser Ala 2Ile Ala Leu Gly Val Ala Thr Ala 35 42 PRT Homo sapiens 23 Met Ala Glu Pro Arg Gln Glu Phe Asp Thr Met Glu Asp Gln Ala Gly Tyr Thr Met Leu Gln Asp Gln Glu Gly Asp Met Asp His Gly Leu 2 Lys Glu Ser Pro Pro Gln Pro Pro Ala AspAsp Gly Ser Glu Glu Pro 35 4y Ser Glu Thr Ser Asp Ala Lys Ser Thr Pro Thr Ala Glu Asp Val 5 Thr Ala Pro Leu Val Glu Glu Arg Ala Pro Asp Lys Gln Ala Thr Ala 65 7 Gln Ser His Thr Glu Ile Pro Glu Gly Thr Thr Ala Glu Glu Ala Gly 85 9e Gly Asp Thr Pro Asn Met Glu Asp Gln Ala Ala Gly His Val Thr Glu Pro Gln Lys Val Glu Ile Phe Ser Gln Ser Leu Leu Val Glu Gly Arg Arg Glu Gly Gln Ala Pro Asp Ser Gly Ile Ser Asp Trp His Gln Gln Val ProSer Met Ser Gly Ala Pro Leu Pro Pro Gln Gly Leu Arg Glu Ala Thr His Gln Pro Leu Gly Thr Arg Pro Glu Asp Glu Arg Ser His Pro Ala Ser Glu Leu Leu Trp Gln Glu Ser Pro Lys Glu Ala Trp Gly Lys Asp Arg Leu GlySer Glu Glu Glu Val 2Glu Asp Ile Thr Met Asp Glu Ser Ser Gln Glu Ser Pro Pro Ser 222la Ser Leu Ala Pro Gly Thr Ala Thr Pro Gln Ala Arg Ser Val 225 234la Ser Gly Val Ser Gly Glu Thr Thr Ser Ile Pro Gly Phe Pro245 25la Glu Gly Ser Ile Pro Leu Pro Ala Asp Phe Phe Ser Lys Val Ser 267lu Thr Gln Ala Ser Pro Pro Glu Gly Pro Gly Thr Gly Pro Ser 275 28lu Glu Gly His Glu Ala Ala Pro Glu Phe Thr Phe His Val Glu Ile 29Ala SerAla Pro Lys Glu Gln Asp Leu Glu Gly Ala Thr Val Val 33Gly Ala Pro Ala Glu Glu Gln Lys Ala Arg Gly Pro Ser Val Gly Lys 325 33ly Thr Lys Glu Ala Ser Leu Leu Glu Pro Thr Asp Lys Gln Pro Ala 345ly Leu Pro Gly Arg Pro ValSer Arg Val Pro Gln Leu Lys Ala 355 36rg Val Ala Gly Val Ser Lys Asp Arg Thr Gly Asn Asp Glu Lys Lys 378ys Thr Ser Thr Pro Ser Cys Ala Lys Thr Pro Ser Asn Arg Pro 385 39Leu Ser Pro Thr Arg Pro Thr Pro Gly Ser Ser AspPro Leu Ile 44Pro Ser Ser Pro Ala Val Cys Pro Glu Pro Ala Thr Ser Pro Lys 423al Ser Ser Val Thr Pro Arg Asn Gly Ser Pro Gly Thr Lys Gln 435 44et Lys Leu Lys Gly Ala Asp Gly Lys Thr Gly Ala Lys Ile Ala Thr 456rg Gly Ala Ala Thr Pro Gly Gln Lys Gly Thr Ser Asn Ala Thr 465 478le Pro Ala Lys Thr Thr Pro Ser Pro Lys Thr Pro Pro Gly Ser 485 49ly Glu Pro Pro Lys Ser Gly Glu Arg Ser Gly Tyr Ser Ser Pro Gly 55Pro Gly Thr ProGly Ser Arg Ser Arg Thr Pro Ser Leu Pro Thr 5525 Pro Pro Thr Arg Glu Pro Lys Lys Val Ala Val Val Arg Thr Pro Pro 534er Pro Ser Ala Ser Lys Ser Arg Leu Gln Thr Ala Pro Val Pro 545 556ro Asp Leu Lys Asn Val Arg Ser LysIle Gly Ser Thr Glu Asn 565 57eu Lys His Gln Pro Gly Gly Gly Lys Val Gln Ile Ile Asn Lys Lys 589sp Leu Ser Asn Val Gln Ser Lys Cys Gly Ser Lys Asp Asn Ile 595 6Lys His Val Pro Gly Gly Gly Ser Val His Ile Val Tyr Lys Pro Val662eu Ser Lys Val Thr Ser Lys Cys Gly Ser Leu Gly Asn Ile His 625 634ys Pro Gly Gly Gly Gln Val Glu Val Lys Ser Glu Lys Leu Asp 645 65he Lys Asp Arg Val Gln Ser Lys Ile Gly Ser Leu Asp Asn Ile Thr 667alPro Gly Gly Gly Asn Lys Lys Ile Glu Thr His Lys Leu Thr 675 68he Arg Glu Asn Ala Lys Ala Lys Thr Asp His Gly Ala Glu Ile Val 69Lys Ser Pro Val Val Ser Gly Asp Thr Ser Pro Arg His Leu Ser 77Asn Val Ser Ser Thr Gly SerIle Asp Met Val Asp Ser Pro Gln Leu 725 73la Thr Leu Ala Asp Glu Val