U.S. patents available from 1976 to present.
U.S. patent applications available from 2005 to present.

Human metalloprotease and polynucleotides encoding the same

Patent 7374933 Issued on May 20, 2008. Estimated Expiration Date: Icon_subject April 12, 2021. Estimated Expiration Date is calculated based on simple USPTO term provisions. It does not account for terminal disclaimers, term adjustments, failure to pay maintenance fees, or other factors which might affect the term of a patent.
Abstract Claims Description Full Text

Inventors

Assignee

Application

No. 09833782 filed on 04/12/2001

US Classes:

435/325, ANIMAL CELL, PER SE (E.G., CELL LINES, ETC.); COMPOSITION THEREOF; PROCESS OF PROPAGATING, MAINTAINING OR PRESERVING AN ANIMAL CELL OR COMPOSITION THEREOF; PROCESS OF ISOLATING OR SEPARATING AN ANIMAL CELL OR COMPOSITION THEREOF; PROCESS OF PREPARING A COMPOSITION CONTAINING AN ANIMAL CELL; CULTURE MEDIA THEREFORE435/320.1, VECTOR, PER SE (E.G., PLASMID, HYBRID PLASMID, COSMID, VIRAL VECTOR, BACTERIOPHAGE VECTOR, ETC.) BACTERIOPHAGE VECTOR, ETC.)435/226, Derived from animal tissue (e.g., rennin, etc.)435/252.1, Bacteria or actinomycetales; media therefor536/23.2Encodes an enzyme

Examiners

Primary: Prosty, Rebecca
Assistant: Walicka, M

Attorney, Agent or Firm

Foreign Patent References

  • WO 01/23590 WO 04/01/2001

International Classes

C12N 9/64
C12N 15/00
C12N 5/00
C12N 1/12
C07H 21/04

Description

1. INTRODUCTION


The present invention relates to the discovery, identification, and characterization of novel human polynucleotides encoding a protein sharing sequence similarity with mammalian neurolysin proteins. The invention encompasses the describedpolynucleotides, host cell expression systems, the encoded proteins, fusion proteins, polypeptides and peptides, antibodies to the encoded proteins and peptides, and genetically engineered animals that either lack or over express the disclosedpolynucleotides, antagonists and agonists of the proteins, and other compounds that modulate the expression or activity of the proteins encoded by the disclosed polynucleotides that can be used for diagnosis, drug screening, clinical trial monitoring,the treatment of physiological disorders or diseases, and cosmetic or nutriceutical applications.

2. BACKGROUND OF THE INVENTION

Neurolysins are soluble proteins of the zinc metalloprotease family that bind and cleave protein substrates such as angiotensin or neurotensin (typically between pro and tyr residues). As such, neurolysins have been implicated in a number ofbiological processes and anomalies such as blood pressure regulation, kidney function, pain management, cardiac disease, natriuresis and diabetes. Consequently, neurolysins can act as therapeutics as well as drug targets.

3. SUMMARY OF THE INVENTION

The present invention relates to the discovery, identification, and characterization of nucleotides that encode a novel human protein, and the corresponding amino acid sequence of this protein. The novel human protein (NHP) described for thefirst time herein shares structural similarity with animal neurolysins and angiotensin-binding proteins. The novel human nucleic acid sequences described herein, encode a protein/open reading frame (ORF) of 704 amino acids in length (see SEQ ID NO:1).

The invention also encompasses agonists and antagonists of the described NHPs, including small molecules, large molecules, mutant NHPs, or portions thereof, that compete with native NHP, peptides, and antibodies, as well as nucleotide sequencesthat can be used to inhibit the expression of the described NHPs (e.g., antisense and ribozyme molecules, and gene or regulatory sequence replacement constructs) or to enhance the expression of the described NHP polynucleotides (e.g., expressionconstructs that place the described polynucleotide under the control of a strong promoter system), and transgenic animals that express a NHP transgene, or "knock-outs" (which can be conditional) that do not express a functional NHP. Knock-out mice canbe produced in several ways, one of which involves the use of mouse embryonic stem cells ("ES cells") lines that contain gene trap mutations in a murine homolog of at least one of the described NHPS. When the unique NHP sequences described in SEQ IDNOS:1-3 are "knocked-out" they provide a method of identifying phenotypic expression of the particular gene as well as a method of assigning function to previously unknown genes. Additionally, the unique NHP sequences described in SEQ ID NOS:1-3 areuseful for the identification of coding sequence and the mapping a unique gene to a particular chromosome.

Further, the present invention also relates to processes for identifying compounds that modulate, i.e., act as agonists or antagonists, of NHP expression and/or NHP activity that utilize purified preparations of the described NHPs and/or NHPproduct, or cells expressing the same. Such compounds can be used as therapeutic agents for the treatment of any of a wide variety of symptoms associated with biological disorders or imbalances.

4. DESCRIPTION OF THE SEQUENCE LISTING ANDFIGURES

The Sequence Listing provides the sequences of a NHP ORF that encodes the described NHP amino acid sequence. SEQ ID NO:3 describes a NHP ORF and flanking regions.

5. DETAILED DESCRIPTION OF THE INVENTION

The NHP described for the first time herein is a novel protein that is expressed in, inter alia, human fetal brain, brain, cerebellum, spinal cord, thymus, trachea, kidney, fetal liver, liver, prostate, testis, adrenal gland, pancreas, salivarygland, stomach, small intestine, colon, skeletal muscle, uterus, mammary gland, esophagus, bladder, cervix, rectum, pericardium, hypothalamus, and gene trapped human cell lines.

The present invention encompasses the nucleotides presented in the Sequence Listing, host cells expressing such nucleotides, the expression products of such nucleotides, and: (a) nucleotides that encode mammalian homologs of the describedpolynucleotide, including the specifically described NHP, and related NHP products; (b) nucleotides that encode one or more portions of the NHP corresponding to NHP functional domain(s), and the polypeptide products specified by such nucleotidesequences, including but not limited to the novel regions of any active domain(s); (c) isolated nucleotides that encode mutant versions, engineered or naturally occurring, of the described NHP in which all or a part of at least one domain is deleted oraltered, and the polypeptide products specified by such nucleotide sequences, including but not limited to soluble proteins and peptides in which all or a portion of the signal sequence is deleted; (d) nucleotides that encode chimeric fusion proteinscontaining all or a portion of a coding region of a NHP, or one of its domains (e.g., a receptor or ligand binding domain, accessory protein/self-association domain, etc.) fused to another peptide or polypeptide; or (e) therapeutic or diagnosticderivatives of the described polynucleotides such as oligonucleotides, antisense polynucleotides, ribozymes, dsRNA, or gene therapy constructs comprising a sequence first disclosed in the Sequence Listing. As discussed above, the present inventionincludes: (a) the human DNA sequences presented in the Sequence Listing (and vectors comprising the same) and additionally contemplates any nucleotide sequence encoding a contiguous NHP open reading frame (ORF) that hybridizes to a complement of a DNAsequence presented in the Sequence Listing under highly stringent conditions, e.g., hybridization to filter-bound DNA in 0.5 M NaHPO4, 7% sodium dodecyl sulfate (SDS), 1 mM EDTA at 65° C., and washing in 0.1×SSC/0.1% SDS at 68° C. (Ausubel F. M. et al., eds., 1989, Current Protocols in Molecular Biology, Vol. I, Green Publishing Associates, Inc., and John Wiley & sons, Inc., New York, at p. 2.10.3) and encodes a functionally equivalent gene product. Additionally contemplatedare any nucleotide sequences that hybridize to the complement of the DNA sequence that encode and express an amino acid sequence presented in the Sequence Listing under moderately stringent conditions, e.g., washing in 0.2×SSC/0.1% SDS at42° C. (Ausubel et al., 1989, supra), yet still encode a functionally equivalent NHP product. Functional equivalents of NHP include naturally occurring NHPs present in other species and mutant NHPs whether naturally occurring or engineered (bysite directed mutagenesis, gene shuffling, directed evolution as described in, for example, U.S. Pat. No. 5,837,458). The invention also includes degenerate nucleic acid variants of the disclosed NHP polynucleotide sequence.