Ser Ala Ser Leu Ala Lys Gln Gly Leu 7458 PRT Homo sapiens 24 Met Ala Glu Pro Arg Gln Glu Phe Glu Val Met Glu Asp His Ala Gly Tyr Gly Leu Gly Asp ArgLys Asp Gln Gly Gly Tyr Thr Met His 2 Gln Asp Gln Glu Gly Asp Thr Asp Ala Gly Leu Lys Glu Ser Pro Leu 35 4n Thr Pro Thr Glu Asp Gly Ser Glu Glu Pro Gly Ser Glu Thr Ser 5 Asp Ala Lys Ser Thr Pro Thr Ala Glu Asp Val Thr Ala Pro Leu Val65 7 Asp Glu Gly Ala Pro Gly Lys Gln Ala Ala Ala Gln Pro His Thr Glu 85 9e Pro Glu Gly Thr Thr Ala Glu Glu Ala Gly Ile Gly Asp Thr Pro Leu Glu Asp Glu Ala Ala Gly His Val Thr Gln Glu Pro Glu Ser Lys Val ValGln Glu Gly Phe Leu Arg Glu Pro Gly Pro Pro Gly Ser His Gln Leu Met Ser Gly Met Pro Gly Ala Pro Leu Leu Pro Glu Gly Pro Arg Glu Ala Thr Arg Gln Pro Ser Gly Thr Gly Pro Glu Thr Glu Gly Gly Arg His Ala ProGlu Leu Leu Lys His Gln Leu Gly Asp Leu His Gln Glu Gly Pro Pro Leu Lys Gly Ala Gly Gly 2Glu Arg Pro Gly Ser Lys Glu Glu Val Asp Glu Asp Arg Asp Val 222lu Ser Ser Pro Gln Asp Ser Pro Pro Ser Lys Ala Ser ProAla 225 234sp Gly Arg Pro Pro Gln Thr Ala Ala Arg Glu Ala Thr Ser Ile 245 25ro Gly Phe Pro Ala Glu Gly Ala Ile Pro Leu Pro Val Asp Phe Leu 267ys Val Ser Thr Glu Ile Pro Ala Ser Glu Pro Asp Gly Pro Ser 275 28alGly Arg Ala Lys Gly Gln Asp Ala Pro Leu Glu Phe Thr Phe His 29Glu Ile Thr Pro Asn Val Gln Lys Glu Gln Ala His Ser Glu Glu 33His Leu Gly Arg Ala Ala Phe Pro Gly Ala Pro Gly Glu Gly Pro Glu 325 33la Arg Gly Pro Ser LeuGly Glu Asp Thr Lys Glu Ala Asp Leu Pro 345ro Ser Glu Lys Gln Pro Ala Ala Ala Pro Arg Gly Lys Pro Val 355 36er Arg Val Pro Gln Leu Lys Ala Arg Met Val Ser Lys Ser Lys Asp 378hr Gly Ser Asp Asp Lys Lys Ala Lys Thr SerThr Arg Ser Ser 385 39Lys Thr Leu Lys Asn Arg Pro Cys Leu Ser Pro Lys Leu Pro Thr 44Gly Ser Ser Asp Pro Leu Ile Gln Pro Ser Ser Pro Ala Val Cys 423lu Pro Pro Ser Ser Pro Lys His Val Ser Ser Val Thr Ser Arg 43544hr Gly Ser Ser Gly Ala Lys Glu Met Lys Leu Lys Gly Ala Asp Gly 456hr Lys Ile Ala Thr Pro Arg Gly Ala Ala Pro Pro Gly Gln Lys 465 478ln Ala Asn Ala Thr Arg Ile Pro Ala Lys Thr Pro Pro Ala Pro 485 49ys Thr ProPro Ser Ser Gly Glu Pro Pro Lys Ser Gly Glu Arg Ser 55Tyr Ser Ser Pro Gly Ser Pro Gly Thr Pro Gly Ser Arg Ser Arg 5525 Thr Pro Ser Leu Pro Thr Pro Pro Thr Arg Glu Pro Lys Lys Val Ala 534al Arg Thr Pro Pro Lys Ser ProSer Ser Ala Lys Ser Arg Leu 545 556hr Ala Pro Val Pro Met Pro Asp Leu Lys Asn Val Lys Ser Lys 565 57le Gly Ser Thr Glu Asn Leu Lys His Gln Pro Gly Gly Gly Lys Val 589le Ile Asn Lys Lys Leu Asp Leu Ser Asn Val Gln SerLys Cys 595 6Gly Ser Lys Asp Asn Ile Lys His Val Pro Gly Gly Gly Ser Val Gln 662al Tyr Lys Pro Val Asp Leu Ser Lys Val Thr Ser Lys Cys Gly 625 634eu Gly Asn Ile His His Lys Pro Gly Gly Gly Gln Val Glu Val 645 65ys Ser Glu Lys Leu Asp Phe Lys Asp Arg Val Gln Ser Lys Ile Gly 667eu Asp Asn Ile Thr His Val Pro Gly Gly Gly Asn Lys Lys Ile 675 68lu Thr His Lys Leu Thr Phe Arg Glu Asn Ala Lys Ala Lys Thr Asp 69Gly Ala Glu Ile ValTyr Lys Ser Pro Val Val Ser Gly Asp Thr 77Ser Pro Arg His Leu Ser Asn Val Ser Ser Thr Gly Ser Ile Asp Met 725 73al Asp Ser Pro Gln Leu Ala Thr Leu Ala Asp Glu Val Ser Ala Ser 745la Lys Gln Gly Leu 755 25 733 PRT Homosapiens 25 Met Ala Asp Pro Arg Gln Glu Phe Asp Thr Met Glu Asp His Ala Gly Tyr Thr Leu Leu Gln Asp Gln Glu Gly Asp Met Asp His Gly Leu 2 Lys Glu Ser Pro Pro Gln Pro Pro Ala Asp Asp Gly Ala Glu Glu Pro 35 4y Ser Glu Thr Ser AspAla Lys Ser Thr Pro Thr Ala Glu Asp Val 5 Thr Ala Pro Leu Val Asp Glu Arg Ala Pro Asp Lys Gln Ala Ala Ala 65 7 Gln Pro His Thr Glu Ile Pro Glu Gly Ile Thr Ala Glu Glu Ala Gly 85 9e Gly Asp Thr Pro Asn Gln Glu Asp Gln Ala Ala Gly HisVal Thr Gly Arg Arg Glu Gly Gln Ala Pro Asp Leu Gly Thr Ser Asp Trp Arg Gln Gln Val Ser Ser Met Ser Gly Ala Pro Leu Leu Pro Gln Leu Arg Glu Ala Thr Cys Gln Pro Ser Gly Thr Arg Pro Glu Asp Ile Glu Lys Ser His Pro Ala Ser Glu Leu Leu Arg Arg Gly Pro Pro Lys Glu Gly Trp Gly Gln Asp Arg Leu Gly Ser Glu Glu Glu Val Glu Asp Leu Thr Val Asp Glu Ser Ser Gln Asp Ser Pro Pro Ser 2Ala Ser Leu Thr ProGly Arg Ala Ala Pro Gln Ala Gly Ser Gly 222al Cys Gly Glu Thr Ala Ser Val Pro Gly Leu Pro Thr Glu Gly 225 234al Pro Leu Pro Ala Asp Phe Phe Ser Lys Val Ser Ala Glu Thr 245 25ln Ala Ser Gln Pro Glu Gly Pro Gly Thr GlyPro Met Glu Glu Gly 267lu Ala Ala Pro Glu Phe Thr Phe His Val Glu Ile Lys Ala Ser 275 28hr Pro Lys Glu Gln Asp Leu Glu Gly Ala Thr Val Val Gly Val Pro 29Glu Glu Gln Lys Ala Gln Thr Gln Gly Pro Ser Val Gly Lys Gly 33Thr Lys Glu Ala Ser Leu Gln Glu Pro Pro Gly Lys Gln Pro Ala Ala 325 33ly Leu Pro Gly Arg Pro Val Ser Arg Val Pro Gln Leu Lys Ala Arg 345la Ser Lys Asp Arg Thr Gly Asn Asp Glu Lys Lys Ala Lys Thr 355 36er Thr ProSer Cys Ala Lys Ala Pro Ser His Arg Pro Cys Leu Ser 378hr Arg Pro Thr Leu Gly Ser Ser Asp Pro Leu Ile Lys Pro Ser 385 39Pro Ala Val Ser Pro Glu Pro Ala Thr Ser Pro Lys His Val Ser 44Val Thr Pro Arg Asn Gly SerPro Gly Thr Lys Gln Met Lys Leu 423ly Ala Asp Gly Lys Thr Gly Ala Lys Ile Ala Thr Pro Arg Gly 435 44la Ala Ser Pro Ala Gln Lys Gly Thr Ser Asn Ala Thr Arg Ile Pro 456ys Thr Thr Pro Ser Pro Lys Thr Pro Pro Gly Ser GlyGlu Pro 465 478ys Ser Gly Glu Arg Ser Gly Tyr Ser Ser Pro Gly Ser Pro Gly 485 49hr Pro Gly Ser Arg Ser Arg Thr Pro Ser Leu Pro Thr Pro Pro Thr 55Glu Pro Lys Lys Val Ala Val Val Arg Thr Pro Pro Lys Ser Pro 5525Ser Ala Ser Lys Ser Arg Leu Gln Thr Ala Pro Val Pro Met Pro Asp 534ys Asn Val Arg Ser Lys Ile Gly Ser Thr Glu Asn Leu Lys His 545 556ro Gly Gly Gly Lys Val Gln Ile Ile Asn Lys Lys Leu Asp Leu 565 57er Asn Val Gln SerLys Cys Gly Ser Lys Asp Asn Ile Lys His Val 589ly Gly Gly Ser Val Gln Ile Val Tyr Lys Pro Val Asp Leu Ser 595 6

Lys Val Thr Ser Lys Cys Gly Ser Leu Gly Asn Ile His His Lys Pro 662ly Gly Gln Val Glu Val Lys Ser Glu Lys Leu Asp Phe Lys Asp 625 634al Gln Ser Lys Ile Gly Ser Leu Asp Asn Ile Thr His Val Pro 645 65ly Gly GlyAsn Lys Lys Ile Glu Thr His Lys Leu Thr Phe Arg Glu 667la Lys Ala Lys Thr Asp His Gly Ala Glu Ile Val Tyr Lys Ser 675 68ro Val Val Ser Gly Asp Thr Ser Pro Arg His Leu Ser Asn Val Ser 69Thr Gly Ser Ile Asp Met Val AspSer Pro Gln Leu Ala Thr Leu 77Ala Asp Glu Val Ser Ala Ser Leu Ala Lys Gln Gly Leu 725 738 PRT Bos taurus 26 Met