Additionally contemplated are polynucleotides encoding NHP ORFs, or their functional equivalents, encoded by polynucleotide sequences that are about 99, 95, 90, or about 85 percent similar or identical to corresponding regions of the nucleotidesequences of the Sequence Listing (as measured by BLAST sequence comparison analysis using, for example, the GCG sequence analysis package using standard default settings).

The invention also includes nucleic acid molecules, preferably DNA molecules, that hybridize to, and are therefore the complements of, the described NHP nucleotide sequences. Such hybridization conditions may be highly stringent or less highlystringent, as described above. In instances where the nucleic acid molecules are deoxyoligonucleotides ("DNA oligos"), such molecules are generally about 16 to about 100 bases long, or about 20 to about 80, or about 34 to about 45 bases long, or anyvariation or combination of sizes represented therein that incorporate a contiguous region of sequence first disclosed in the Sequence Listing. Such oligonucleotides can be used in conjunction with the polymerase chain reaction (PCR) to screenlibraries, isolate clones, and prepare cloning and sequencing templates, etc.

Alternatively, such NHP oligonucleotides can be used as hybridization probes for screening libraries, and assessing gene expression patterns (particularly using a micro array or high-throughput "chip" format). Additionally, a series of thedescribed NHP oligonucleotide sequences, or the complements thereof, can be used to represent all or a portion of the described NHP sequences. An oligonucleotide or polynucleotide sequence first disclosed in at least a portion of one or more of thesequences of SEQ ID NOS: 1-3 can be used as a hybridization probe in conjunction with a solid support matrix/substrate (resins, beads, membranes, plastics, polymers, metal or metallized substrates, crystalline or polycrystalline substrates, etc.). Ofparticular note are spatially addressable arrays (i.e., gene chips, microtiter plates, etc.) of oligonucleotides and polynucleotides, or corresponding oligopeptides and polypeptides, wherein at least one of the biopolymers present on the spatiallyaddressable array comprises an oligonucleotide or polynucleotide sequence first disclosed in at least one of the sequences of SEQ ID NOS: 1-3, or an amino acid sequence encoded thereby. Methods for attaching biopolymers to, or synthesizing biopolymerson, solid support matrices, and conducting binding studies thereon are disclosed in, inter alia, U.S. Pat. Nos. 5,700,637, 5,556,752, 5,744,305, 4,631,211, 5,445,934, 5,252,743, 4,713,326, 5,424,186, and 4,689,405 the disclosures of which are hereinincorporated by reference in their entirety.

Addressable arrays comprising sequences first disclosed in SEQ ID NOS:1-3 can be used to identify and characterize the temporal and tissue specific expression of a gene. These addressable arrays incorporate oligonucleotide sequences ofsufficient length to confer the required specificity, yet be within the limitations of the production technology. The length of these probes is within a range of between about 8 to about 2000 nucleotides. Preferably the probes consist of 60 nucleotidesand more preferably 25 nucleotides from the sequences first disclosed in SEQ ID NOS:1-3.

For example, a series of the described oligonucleotide sequences, or the complements thereof, can be used in chip format to represent all or a portion of the described sequences. The oligonucleotides, typically between about 16 to about 40 (orany whole number within the stated range) nucleotides in length can partially overlap each other and/or the sequence may be represented using oligonucleotides that do not overlap. Accordingly, the described polynucleotide sequences shall typicallycomprise at least about two or three distinct oligonucleotide sequences of at least about 8 nucleotides in length that are each first disclosed in the described Sequence Listing. Such oligonucleotide sequences can begin at any nucleotide present withina sequence in the Sequence Listing and proceed in either a sense (5'-to-3') orientation vis-a-vis the described sequence or in an antisense orientation.

Microarray-based analysis allows the discovery of broad patterns of genetic activity, providing new understanding of gene functions and generating novel and unexpected insight into transcriptional processes and biological mechanisms. The use ofaddressable arrays comprising sequences first disclosed in SEQ ID NOS:1-3 provides detailed information about transcriptional changes involved in a specific pathway, potentially leading to the identification of novel components or gene functions thatmanifest themselves as novel phenotypes.

Probes consisting of sequences first disclosed in SEQ ID NOS:1-3 can also be used in the identification, selection and validation of novel molecular targets for drug discovery. The use of these unique sequences permits the direct confirmation ofdrug targets and recognition of drug dependent changes in gene expression that are modulated through pathways distinct from the drugs intended target. These unique sequences therefore also have utility in defining and monitoring both drug action andtoxicity.

As an example of utility, the sequences first disclosed in SEQ ID NOS:1-3 can be utilized in microarrays or other assay formats, to screen collections of genetic material from patients who have a particular medical condition. Theseinvestigations can also be carried out using the sequences first disclosed in SEQ ID NOS:1-3 in silico and by comparing previously collected genetic databases and the disclosed sequences using computer software known to those in the art.

Thus the sequences first disclosed in SEQ ID NOS:1-3 can be used to identify mutations associated with a particular disease and also as a diagnostic or prognostic assay.

Although the presently described sequences have been specifically described using nucleotide sequence, it should be appreciated that each of the sequences can uniquely be described using any of a wide variety of additional structural attributes,or combinations thereof. For example, a given sequence can be described by the net composition of the nucleotides present within a given region of the sequence in conjunction with the presence of one or more specific oligonucleotide sequence(s) firstdisclosed in the SEQ ID NOS:1-3. Alternatively, a restriction map specifying the relative positions of restriction endonuclease digestion sites, or various palindromic or other specific oligonucleotide sequences can be used to structurally describe agiven sequence. Such restriction maps, which are typically generated by widely available computer programs (e.g., the University of Wisconsin GCG sequence analysis package, SEQUENCHER 3.0, Gene Codes Corp., Ann Arbor, Mich., etc.), can optionally beused in conjunction with one or more discrete nucleotide sequence(s) present in the sequence that can be described by the relative position of the sequence relatve to one or more additional sequence(s) or one or more restriction sites present in thedisclosed sequence.

For oligonucleotide probes, highly stringent conditions may refer, e.g., to washing in 6×SSC/0.05% sodium pyrophosphate at 37° C. (for 14-base oligos), 48° C. (for 17-base oligos), 55° C. (for 20-base oligos), and60° C. (for 23-base oligos). These nucleic acid molecules may encode or act as NHP gene antisense molecules, useful, for example, in NHP gene regulation (for and/or as antisense primers in amplification reactions of NHP gene nucleic acidsequences). With respect to NHP gene regulation, such techniques can be used to regulate biological functions. Further, such sequences may be used as part of ribozyme and/or triple helix sequences that are also useful for NHP gene regulation.