Ala Glu Pro Arg Gln Glu Phe Asp Val Met Glu Asp His Ala Gln Asp Tyr Thr Leu Gln Asp Gln Glu Gly Asp Met AspPro Gly Leu 2 Lys Glu Ser Pro Leu Gln Thr Pro Ala Asp Asp Gly Ser Glu Glu Pro 35 4y Ser Glu Thr Ser Asp Ala Lys Ser Thr Pro Thr Ala Glu Asp Ala 5 Thr Ala Pro Leu Val Asp Glu Gly Ala Pro Gly Glu Gln Ala Ala Ala 65 7 Gln Ala ProAla Glu Ile Pro Glu Gly Thr Ala Ala Glu Glu Ala Gly 85 9e Gly Asp Thr Ser Asn Leu Glu Asp Gln Ala Ala Gly His Val Thr Ala Arg Met Val Ser Lys Gly Lys Asp Gly Thr Gly Pro Asp Asp Lys Thr Lys Gly Ala Asp Gly Lys ProGly Thr Lys Ile Ala Thr Arg Gly Ala Ala Pro Pro Gly Gln Lys Gly Gln Ala Asn Ala Thr Arg Ile Pro Ala Lys Thr Thr Pro Thr Pro Lys Thr Ser Pro Ala Thr Gln Val Gln Lys Lys Pro Pro Pro Ala Gly Ala Lys Ser GluArg Glu Ser Gly Lys Ser Gly Asp Arg Ser Gly Tyr Ser Ser Pro Gly 2Pro Gly Thr Pro Gly Ser Arg Ser Arg Thr Pro Ser Leu Pro Thr 222ro Thr Arg Glu Pro Lys Lys Val Ala Val Val Arg Thr Pro Pro 225 234er Pro Ser Ala Ala Lys Ser Arg Leu Gln Ala Ala Pro Gly Pro 245 25et Pro Asp Leu Lys Asn Val Lys Ser Lys Ile Gly Ser Thr Glu Asn 267ys His Gln Pro Gly Gly Gly Lys Val Gln Ile Ile Asn Lys Lys 275 28eu Asp Leu Ser Asn Val GlnSer Lys Cys Gly Ser Lys Asp Asn Ile 29His Val Pro Gly Gly Gly Ser Val Gln Ile Val Tyr Lys Pro Val 33Asp Leu Ser Lys Val Thr Ser Lys Cys Gly Ser Leu Gly Asn Ile His 325 33is Lys Pro Gly Gly Gly Gln Val Glu Val Lys SerGlu Lys Leu Asp 345ys Asp Arg Val Gln Ser Lys Ile Gly Ser Leu Asp Asn Ile Thr 355 36is Val Pro Gly Gly Gly Asn Lys Lys Ile Glu Thr His Lys Leu Thr 378rg Glu Asn Ala Lys Ala Lys Thr Asp His Gly Ala Glu Ile Val 385 39Lys Ser Pro Val Val Ser Gly Asp Thr Ser Pro Arg His Leu Ser 44Val Ser Ser Thr Gly Ser Ile Asp Met Val Asp Ser Pro Gln Leu 423hr Leu Ala Asp Glu Val Ser Ala Ser Leu Ala Lys Gln Gly Leu 435 447 352 PRT Homosapiens 27 Met Ala Glu Pro Arg Gln Glu Phe Glu Val Met Glu Asp His Ala Gly Tyr Gly Leu Gly Asp Arg Lys Asp Gln Gly Gly Tyr Thr Met His 2 Gln Asp Gln Glu Gly Asp Thr Asp Ala Gly Leu Lys Ala Glu Glu Ala 35 4y Ile Gly Asp Thr ProSer Leu Glu Asp Glu Ala Ala Gly His Val 5 Thr Gln Ala Arg Met Val Ser Lys Ser Lys Asp Gly Thr Gly Ser Asp 65 7 Asp Lys Lys Ala Lys Gly Ala Asp Gly Lys Thr Lys Ile Ala Thr Pro 85 9g Gly Ala Ala Pro Pro Gly Gln Lys Gly Gln Ala Asn AlaThr Arg Pro Ala Lys Thr Pro Pro Ala Pro Lys Thr Pro Pro Ser Ser Gly Pro Pro Lys Ser Gly Asp Arg Ser Gly Tyr Ser Ser Pro Gly Ser Gly Thr Pro Gly Ser Arg Ser Arg Thr Pro Ser Leu Pro Thr Pro Pro Thr Arg Glu Pro Lys Lys Val Ala Val Val Arg Thr Pro Pro Lys Pro Ser Ser Ala Lys Ser Arg Leu Gln Thr Ala Pro Val Pro Met Asp Leu Lys Asn Val Lys Ser Lys Ile Gly Ser Thr Glu Asn Leu 2His Gln Pro Gly GlyGly Lys Val Gln Ile Val Tyr Lys Pro Val 222eu Ser Lys Val Thr Ser Lys Cys Gly Ser Leu Gly Asn Ile His 225 234ys Pro Gly Gly Gly Gln Val Glu Val Lys Ser Glu Lys Leu Asp 245 25he Lys Asp Arg Val Gln Ser Lys Ile Gly SerLeu Asp Asn Ile Thr 267al Pro Gly Gly Gly Asn Lys Lys Ile Glu Thr His Lys Leu Thr 275 28he Arg Glu Asn Ala Lys Ala Lys Thr Asp His Gly Ala Glu Ile Val 29Lys Ser Pro Val Val Ser Gly Asp Thr Ser Pro