Inhibitory antisense or double stranded oligonucleotides can additionally comprise at least one modified base moiety which is selected from the group including but not limited to 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil,hypoxanthine, xantine, 4-acetylcytosine, 5-(carboxyhydroxylmethyl)uracil, 5-carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylaminomethyluracil, dihydrouracil, beta-D-galactosylqueosine, inosine, N6-isopentenyladenine, 1-methylguanine,1-methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-adenine, 7-methylguanine, 5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, beta-D-mannosylqueosine, 5'-methoxycarboxymethyluracil,5-methoxyuracil, 2-methylthio-N6-isopentenyladenine, uracil-5-oxyacetic acid (v), wybutoxosine, pseudouracil, queosine, 2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil, uracil-5-oxyacetic acid methylester,uracil-5-oxyacetic acid (v), 5-methyl-2-thiouracil, 3-(3-amino-3-N-2-carboxypropyl)uracil, (acp3)w, and 2,6-diaminopurine.

The antisense oligonucleotide can also comprise at least one modified sugar moiety selected from the group including but not limited to arabinose, 2-fluoroarabinose, xylulose, and hexose.

In yet another embodiment, the antisense oligonucleotide will comprise at least one modified phosphate backbone selected from the group consisting of a phosphorothioate, a phosphorodithioate, a phosphoramidothioate, a phosphoramidate, aphosphordiamidate, a methylphosphonate, an alkyl phosphotriester, and a formacetal or any combination or analog thereof.

In yet another embodiment, the antisense oligonucleotide is an α-anomeric oligonucleotide. An α-anomeric oligonucleotide forms specific double-stranded hybrids with complementary RNA in which, contrary to the usual β-units, thestrands run parallel to each other (Gautier et al., 1987, Nucl. Acids Res. 15:6625-6641). The oligonucleotide is a 2'-0-methylribonucleotide (Inoue et al., 1987, Nucl. Acids Res. 15:6131-6148), or a chimeric RNA-DNA analogue (Inoue et al., 1987,FEBS Lett. 215:327-330). Alternatively, double stranded RNA can be used to disrupt the expression and function of a targeted NHP.

Oligonucleotides of the invention can be synthesized by standard methods known in the art, e.g. by use of an automated DNA synthesizer (such as are commercially available from Biosearch, Applied Biosystems, etc.). As examples, phosphorothioateoligonucleotides can be synthesized by the method of Stein et al. (1988, Nucl. Acids Res. 16:3209), and methylphosphonate oligonucleotides can be prepared by use of controlled pore glass polymer supports (Sarin et al., 1988, Proc. Natl. Acad. Sci. U.S.A. 85:7448-7451), etc.

Low stringency conditions are well known to those of skill in the art, and will vary predictably depending on the specific organisms from which the library and the labeled sequences are derived. For guidance regarding such conditions see, forexample, Sambrook et al., 1989, Molecular Cloning, A Laboratory Manual (and periodic updates thereof), Cold Springs Harbor Press, N.Y.; and Ausubel et al., 1989, Current Protocols in Molecular Biology, Green Publishing Associates and Wiley Interscience,N.Y.

Alternatively, suitably labeled NHP nucleotide probes can be used to screen a human genomic library using appropriately stringent conditions or by PCR. The identification and characterization of human genomic clones is helpful for identifyingpolymorphisms (including, but not limited to, nucleotide repeats, microsatellite alleles, single nucleotide polymorphisms, or coding single nucleotide polymorphisms), determining the genomic structure of a given locus/allele, and designing diagnostictests. For example, sequences derived from regions adjacent to the intron/exon boundaries of the human gene can be used to design primers for use in amplification assays to detect mutations within the exons, introns, splice sites (e.g., splice acceptorand/or donor sites), etc., that can be used in diagnostics and pharmacogenomics.

Further, a NHP gene homolog can be isolated from nucleic acid from an organism of interest by performing PCR using two degenerate or "wobble" oligonucleotide primer pools designed on the basis of amino acid sequences within the NHP productsdisclosed herein. The template for the reaction may be total RNA, mRNA, and/or cDNA obtained by reverse transcription of mRNA prepared from human or non-human cell lines or tissue known or suspected to express an allele of a NHP gene. The PCR productcan be subcloned and sequenced to ensure that the amplified sequences represent the sequence of the desired NHP gene. The PCR fragment can then be used to isolate a full length cDNA clone by a variety of methods. For example, the amplified fragment canbe labeled and used to screen a cDNA library, such as a bacteriophage cDNA library. Alternatively, the labeled fragment can be used to isolate genomic clones via the screening of a genomic library.

PCR technology can also be used to isolate full length cDNA sequences. For example, RNA can be isolated, following standard procedures, from an appropriate cellular or tissue source (i.e., one known, or suspected, to express a NHP gene, such as,for example, testis tissue). A reverse transcription (RT) reaction can be performed on the RNA using an oligonucleotide primer specific for the most 5' end of the amplified fragment for the priming of first strand synthesis. The resulting RNA/DNAhybrid may then be "tailed" using a standard terminal transferase reaction, the hybrid may be digested with RNase H, and second strand synthesis may then be primed with a complementary primer. Thus, cDNA sequences upstream of the amplified fragment canbe isolated. For a review of cloning strategies that can be used, see e.g., Sambrook et al., 1989, supra.

A cDNA encoding a mutant NHP gene can be isolated, for example, by using PCR. In this case, the first cDNA strand may be synthesized by hybridizing an oligo-dT oligonucleotide to mRNA isolated from tissue known or suspected to be expressed in anindividual putatively carrying a mutant NHP allele, and by extending the new strand with reverse transcriptase. The second strand of the cDNA is then synthesized using an oligonucleotide that hybridizes specifically to the 5' end of the normal gene. Using these two primers, the product is then amplified via PCR, optionally cloned into a suitable vector, and subjected to DNA sequence analysis through methods well known to those of skill in the art. By comparing the DNA sequence of the mutant NHPallele to that of a corresponding normal NHP allele, the mutation(s) responsible for the loss or alteration of function of the mutant NHP gene product can be ascertained.

Alternatively, a genomic library can be constructed using DNA obtained from an individual suspected of or known to carry a mutant NHP allele (e.g., a person manifesting a NHP-associated phenotype such as, for example, obesity, high bloodpressure, an inflammatory disorder, etc.), or a cDNA library can be constructed using RNA from a tissue known, or suspected, to express a mutant NHP allele. A normal NHP gene, or any suitable fragment thereof, can then be labeled and used as a probe toidentify the corresponding mutant NHP allele in such libraries. Clones containing mutant NHP gene sequences can then be purified and subjected to sequence analysis according to methods well known to those skilled in the art.

Additionally, an expression library can be constructed utilizing cDNA synthesized from, for example, RNA isolated from a tissue known, or suspected, to express a mutant NHP allele in an individual suspected of or known to carry such a mutantallele. In this manner, gene products made by the putatively mutant tissue can be expressed and screened using standard antibody screening techniques in conjunction with antibodies raised against a normal NHP product, as described below. (For screeningtechniques, see, for example, Harlow, E. and Lane, eds., 1988, "Antibodies: A Laboratory Manual", Cold Spring Harbor Press, Cold Spring Harbor, N.Y.)

Additionally, screening can be accomplished by screening with labeled NHP fusion proteins, such as, for example, alkaline phosphatase-NHP or NHP-alkaline phosphatase fusion proteins. In cases where a NHP mutation results in an expressed geneproduct with altered function (e.g., as a result of a missense or a frameshift mutation), polyclonal antibodies to a NHP are likely to cross-react with a corresponding mutant NHP gene product. Library clones detected via their reaction with such labeledantibodies can be purified and subjected to sequence analysis according to methods well known in the art.