Arg His Leu Ser 33Asn Val Ser Ser Thr Gly Ser Ile Asp Met Val Asp Ser Pro Gln Leu 325 33la Thr Leu Ala Asp Glu Val Ser Ala Ser Leu Ala Lys Gln Gly Leu 3454 PRT Ebola virus 28 Met Asp Ser Arg Pro Gln Lys Ile Trp Met Ala Pro Ser Leu Thr GluAsp Met Asp Tyr His Lys Ile Leu Thr Ala Gly Leu Ser Val Gln 2 Gln Gly Ile Val Arg Gln Arg Val Ile Pro Val Tyr Gln Val Asn Asn 35 4u Glu Glu Ile Cys Gln Leu Ile Ile Gln Ala Phe Glu Ala Gly Val 5 Asp Phe Gln Glu Ser AlaAsp Ser Phe Leu Leu Met Leu Cys Leu His 65 7 His Ala Tyr Gln Gly Asp Tyr Lys Leu Phe Leu Glu Ser Gly Ala Val 85 9s Tyr Leu Glu Gly His Gly Phe Arg Phe Glu Val Lys Lys Arg Asp Val Lys Arg Leu Glu Glu Leu Leu Pro Ala Val SerSer Gly Lys Ile Lys Arg Thr Leu Ala Ala Met Pro Glu Glu Glu Thr Thr Glu Asn Ala Gly Gln Phe Leu Ser Phe Ala Ser Leu Phe Leu Pro Lys Leu Val Val Gly Glu Lys Ala Cys Leu Glu Lys Val Gln Arg Gln Ile Val His Ala Glu Gln Gly Leu Ile Gln Tyr Pro Thr Ala Trp Gln Val Gly His Met Met Val Ile Phe Arg Leu Met Arg Thr Asn Phe 2Ile Lys Phe Leu Leu Ile His Gln Gly Met His Met Val Ala Gly 222sp Ala Asn AspAla Val Ile Ser Asn Ser Val Ala Gln Ala Arg 225 234er Gly Leu Leu Ile Val Lys Thr Val Leu Asp His Ile Leu Gln 245 25ys Thr Glu Arg Gly Val Arg Leu His Pro Leu Ala Arg Thr Ala Lys 267ys Asn Glu Val Asn Ser Phe Lys AlaAla Leu Ser Ser Leu Ala 275 28ys His Gly Glu Tyr Ala Pro Phe Ala Arg Leu Leu Asn Leu Ser Gly 29Asn Asn Leu Glu His Gly Leu Phe Pro Gln Leu Ser Ala Ile Ala 33Leu Gly Val Ala Thr Ala His Gly Ser Thr Leu Ala Gly Val AsnVal 325 33ly Glu Gln Tyr Gln Gln Leu Arg Glu Ala Ala Thr Glu Ala Glu Lys 345eu Gln Gln Tyr Ala Glu Ser Arg Glu Leu Asp His Leu Gly Leu 355 36sp Asp Gln Glu Lys Lys Ile Leu Met Asn Phe His Gln Lys Lys Asn 378leSer Phe Gln Gln Thr Asn Ala Met Val Thr Leu Arg Lys Glu 385 39Leu Ala Lys Leu Thr Glu Ala Ile Thr Ala Ala Ser Leu Pro Lys 44Ser Gly His Tyr Asp Asp Asp Asp Asp Ile Pro Phe Pro Gly Pro 423sn Asp Asp Asp Asn ProGly His Gln Asp Asp Asp Pro Thr Asp 435 44er Gln Asp Thr Thr Ile Pro Asp Val Val Val Asp Pro Asp Asp Gly 456yr Gly Glu Tyr Gln Ser Tyr Ser Glu Asn Gly Met Asn Ala Pro 465 478sp Leu Val Leu Phe Asp Leu Asp Glu Asp AspGlu Asp Thr Lys 485 49ro Val Pro Asn Arg Ser Thr Lys Gly Gly Gln Gln Lys Asn Ser Gln 55Gly Gln His Ile Glu Gly Arg Gln Thr Gln Ser Arg Pro Ile Gln 5525 Asn Val Pro Gly Pro His Arg Thr Ile His His Ala Ser Ala Pro Leu 534sp Asn Asp Arg Arg Asn Glu Pro Ser Gly Ser Thr Ser Pro Arg 545 556eu Thr Pro Ile Asn Glu Glu Ala Asp Pro Leu Asp Asp Ala Asp 565 57sp Glu Thr Ser Ser Leu Pro Pro Leu Glu Ser Asp Asp Glu Glu Gln 589rg Asp GlyThr Ser Asn Arg Thr Pro Thr Val Ala Pro Pro Ala 595 6Pro Val Tyr Arg Asp His Ser Glu Lys Lys Glu Leu Pro Gln Asp Glu 662ln Asp Gln Asp His Thr Gln Glu Ala Arg Asn Gln Asp Ser Asp 625 634hr Gln Ser Glu His Ser Phe GluGlu Met Tyr Arg His Ile Leu 645 65rg Ser Gln Gly Pro Phe Asp Ala Val Leu Tyr Tyr His Met Met Lys 667lu Pro Val Val Phe Ser Thr Ser Asp Gly Lys Glu Tyr Thr Tyr 675 68ro Asp Ser Leu Glu Glu Glu Tyr Pro Pro Trp Leu Thr Glu LysGlu 69Met Asn Glu Glu Asn Arg Phe Val Thr Leu Asp Gly Gln