The invention also encompasses (a) DNA vectors that contain any of the foregoing NHP coding sequences and/or their complements (i.e., antisense); (b) DNA expression vectors that contain any of the foregoing NHP coding sequences operativelyassociated with a regulatory element that directs the expression of the coding sequences (for example, baculo virus as described in U.S. Pat. No. 5,869,336 herein incorporated by reference); (c) genetically engineered host cells that contain any of theforegoing NHP coding sequences operatively associated with a regulatory element that directs the expression of the coding sequences in the host cell; and (d) genetically engineered host cells that express an endogenous NHP gene under the control of anexogenously introduced regulatory element (i.e., gene activation). As used herein, regulatory elements include, but are not limited to, inducible and non-inducible promoters, enhancers, operators and other elements known to those skilled in the art thatdrive and regulate expression. Such regulatory elements include but are not limited to the cytomegalovirus (hCMV) immediate early gene, regulatable, viral elements (particularly retroviral LTR promoters), the early or late promoters of SV40 adenovirus,the lac system, the trp system, the TAC system, the TRC system, the major operator and promoter regions of phage lambda, the control regions of fd coat protein, the promoter for 3-phosphoglycerate kinase (PGK), the promoters of acid phosphatase, and thepromoters of the yeast α-mating factors.

The present invention also encompasses antibodies and anti-idiotypic antibodies (including Fab fragments), antagonists and agonists of the NHP, as well as compounds or nucleotide constructs that inhibit expression of a NHP gene (transcriptionfactor inhibitors, antisense and ribozyme molecules, or gene or regulatory sequence replacement constructs), or promote the expression of a NHP (e.g., expression constructs in which a NHP coding sequence is operatively associated with expression controlelements such as promoters, promoter/enhancers, etc.).

The NHP or NHP peptides, NHP fusion proteins, NHP nucleotide sequences, antibodies, antagonists and agonists can be useful for the detection of mutant NHPs or inappropriately expressed NHPs for the diagnosis of disease. The NHP or NHP peptides,NHP fusion proteins, NHP nucleotide sequences, host cell expression systems, antibodies, antagonists, agonists and genetically engineered cells and animals can be used for screening for drugs (or high throughput screening of combinatorial libraries)effective in the treatment of the symptomatic or phenotypic manifestations of perturbing the normal function of NHP in the body. The use of engineered host cells and/or animals may offer an advantage in that such systems allow not only for theidentification of compounds that bind to the endogenous receptor for a NHP, but can also identify compounds that trigger NHP-mediated activities or pathways.

Finally, the NHP products can be used as therapeutics. For example, soluble derivatives such as a mature NHP, or NHP peptides/domains corresponding to the NHP, NHP fusion protein products (especially NHP-Ig fusion proteins, i.e., fusions of aNHP, or a domain of a NHP, to an IgFc), NHP antibodies and anti-idiotypic antibodies (including Fab fragments), antagonists or agonists (including compounds that modulate or act on downstream targets in a NHP-mediated pathway) can be used to directlytreat diseases or disorders. For instance, the administration of an effective amount of soluble NHP, or a NHP-IgFc fusion protein or an anti-idiotypic antibody (or its Fab) that mimics the NHP could activate or effectively antagonize the endogenous NHPreceptor. Soluble NHP can also be modified by proteolytic cleavage to active peptide products (e.g., any novel peptide sequence initiating at any one of the amino acids presented in the Sequence Listing and ending at any downstream amino acid). Suchproducts or peptides can be further subject to modification such as the construction of NHP fusion proteins and/or can be derivatized by being combined with pharmaceutically acceptable agents such as, but not limited to, polyethylene glycol (PEG).

Nucleotide constructs encoding such NHP products can be used to genetically engineer host cells to express such products in vivo; these genetically engineered cells function as "bioreactors" in the body delivering a continuous supply of a NHP, aNHP peptide, or a NHP fusion protein to the body. Nucleotide constructs encoding a functional NHP, mutant NHPs, as well as antisense and ribozyme molecules can also be used in "gene therapy" approaches for the modulation of NHP expression. Thus, theinvention also encompasses pharmaceutical formulations and methods for treating biological disorders.

Various aspects of the invention are described in greater detail in the subsections below.

5.1 THE NHP SEQUENCES

The cDNA sequence (SEQ ID NO: 1) and the corresponding deduced amino acid sequence (SEQ ID NO: 2) of the described NHP are presented in the Sequence Listing. The NHP nucleotides were obtained by aligning human EST sequences and cDNA clones froma HUVEC cDNA library (Edge Biosystems, Gaithersburg, MD). The "y" at position 951 of SEQ ID NO:1 represents a translationally silent C or T polymorphism, and the "y" displayed at position 2,110 of SEQ ID NO:1 represents a C or T polymorphism that canresult in either a P or a S at corresponding amino acid position 704 of SEQ ID NO:2.

An additional application of the described novel human polynucleotide sequences is their use in the molecular mutagenesis/evolution of proteins that are at least partially encoded by the described novel sequences using, for example,polynucleotide shuffling or related methodologies. Such approaches are described in U.S. Pat. Nos. 5,830,721 and 5,837,458 which are herein incorporated by reference in their entirety.

NHP gene products can also be expressed in transgenic animals. Animals of any species, including, but not limited to, worms, mice, rats, rabbits, guinea pigs, pigs, micro-pigs, birds, goats, and non-human primates, e.g., baboons, monkeys, andchimpanzees may be used to generate NHP transgenic animals.

Any technique known in the art may be used to introduce a NHP transgene into animals to produce the founder lines of transgenic animals. Such techniques include, but are not limited to pronuclear microinjection (Hoppe, P. C. and Wagner, T. E.,1989, U.S. Pat. No. 4,873,191); retrovirus mediated gene transfer into germ lines (Van der Putten et al., 1985, Proc. Natl. Acad. Sci., USA 82:6148-6152); gene targeting in embryonic stem cells (Thompson et al., 1989, Cell 56:313-321);electroporation of embryos (Lo, 1983, Mol Cell. Biol. 3:1803-1814); and sperm-mediated gene transfer (Lavitrano et al ., 1989, Cell 57:717-723); etc. For a review of such techniques, see Gordon, 1989, Transgenic Animals, Intl. Rev. Cytol. 115:171-229, which is incorporated by reference herein in its entirety.

The present invention provides for transgenic animals that carry the NHP transgene in all their cells, as well as animals which carry the transgene in some, but not all their cells, i.e., mosaic animals or somatic cell transgenic animals. Thetransgene may be integrated as a single transgene or in concatamers, e.g., head-to-head tandems or head-to-tail tandems. The transgene may also be selectively introduced into and activated in a particular cell type by following, for example, theteaching of Lasko et al., 1992, Proc. Natl. Acad. Sci. USA 89:6232-6236. The regulatory sequences required for such a cell-type specific activation will depend upon the particular cell type of interest, and will be apparent to those of skill in theart.

When it is desired that a NHP transgene be integrated into the chromosomal site of the endogenous NHP gene, gene targeting is preferred. Briefly, when such a technique is to be utilized, vectors containing some nucleotide sequences homologous tothe endogenous NHP gene are designed for the purpose of integrating, via homologous recombination with chromosomal sequences, into and disrupting the function of the nucleotide sequence of the endogenous NHP gene (i.e., "knockout" animals).