Gln Phe 77Tyr Trp Pro Val Met Asn His Lys Asn Lys Phe Met Ala Ile Leu Gln 725 73is His Gln Gly Pro Phe Glu Gln Lys Leu Ile Ser Glu Glu Asp Leu 745et His Thr Gly His His His His His His Arg 755 765 PRT Artificial Sequence Consensus sequence 29 Met Ala Glu Pro Arg Gln Glu Phe Asp Val Met Glu Asp His Ala Gly Asp Tyr Thr Met Leu Gln Asp Gln Glu Gly Asp Met Asp Gly Leu 2Lys Glu Ser Pro Leu Gln Pro Pro Ala Asp Asp Gly Ser Glu Glu Pro 35 4y Ser Glu Thr Ser Asp Ala Lys Ser Thr Pro Thr Ala Glu Asp Val 5 Thr Ala Pro Leu Val Asp Glu Ala Pro Lys Gln Ala Ala Ala Gln His 65 7 Thr Glu Ile Pro Glu Gly Thr ThrAla Glu Glu Ala Gly Ile Gly Asp 85 9r Pro Asn Leu Glu Asp Gln Ala Ala Gly His Val Thr Gln Arg Glu Pro Asp Gly Ser Asp Thr Gln Gln Val Ser Met Ser Gly Ala Pro Pro Gly Leu Arg Glu Ala Thr Gln Pro Gly Thr Arg Pro GluAsp Glu Ala Glu Leu Leu Pro Lys Ala Gly Asp Arg Leu Gly Ser Glu Glu Val Asp Glu Asp Leu Val Asp Glu Ser Ser Gln Asp Ser Pro Pro Ala Ser Ala Pro Gln Ala Ser Val Glu Ser Ile Pro Gly Pro Glu Ser Ile Pro Leu Pro Asp Phe Ser Lys Val Ser Glu Gln Ala Ser 2Glu Gly Pro Gly Glu Gly Glu Ala Ala Glu Phe Thr Phe His Val 222le Lys Glu Gln Leu Ala Thr Gly Ala Pro Gly Glu Ala Gly Pro 225 234al Gly Thr Lys GluAla Leu Glu Pro Lys Gln Pro Ala Ala Gly 245 25eu Gly Arg Pro Val Ser Arg Val Pro Gln Leu Lys Ala Arg Met Val 267ys Ser Lys Asp Gly Thr Gly Asp Asp Lys Lys Ala Lys Thr Ser 275 28hr Ser Ala Lys Arg Pro Cys Leu Ser Pro Thr ProThr Gly Ser Ser 29Pro Leu Ile Lys Pro Ser Ser Pro Ala Val Pro Glu Pro Thr Ser 33Pro Lys His Val Ser Ser Val Thr Arg Gly Ser Gly Lys Met Lys Leu 325 33ys Gly Ala Asp Gly Lys Thr Lys Ile Ala Thr Pro Arg Gly Ala Ala 345ro Gly Gln Lys Gly Gln Ala Asn Ala Thr Arg Ile Pro Ala Lys 355 36hr Thr Pro Ala Pro Lys Thr Pro Pro Ser Ser Gly Glu Pro Pro Lys 378ly Asp Arg Ser Gly Tyr Ser Ser Pro Gly Ser Pro Gly Thr Pro 385 39Ser ArgSer Arg Thr Pro Ser Leu Pro Thr Pro Pro Thr Arg Glu 44Lys Lys Val Ala Val Val Arg Thr Pro Pro Lys Ser Pro Ser Ala 423ys Ser Arg Leu Gln Thr Ala Pro Val Pro Met Pro Asp Leu Lys 435 44sn Val Lys Ser Lys Ile Gly Ser ThrGlu Asn Leu Lys His Gln Pro 456ly Gly Lys Val Gln Ile Ile Asn Lys Lys Leu Asp Leu Ser Asn 465 478ln Ser Lys Cys Gly Ser Lys Asp Asn Ile Lys His Val Pro Gly 485 49ly Gly Ser Val Gln Ile Val Tyr Lys Pro Val Asp Leu SerLys Val 55Ser Lys Cys Gly Ser Leu Gly Asn Ile His His Lys Pro Gly Gly 5525 Gly Gln Val Glu Val Lys Ser Glu Lys Leu Asp Phe Lys Asp Arg Val 534er Lys Ile Gly Ser Leu Asp Asn Ile Thr His Val Pro Gly Gly 545 556sn Lys Lys Ile Glu Thr His Lys Leu Thr Phe Arg Glu Asn Ala 565 57ys Ala Lys Thr Asp His Gly Ala Glu Ile Val Tyr Lys Ser Pro Val 589er Gly Asp Thr Ser Pro Arg His Leu Ser Asn Val Ser Ser Thr 595 6Gly Ser Ile Asp Met ValAsp Ser Pro Gln Leu Ala Thr Leu Ala Asp 662al Ser Ala Ser Leu Ala Lys Gln Gly Leu 625 63BR>

Other References

  • Tindle, R.W. et al. 1994 “Chimeric Hepatitis B Core Antigen Particles Containing B- and Th- Epitopes of Human Papillomavirus Type 16 E7 Protein Induce Specific Antibody and T-Helper Responses in Immunised Mice.” Virology 200: 547-557.