The transgene can also be selectively introduced into a particular cell type, thus inactivating the endogenous NHP gene in only that cell type, by following, for example, the teaching of Gu et al., 1994, Science, 265:103-106. The regulatorysequences required for such a cell-type specific inactivation will depend upon the particular cell type of interest, and will be apparent to those of skill in the art.

Once transgenic animals have been generated, the expression of the recombinant NHP gene may be assayed utilizing standard techniques. Initial screening may be accomplished by Southern blot analysis or PCR techniques to analyze animal tissues toassay whether integration of the transgene has taken place. The level of mRNA expression of the transgene in the tissues of the transgenic animals may also be assessed using techniques which include but are not limited to Northern blot analysis oftissue samples obtained from the animal, in situ hybridization analysis, and RT-PCR. Samples of NHP gene-expressing tissue, may also be evaluated immunocytochemically using antibodies specific for the NHP transgene product.

5.2 NHP AND NHP POLYPEPTIDES

The described NHP, NHP polypeptides, NHP peptide fragments, mutated, truncated, or deleted forms of the NHP, and/or NHP fusion proteins can be prepared for a variety of uses. These uses include, but are not limited to, the generation ofantibodies, as reagents in diagnostic assays, the identification of other cellular gene products related to a NHP, as reagents in assays for screening for compounds that can be used as pharmaceutical reagents useful in the therapeutic treatment ofmental, biological, or medical disorders and disease.

The Sequence Listing discloses the amino acid sequences encoded by the described NHP polynucleotides. The NHP displays an initiator methionine in a DNA sequence context consistent with a translation initiation site, and further incorporates ahydrophobic leader sequence as typically found in secreted proteins.

The NHP amino acid sequence of the invention includes the amino acid sequence presented in the Sequence Listing as well as analogues and derivatives thereof. Further, corresponding NHP homologues from other species are encompassed by theinvention. In fact, any NHP product encoded by the NHP nucleotide sequences described above are within the scope of the invention, as are any novel polynucleotide sequences encoding all or any novel portion of an amino acid sequence presented in theSequence Listing. The degenerate nature of the genetic code is well known, and, accordingly, each amino acid presented in the Sequence Listing, is generically representative of the well known nucleic acid "triplet" codon, or in many cases codons, thatcan encode the amino acid. As such, as contemplated herein, the amino acid sequences presented in the Sequence Listing, when taken together with the genetic code (see, for example, Table 4-1 at page 109 of "Molecular Cell Biology", 1986, J. Darnell etal. eds., Scientific American Books, New York, N.Y., herein incorporated by reference) are generically representative of all the various permutations and combinations of nucleic acid sequences that can encode such amino acid sequences.

The invention also encompasses proteins that are functionally equivalent to the NHP encoded by the presently described nucleotide sequences as judged by any of a number of criteria, including, but not limited to, the ability to bind and cleave asubstrate of a NHP, or the ability to effect an identical or complementary downstream pathway, or a change in cellular metabolism (e.g., proteolytic activity, ion flux, tyrosine phosphorylation, etc.). Such functionally equivalent NHP proteins include,but are not limited to, additions or substitutions of amino acid residues within the amino acid sequence encoded by the NHP nucleotide sequences described above, but which result in a silent change, thus producing a functionally equivalent gene product. Amino acid substitutions may be made on the basis of similarity in polarity, charge, solubility, hydrophobicity, hydrophilicity, and/or the amphipathic nature of the residues involved. For example, nonpolar (hydrophobic) amino acids include alanine,leucine, isoleucine, valine, proline, phenylalanine, tryptophan, and methionine; polar neutral amino acids include glycine, serine, threonine, cysteine, tyrosine, asparagine, and glutamine; positively charged (basic) amino acids include arginine, lysine,and histidine; and negatively charged (acidic) amino acids include aspartic acid and glutamic acid.

A variety of host-expression vector systems can be used to express the NHP nucleotide sequences of the invention. Where, as in the present instance, the NHP peptide or polypeptide is thought to be a soluble or secreted molecule, the peptide orpolypeptide can be recovered from the culture media. Such expression systems also encompass engineered host cells that express a NHP, or functional equivalent, in situ. Purification or enrichment of a NHP from such expression systems can beaccomplished using appropriate detergents and lipid micelles and methods well known to those skilled in the art. However, such engineered host cells themselves may be used in situations where it is important not only to retain the structural andfunctional characteristics of the NHP, but to assess biological activity, e.g., in drug screening assays.

The expression systems that may be used for purposes of the invention include but are not limited to microorganisms such as bacteria (e.g., E. coli, B. subtilis) transformed with recombinant bacteriophage DNA, plasmid DNA or cosmid DNA expressionvectors containing NHP nucleotide sequences; yeast (e.g., Saccharomyces, Pichia) transformed with recombinant yeast expression vectors containing NHP nucleotide sequences; insect cell systems infected with recombinant virus expression vectors (e.g.,baculovirus) containing NHP sequences; plant cell systems infected with recombinant virus expression vectors (e.g., cauliflower mosaic virus, CaMV; tobacco mosaic virus, TMV) or transformed with recombinant plasmid expression vectors (e.g., Ti plasmid)containing NHP nucleotide sequences; or mammalian cell systems (e.g., COS, CHO, BHK, 293, 3T3) harboring recombinant expression constructs containing promoters derived from the genome of mammalian cells (e.g., metallothionein promoter) or from mammalianviruses (e.g., the adenovirus late promoter; the vaccinia virus 7.5K promoter).

In bacterial systems, a number of expression vectors may be advantageously selected depending upon the use intended for the NHP product being expressed. For example, when a large quantity of such a protein is to be produced for the generation ofpharmaceutical compositions of or containing NHP, or for raising antibodies to a NHP, vectors that direct the expression of high levels of fusion protein products that are readily purified may be desirable. Such vectors include, but are not limited, tothe E. coli expression vector pUR278 (Ruther et al., 1983, EMBO J. 2:1791), in which a NHP coding sequence may be ligated individually into the vector in frame with the lacZ coding region so that a fusion protein is produced; pIN vectors (Inouye &Inouye, 1985, Nucleic Acids Res. 13:3101-3109; Van Heeke & Schuster, 1989, J. Biol. Chem. 264:5503-5509); and the like. pGEX vectors (Pharmacia or American Type Culture Collection) can also be used to express foreign polypeptides as fusion proteinswith glutathione S-transferase (GST). In general, such fusion proteins are soluble and can easily be purified from lysed cells by adsorption to glutathione-agarose beads followed by elution in the presence of free glutathione. The PGEX vectors aredesigned to include thrombin or factor Xa protease cleavage sites so that the cloned target gene product can be released from the GST moiety.

In an insect system, Autographa californica nuclear polyhidrosis virus (AcNPV) is used as a vector to express foreign polynucleotides. The virus grows in Spodoptera frugiperda cells. A NHP coding sequence may be cloned individually intonon-essential regions (for example the polyhedrin gene) of the virus and placed under control of an AcNPV promoter (for example the polyhedrin promoter). Successful insertion of NHP coding sequence will result in inactivation of the polyhedrin gene andproduction of non-occluded recombinant virus (i.e., virus lacking the proteinaceous coat coded for by the polyhedrin gene). These recombinant viruses are then used to infect Spodoptera frugiperda cells in which the inserted polynucleotide is expressed(e.g., see Smith et al., 1983, J. Virol. 46: 584; Smith, U.S. Pat. No. 4,215,051).

In mammalian host cells, a number of viral-based expression systems can be utilized. In cases where an adenovirus is used as an expression vector, the NHP nucleotide sequence of interest may be ligated to an adenovirus transcription/translationcontrol complex, e.g., the late promoter and tripartite leader sequence. This chimeric gene may then be inserted in the adenovirus genome by in vitro or in vivo recombination. Insertion in a non-essential region of the viral genome (e.g., region E1 orE3) will result in a recombinant virus that is viable and capable of expressing a NHP product in infected hosts (e.g., See Logan & Shenk, 1984, Proc. Natl. Acad. Sci. USA 81:3655-3659). Specific initiation signals may also be required for efficienttranslation of inserted NHP nucleotide sequences. These signals include the ATG initiation codon and adjacent sequences. In cases where an entire NHP gene or cDNA, including its own initiation codon and adjacent sequences, is inserted into theappropriate expression vector, no additional translational control signals may be needed. However, in cases where only a portion of a NHP coding sequence is inserted, exogenous translational control signals, including, perhaps, the ATG initiation codon,must be provided. Furthermore, the initiation codon must be in phase with the reading frame of the desired coding sequence to ensure translation of the entire insert. These exogenous translational control signals and initiation codons can be of avariety of origins, both natural and synthetic. The efficiency of expression may be enhanced by the inclusion of appropriate transcription enhancer elements, transcription terminators, etc. (See Bitter et al., 1987, Methods in Enzymol. 153:516-544).

In addition, a host cell strain may be chosen that modulates the expression of the inserted sequences, or modifies and processes the gene product in the specific fashion desired. Such modifications (e.g., glycosylation) and processing (e.g.,cleavage) of protein products may be important for the function of the protein. Different host cells have characteristic and specific mechanisms for the post-translational processing and modification of proteins and gene products. Appropriate celllines or host systems can be chosen to ensure the correct modification and processing of the foreign protein expressed. To this end, eukaryotic host cells which possess the cellular machinery for proper processing of the primary transcript,glycosylation, and phosphorylation of the gene product may be used. Such mammalian host cells include, but are not limited to, CHO, VERO, BHK, HeLa, COS, MDCK, 293, 3T3, WI38, and in particular, human cell lines.

For long-term, high-yield production of recombinant proteins, stable expression is preferred. For example, cell lines which stably express the NHP sequences described above can be engineered. Rather than using expression vectors which containviral origins of replication, host cells can be transformed with DNA controlled by appropriate expression control elements (e.g., promoter, enhancer sequences, transcription terminators, polyadenylation sites, etc.), and a selectable marker. Followingthe introduction of the foreign DNA, engineered cells may be allowed to grow for 1-2 days in an enriched media, and then are switched to a selective media. The selectable marker in the recombinant plasmid confers resistance to the selection and allowscells to stably integrate the plasmid into their chromosomes and grow to form foci which in turn can be cloned and expanded into cell lines. This method may advantageously be used to engineer cell lines which express the NHP product. Such engineeredcell lines may be particularly useful in screening and evaluation of compounds that affect the endogenous activity of the NHP product.

A number of selection systems may be used, including but not limited to the herpes simplex virus thymidine kinase (Wigler, et al., 1977, Cell 11:223), hypoxanthine-guanine phosphoribosyltransferase (Szybalska & Szybalski, 1962, Proc. Natl. Acad. Sci. USA 48:2026), and adenine phosphoribosyltransferase (Lowy, et al., 1980, Cell 22:817) genes can be employed in tk-, hgprt- or aprt- cells, respectively. Also, antimetabolite resistance can be used as the basis of selectionfor the following genes: dhfr, which confers resistance to methotrexate (Wigler, et al., 1980, Natl. Acad. Sci. USA 77:3567; O'Hare, et al., 1981, Proc. Natl. Acad. Sci. USA 78:1527); gpt, which confers resistance to mycophenolic acid (Mulligan &Berg, 1981, Proc. Natl. Acad. Sci. USA 78:2072); neo, which confers resistance to the aminoglycoside G-418 (Colberre-Garapin, et al., 1981, J. Mol. Biol. 150:1); and hygro, which confers resistance to hygromycin (Santerre, et al., 1984, Gene30:147).

Alternatively, any fusion protein can be readily purified by utilizing an antibody specific for the fusion protein being expressed. For example, a system described by Janknecht et al. allows for the ready purification of non-denatured fusionproteins expressed in human cell lines (Janknecht, et al., 1991, Proc. Natl. Acad. Sci. USA 88:8972-8976). In this system, the polynucleotide of interest is subcloned into a vaccinia recombination plasmid such that the gene's open reading frame istranslationally fused to an amino-terminal tag consisting of six histidine residues. Extracts from cells infected with recombinant vaccinia virus are loaded onto Ni2 -nitriloacetic acid-agarose columns and histidine-tagged proteins are selectivelyeluted with imidazole-containing buffers.

Also encompassed by the present invention are fusion proteins that direct the NHP to a target organ and/or facilitate transport across the membrane into the cytosol. Conjugation of NHPs to antibody molecules or their Fab fragments could be usedto target cells bearing a particular epitope. Attaching the appropriate signal sequence to the NHP would also transport the NHP to the desired location within the cell. Alternatively targeting of NHP or its nucleic acid sequence might be achieved usingliposome or lipid complex based delivery systems. Such technologies are described in Liposomes:A Practical Approach, New,RRC ed., Oxford University Press, New York and in U.S. Pat. Nos. 4,594,595, 5,459,127, 5,948,767 and 6,110,490 and theirrespective disclosures which are herein incorporated by reference in their entirety. Additionally embodied are novel protein constructs engineered in such a way that they facilitate transport of the NHP to the target site or desired organ. This goalmay be achieved by coupling of the NHP to a cytokine or other ligand that provides targeting specificity, and/or to a protein transducing domain (see generally U.S. applications Ser. No. 60/111,701 and 60/056,713, both of which are herein incorporatedby reference, for examples of such transducing sequences) to facilitate passage across cellular membranes if needed and can optionally be engineered to include nuclear localization sequences when desired.

5.3 ANTIBODIES TO NHP PRODUCTS

Antibodies that specifically recognize one or more epitopes of a NHP, or epitopes of conserved variants of a NHP, or peptide fragments of a NHP are also encompassed by the invention. Such antibodies include but are not limited to polyclonalantibodies, monoclonal antibodies (mAbs), humanized or chimeric antibodies, single chain antibodies, Fab fragments, F(ab')2 fragments, fragments produced by a Fab expression library, anti-idiotypic (anti-Id) antibodies, and epitope-binding fragmentsof any of the above.

The antibodies of the invention may be used, for example, in the detection of NHP in a biological sample and may, therefore, be utilized as part of a diagnostic or prognostic technique whereby patients may be tested for abnormal amounts of NHP. Such antibodies may also be utilized in conjunction with, for example, compound screening schemes for the evaluation of the effect of test compounds on expression and/or activity of a NHP gene product. Additionally, such antibodies can be used inconjunction gene therapy to, for example, evaluate the normal and/or engineered NHP-expressing cells prior to their introduction into the patient. Such antibodies may additionally be used as a method for the inhibition of abnormal NHP activity. Thus,such antibodies may, therefore, be utilized as part of treatment methods.