  • Sanchez, A. et al. 1998 “Variation in the Glycoprotein and VP35 Genes of Marburg Virus Strains.” Virology 240: 138-146.
  • Sanchez, A. et al. 1998 “Biochemical Analysis of the Secreted and Virion Glycoproteins of Ebola Virus.” J. Virol. 72: 6442-6447.
  • Sanchez, A. et al. 1986 “Conserved Structures among the Nucleocapsid Proteins of the Paramyxoviridae: Complete Nucleotide Sequence of Human Parainfluenza Virus Type 3 NP mRNA.” Virology 152: 171-180.
  • Patton, J.T. et al. 1983 “Cell-Free Synthesis and Assembly of Vesicular Stomatitis Virus Nucleocapsids.” J. Virol. 45: 155-164.
  • Pal, R. et al. 1981 “Pardaxin, a Hydrophobic Toxin of the Red Sea Flatfish, Disassembles the Intact Membrane of Vesicular Stomatitis Virus.” J. Biol. Chem. 256: 10209-10212.
  • Myers, T.M. et al. 1997 “A Highly Conserved Region of the Sendai Virus Nucleocapsid Protein Contributes to the NP-NP Binding Domain.” Virology 229: 322-335.
  • European Patent Office Communication (Supplementary Partial European Search Report) dated Nov. 13, 2006, pursuant to European Patent Application No. 03751792.7.
  • European Patent Office Communication (Supplementary Partial European Search Report) dated Apr. 11, 2007, pursuant to European Patent Application No. 03751792.7.
  • Brown, J.R. et al. 1997 “Hydrophobic mannosides act as acceptors for trypanosome α-mannosyltransferases.” Glycobiology 7: 549-558.
  • Adams, S.E. et al. 1987 “The expression of hybrid HIV:Ty virus-like particles in yeast.” Nature 329: 68-70.
  • Yang, Z.-Y. et al. 2000 “Identification of the ebola virus glycoprotein as the main viral determinant of vascular cell cytotoxicity and injury.” Nat. Med. 6:886-889.
  • Yang, Z.-Y. et al. 1998 “Ebola virus, neutrophils, and antibody specificity (technical comment).” Science 282:845a in 4 pages.
  • Wills, J.W. et al. 1989 “Creation and expression of myristylated forms of rous sarcoma virus gag protein in mammalian cells.” J. Virol. 63:4331-4343.
  • Wells, L. et al. 2001 “Glycosylation of nucleocytoplasmic proteins: signal transduction and O-GlcNAc.” Science 291:2376-2378.
  • Volchkov, V.E. et al. 2001 “Recovery of infectious ebola virus from complementary DNA: RNA editing of the GP gene and viral cytotoxicity.” Science 291:1965-1969.
  • Tooze, J. et al. 1988 “Site of addition of N-Acetyl-galactosamine to the E1 glycoprotein of mouse hepatitis virus-A59.” J. Cell Biol. 106:1475-1487.
  • Timmins, J. et al. 2001 “Vesicular release of ebola virus matrix protein VP40.” Virology 283:1-6.
  • Sullivan, N.J. et al. 2000 “Development of a preventive vaccine for ebola virus infection in primates.” Nature 408:605-609.
  • Starr, C.M. et al. 1990 “Glycosylation of nuclear pore protein p62. Reticulocyte lysate catalyzes O-linked N-acetylglucosamine addition in vitro.” J. Biol. Chem. 265:6868-6873.
  • Smith, A.J. et al. 1993 “Requirements for incorporation of Pr160gag-pol from human immunodeficiency virus type 1 into virus-like particles.” J. Virol. 67:2266-2275.
  • Schwemmle, M. et al. 1998 “Interactions of the borna disease virus P, N, and X proteins and their functional implications.” J. Biol. Chem. 273:9007-9012.
  • Schnittler, H-J. et al. 1993 “Replication of marburg virus in human endothelial cells: a possible mechanism for the development of viral hemorrhagic disease.” J. Clin. Invest. 91:1301-1309.
  • Sanchez, A. et al. 1993 “Sequence analysis of the ebola virus genome: organization, genetic elements, and comparison with the genome of marburg virus.” Virus Res. 29:215-240.
  • Ruigrok, R.W. et al. 2000 “Structural characterization and membrane binding properties of the matrix protein VP40 of ebola virus.” J. Mol. Biol. 300:103-112.
  • Roquemore, E.P. et al. 1994 “Detection of O-linked N-acetylglucosamine (O-GlcNAc) on cytoplasmic and nuclear proteins.” Meth. Enzymol. 230:443-460.
  • Muhlberger, E. et al. 1999 “Comparison of the transcription and replication strategies of marburg virus and ebola virus by using artificial replication systems.” J. Virol. 73:2333-2342.
  • Muhlberger, E. et al. 1998 “Three of the four nucleocapsid proteins of marburg virus, NP, VP35, and L, are sufficient to mediate replication and transcription of marburg virus-specific monocistronic minigenomes.” J. Virol. 72:8756-8764.
  • Moody, A.M. et al. 2001 “Developmentally regulated glycosylation of the CD8αβ coreceptor stalk modulates ligand binding.” Cell 107:501-512.