For the production of antibodies, various host animals may be immunized by injection with the NHP, an NHP peptide (e.g., one corresponding to a functional domain of an NHP), truncated NHP polypeptides (NHP in which one or more domains have beendeleted), functional equivalents of the NHP or mutated variant of the NHP. Such host animals may include but are not limited to pigs, rabbits, mice, goats, and rats, to name but a few. Various adjuvants may be used to increase the immunologicalresponse, depending on the host species, including but not limited to Freund's adjuvant (complete and incomplete), mineral salts such as aluminum hydroxide or aluminum phosphate, surface active substances such as lysolecithin, pluronic polyols,polyanions, peptides, oil emulsions, and potentially useful human adjuvants such as BCG (bacille Calmette-Guerin) and Corynebacterium parvum. Alternatively, the immune response could be enhanced by combination and or coupling with molecules such askeyhole limpet hemocyanin, tetanus toxoid, diptheria toxoid, ovalbumin, cholera toxin or fragments thereof. Polyclonal antibodies are heterogeneous populations of antibody molecules derived from the sera of the immunized animals.

Monoclonal antibodies, which are homogeneous populations of antibodies to a particular antigen, can be obtained by any technique which provides for the production of antibody molecules by continuous cell lines in culture. These include, but arenot limited to, the hybridoma technique of Kohler and Milstein, (1975, Nature 256:495-497; and U.S. Pat. No. 4,376,110), the human B-cell hybridoma technique (Kosbor et al., 1983, Immunology Today 4:72; Cole et al., 1983, Proc. Natl. Acad. Sci. USA80:2026-2030), and the EBV-hybridoma technique (Cole et al., 1985, Monoclonal Antibodies And Cancer Therapy, Alan R. Liss, Inc., pp. 77-96). Such antibodies may be of any immunoglobulin class including IgG, IgM, IgE, IgA, IgD and any subclass thereof. The hybridoma producing the mAb of this invention may be cultivated in vitro or in vivo. Production of high titers of mAbs in vivo makes this the presently preferred method of production.

In addition, techniques developed for the production of "chimeric antibodies" (Morrison et al., 1984, Proc. Natl. Acad. Sci., 81:6851-6855; Neuberger et al., 1984, Nature, 312:604-608; Takeda et al., 1985, Nature, 314:452-454) by splicing thegenes from a mouse antibody molecule of appropriate antigen specificity together with genes from a human antibody molecule of appropriate biological activity can be used. A chimeric antibody is a molecule in which different portions are derived fromdifferent animal species, such as those having a variable region derived from a murine mAb and a human immunoglobulin constant region. Such technologies are described in U.S. Pat. Nos. 6,075,181 and 5,877,397 and their respective disclosures whichare herein incorporated by reference in their entirety. Also encompassed by the present invention is the use of fully humanized monoclonal antibodies as described in U.S. Pat. No. 6,150,584 and respective disclosures which are herein incorporated byreference in their entirety.

Alternatively, techniques described for the production of single chain antibodies (U.S. Pat. No. 4,946,778; Bird, 1988, Science 242:423-426; Huston et al., 1988, Proc. Natl. Acad. Sci. USA 85:5879-5883; and Ward et al., 1989, Nature341:544-546) can be adapted to produce single chain antibodies against NHP gene products. Single chain antibodies are formed by linking the heavy and light chain fragments of the Fv region via an amino acid bridge, resulting in a single chainpolypeptide.

Antibody fragments which recognize specific epitopes may be generated by known techniques. For example, such fragments include, but are not limited to: the F(ab')2 fragments which can be produced by pepsin digestion of the antibody moleculeand the Fab fragments which can be generated by reducing the disulfide bridges of the F(ab')2 fragments. Alternatively, Fab expression libraries may be constructed (Huse et al., 1989, Science, 246:1275-1281) to allow rapid and easy identificationof monoclonal Fab fragments with the desired specificity.

Antibodies to a NHP can, in turn, be utilized to generate anti-idiotype antibodies that "mimic" a given NHP, using techniques well known to those skilled in the art. (See, e.g., Greenspan & Bona, 1993, FASEB J 7(5):437-444; and Nissinoff, 1991,J. Immunol. 147(8):2429-2438). For example antibodies which bind to a NHP domain and competitively inhibit the binding of NHP to its cognate receptor can be used to generate anti-idiotypes that "mimic" the NHP and, therefore, bind and activate orneutralize a receptor. Such anti-idiotypic antibodies or Fab fragments of such anti-idiotypes can be used in therapeutic regimens involving a NHP signaling pathway.

The present invention is not to be limited in scope by the specific embodiments described herein, which are intended as single illustrations of individual aspects of the invention, and functionally equivalent methods and components are within thescope of the invention. Indeed, various modifications of the invention, in addition to those shown and described herein will become apparent to those skilled in the art from the foregoing description. Such modifications are intended to fall within thescope of the appended claims. All cited publications, patents, and patent applications are herein incorporated by reference in their entirety.