  • Maruyama, T. et al. 1999 “Ebola virus can be effectively neutralized by antibody produced in natural human infection.” J. Virol. 73:6024-6030.
  • Martin-Serrano, J. et al. 2001 “HIV-1 and ebola virus encode small peptide motifs that recruit Tsg101 to sites of particle assembly to facilitate egress.” Nat. Med. 7:1313-1319.
  • Luo, L. et al. 1994 “Mapping of functional domains for HIV-2 gag assembly into virus-like particles.” Virology 205:496-502.
  • Lowe, J.B. 2001 “Glycosylation, immunity, and autoimmunity.” Cell 104:809-812.
  • Le Guenno, B. et al. 1995 “Isolation and partial characterisation of a new strain of ebola virus.” Lancet 345:1271-1274.
  • Kiley, M.P. et al. 1988 “Physicochemical properties of marburg virus: evidence for three distinct virus strains and their relationship to ebola virus.” J. Gen. Virol. 69:1956-1967.
  • Jasenosky, L.D. et al. 2001 “Ebola virus VP40-induced particle formation and association with the lipid bilayer.” J. Virol. 75:5205-5214.
  • Huber, M. et al. 1991 “Measles virus phosphoprotein retains the nucleocapsid protein in the cytoplasm.” Virology 185:299-308.
  • Huang, Y. et al. 2002 “The assembly of Ebola virus nucleocapsid requires virion-associated proteins 35 and 24 and posttranslational modification of nucleoprotein.” Mol. Cell 10:307-316.
  • Huang, Y. et al. 2001 “Human immunodeficiency virus type 1-specific immunity after genetic immunization is enhanced by modification of Gag and Pol expression.” J. Virol. 75:4947-4951.
  • Horikami, S.M. et al. 1992 “Complexes of sendai virus NP-P and P-L proteins are required for defective interfering particle genome replication in vitro.” J. Virol. 66:4901-4908.
  • Hanover, J.A. 2001 “Glycan-dependent signaling: O-linked N-acetylglucosamine.” FASEB J. 15:1865-1876.
  • Han, I. et al. 1997 “Reduced O glycosylation of Sp1 is associated with increased proteasome susceptibility.” Mol. Cell. Biol. 17:2550-2558.
  • Gheysen, D. et al. 1989 “Assembly and release of HIV-1 precursor Pr55gag virus-like particles from recombinant baculovirus-infected insect cells.” Cell 59:103-112.
  • Geisbert, T.W. et al. 1995 “Differentiation in filoviruses by electron microscopy.” Virus Res. 39:129-150.
  • Geisbert, T.W. et al. 1992 “Association of ebola-related reston virus particles and antigen with tissue lesions of monkeys imported to the United States.” J. Compar. Pathol. 106:137-152.
  • Garoff, H. et al 1998. “Virus maturation by budding.” Microbiol. Molec. Biol. Rev. 62:1171-1190.
  • Friborg, J. Jr. et al. 1999 “p53 inhibition by the LANA protein of KSHV protects against cell death.” Nature 402:889-894.
  • Feldmann, H. et al. 2001 “Biosynthesis and role of filoviral glycoproteins.” J. Gen. Virol. 82:2839-2848.
  • Feldmann, H. et al. 1999 “Classification, structure, and replication of filoviruses.” Curr. Top. Microbiol. Immunol. 235:1-21.
  • Feldmann, H. et al. 1996 “Marburg and ebola viruses.” Adv. Virus Res. 47:1-52.
  • Feldmann, H. et al. 1996 “Filovirus-induced endothelial leakage triggered by infected monocytes/macrophages.” J. Virol. 70:2208-2214.
  • Feldmann, H. et al. 1992 “Marburg virus, a filovirus: messenger RNAs, gene order, and regulatory elements of the replication cycle.” Virus Res. 24:1-19.
  • Elliott, L.H. et al. 1985 “Descriptive analysis of ebola virus proteins.” Virology 147:169-176.
  • Dessen, A. et al. 2000 “Crystal structure of the matrix protein VP40 from ebola virus.” EMBO J. 19:4228-4236.
  • Delchambre, M. et al. 1989 “The gag precursor of simian immunodeficiency virus assembles into virus-like particles.” EMBO J. 8:2653-2660.
  • Chen, C. et al. 1987 “High-efficiency transformation of mammalian cells by plasmid DNA.” Mol. Cell. Biol. 7:2745-2752.
  • Becker, S. et al. 1998 “Interactions of marburg virus nucleocapsid proteins.” Virology 249:406-417.
  • Becker, S. et al. 1994 “The nucleoprotein of marburg virus is phosphorylated.” J. Gen. Virol. 75:809-818.
  • Aoki, K. et al. 1999 “Efficient generation of recombinant adenoviral vectors by cre-lox recombination in vitro.” Mol. Med. 5:224-231.
  • Warfield et al., Filovirus-like particles as vaccines and discovery tools, Expert Rev Vaccines, 2005, 4(3):429-440.
  • Reed et al., Status and challenges of filovirus vaccines, Vaccine 25 (2007) 1923-1934.
PatentsPlus Images
Enhanced PDF formats
loading...
PatentsPlus: add to cart
PatentsPlus: add to cartSearch-enhanced full patent PDF image
$9.95more info
PatentsPlus: add to cart
PatentsPlus: add to cartIntelligent turbocharged patent PDFs with marked up images
$18.95more info
 
Sign InRegister
Username  
Password   
forgot password?