>

3 DNA homo sapiens cgccc ggtgcctttt ggctgtgcga agcctccgcagagttggtgg ttccaggatt 6cagaa tgacgttagg aagagaagtg atgtctcctc ttcaggcaat gtcttcctat gtggctg gcagaaatgt tttaagatgg gatctttcac cagagcaaat taaaacaaga gaggagc tcattgtgca gaccaaacag gtgtacgatg ctgttggaat gctcggtatt 24agtaacttacgagaa ctgtctgcag gcactggcag atgtagaagt aaagtatata 3aaagga ccatgctaga ctttccccag catgtatcct ctgacaaaga agtacgagca 36tacag aagcagacaa aagactttct cgttttgata ttgagatgag catgagagga 42atttg agagaattgt tcatttacag gaaacctgtg atctggggaagataaaacct 48cagac gatacttgga aaagtcaatt aaaatgggga aaagaaatgg gctccatctt 54acaag tacagaatga aatcaaatca atgaagaaaa gaatgagtga gctatgtatt 6ttaaca aaaacctcaa tgaggatgat accttccttg tattttccaa ggctgaactt 66tcttc ctgatgatttcattgacagt ttagaaaaga cagatgatga caagtataaa 72cttaa aatatccaca ctatttccct gtcatgaaga aatgttgtat ccctgaaacc 78aagga tggaaatggc ttttaataca aggtgcaaag aggaaaacac cataattttg 84gctac tcccactgcg aaccaaggtg gccaaactac tcggttatag cacacatgct9tcgtcc ttgaaatgaa cactgcaaag agcacaagcc gcgtaacagc ytttctagat 96aagcc agaagttaaa acccttgggt gaagcagaac gagagtttat tttgaatttg gaaaaagg aatgcaaaga caggggtttt gaatatgatg ggaaaatcaa tgcctgggat atattact acatgactca gacagaggaactcaagtatt ccatagacca agagttcctc ggaatact tcccaattga ggtggtcact gaaggcttgc tgaacaccta ccaggagttg gggacttt catttgaaca aatgacagat gctcatgttt ggaacaagag tgttacactt tactgtga aggataaagc tacaggagaa gtattgggac agttctattt ggacctctat aagggaag gaaaatacaa tcatgcggcc tgcttcggtc tccagcctgg ctgccttctg tgatggaa gccggatgat ggcagtggct gccctcgtgg tgaacttctc acagccagtg aggtcgtc cctctctcct gagacacgac gaggtgagga cttactttca tgagtttggt cgtgatgc atcagatttg tgcacagactgattttgcac gatttagcgg aacaaatgtg aactgact ttgtagaggt gccatcgcaa atgcttgaaa attgggtgtg ggacgtcgat cctccgaa gattgtcaaa acattataaa gatggaagcc ctattgcaga cgatctgctt aaaacttg ttgcttctag gctggtcaac acaggtcttc tgaccctgcg ccagattgtt gagcaaag ttgatcagtc tcttcatacc aacacatcgc tggatgctgc aagtgaatat caaatact gctcagaaat attaggagtt gcagctactc caggcacaaa tatgccagct ctttggac atttggcagg gggatacgat ggccaatatt atggatatct ttggagtgaa attttcca tggatatgtt ttacagctgttttaaaaaag aagggataat gaatccagag tggaatga aatacagaaa cctaatcctg aaacctgggg gatctctgga cggcatggac 2ctccaca atttcttgaa acgtgagcca aaccaaaaag cgttcctaat gagtagaggc 2catgcty cgtga 2homo sapiens 2 Met Ile Ala Arg Cys Leu LeuAla Val Arg Ser Leu Arg Arg Val Gly Ser Arg Ile Leu Leu Arg Met Thr Leu Gly Arg Glu Val Met Ser 2 Pro Leu Gln Ala Met Ser Ser Tyr Thr Val Ala Gly Arg Asn Val Leu 35 4g Trp Asp Leu Ser Pro Glu Gln Ile Lys Thr Arg Thr Glu GluLeu 5 Ile Val Gln Thr Lys Gln Val Tyr Asp Ala Val Gly Met Leu Gly Ile 65 7 Glu Glu Val Thr Tyr Glu Asn Cys Leu Gln Ala Leu Ala Asp Val Glu 85 9l Lys Tyr Ile Val Glu Arg Thr Met Leu Asp Phe Pro Gln His Val Ser Asp LysGlu Val Arg Ala Ala Ser Thr Glu Ala Asp Lys Arg Ser Arg Phe Asp Ile Glu Met Ser Met Arg Gly Asp Ile Phe Glu Ile Val His Leu Gln Glu Thr Cys Asp Leu Gly Lys Ile Lys Pro Glu Ala Arg Arg Tyr Leu Glu Lys SerIle Lys Met Gly Lys Arg Asn Leu His Leu Pro Glu Gln Val Gln Asn Glu Ile Lys Ser Met Lys Arg Met Ser Glu Leu Cys Ile Asp Phe Asn Lys Asn Leu Asn Glu 2Asp Thr Phe Leu Val Phe Ser Lys Ala Glu Leu Gly Ala LeuPro 222sp Phe Ile Asp Ser Leu Glu Lys Thr Asp Asp Asp Lys Tyr Lys 225 234hr Leu Lys Tyr Pro His Tyr Phe Pro Val Met Lys Lys Cys Cys 245 25le Pro Glu Thr Arg Arg Arg Met Glu Met Ala Phe Asn Thr Arg Cys 267lu Glu Asn Thr Ile Ile Leu Gln Gln Leu Leu Pro Leu Arg Thr 275 28ys Val Ala Lys Leu Leu Gly Tyr Ser Thr His Ala Asp Phe Val Leu 29Met Asn Thr Ala Lys Ser Thr Ser Arg Val Thr Ala Phe Leu Asp 33Asp Leu Ser Gln Lys LeuLys Pro Leu Gly Glu Ala Glu Arg Glu Phe 325 33le Leu Asn Leu Lys Lys Lys Glu Cys Lys Asp Arg Gly Phe Glu Tyr 345ly Lys Ile Asn Ala Trp Asp Leu Tyr Tyr Tyr Met Thr Gln Thr 355 36lu Glu Leu Lys Tyr Ser Ile Asp Gln Glu Phe LeuLys Glu Tyr Phe 378le Glu Val Val Thr Glu Gly Leu Leu Asn Thr Tyr Gln Glu Leu 385 39Gly Leu Ser Phe Glu Gln Met Thr Asp Ala His Val Trp Asn Lys 44Val Thr Leu Tyr Thr Val Lys Asp Lys Ala Thr Gly Glu Val Leu 423ln Phe Tyr Leu Asp Leu Tyr Pro Arg Glu Gly Lys Tyr Asn His 435 44la Ala Cys Phe Gly Leu Gln Pro Gly Cys Leu Leu Pro Asp Gly Ser 456et Met Ala Val Ala Ala Leu Val Val Asn Phe Ser Gln Pro Val 465 478ly ArgPro Ser Leu Leu Arg His Asp Glu Val Arg Thr Tyr Phe 485 49is Glu Phe Gly His Val Met His Gln Ile Cys Ala Gln Thr Asp Phe 55Arg Phe Ser Gly Thr Asn Val Glu Thr Asp Phe Val Glu Val Pro 5525 Ser Gln Met Leu Glu Asn Trp Val TrpAsp Val Asp Ser Leu Arg Arg 534er Lys His Tyr Lys Asp Gly Ser Pro Ile Ala Asp Asp Leu Leu 545 556ys Leu Val Ala Ser Arg Leu Val Asn Thr Gly Leu Leu Thr Leu 565 57rg Gln Ile Val Leu Ser Lys Val Asp Gln Ser Leu His ThrAsn Thr 589eu Asp Ala Ala Ser Glu Tyr Ala Lys Tyr Cys Ser Glu Ile Leu 595 6Gly Val Ala Ala Thr Pro Gly Thr Asn Met Pro Ala Thr Phe Gly His 662la Gly Gly Tyr Asp Gly Gln Tyr Tyr Gly Tyr Leu Trp Ser Glu 625 634he Ser Met Asp Met Phe Tyr Ser Cys Phe Lys Lys Glu Gly Ile 645 65et Asn Pro Glu Val Gly Met Lys Tyr Arg Asn Leu Ile Leu Lys Pro 667ly Ser Leu Asp Gly Met Asp Met Leu His Asn Phe Leu Lys Arg 675 68lu Pro Asn Gln Lys AlaPhe Leu Met Ser Arg Gly Leu His Ala Pro 69homo sapiens 3 cgtgatcttg gctcactgca gcctctgcct ccytggttca agcgattctc ctgcttcagc 6gatgc ctcagacagt ggttcaaatt aatacgactc actataggga gacttctttc catttca ggtgtcgtaa gcttgaattcaataactata acggtcctaa ggtagcgaag cagcgct cccatgatcg cccggtgcct tttggctgtg cgaagcctcc gcagagttgg 24ccagg attttactca gaatgacgtt aggaagagaa gtgatgtctc ctcttcaggc 3tcttcc tatactgtgg ctggcagaaa tgttttaaga tgggatcttt caccagagca 36aaaca agaactgagg agctcattgt gcagaccaaa caggtgtacg atgctgttgg 42tcggt attgaggaag taacttacga gaactgtctg caggcactgg cagatgtaga 48agtat atagtggaaa ggaccatgct agactttccc cagcatgtat cctctgacaa 54tacga gcagcaagta cagaagcaga caaaagactttctcgttttg atattgagat 6atgaga ggagatatat ttgagagaat tgttcattta caggaaacct gtgatctggg 66taaaa cctgaggcca gacgatactt ggaaaagtca attaaaatgg ggaaaagaaa 72tccat cttcctgaac aagtacagaa tgaaatcaaa tcaatgaaga aaagaatgag 78tatgtattgatttta acaaaaacct caatgaggat gataccttcc ttgtattttc 84ctgaa cttggtgctc ttcctgatga tttcattgac agtttagaaa agacagatga 9aagtat aaaattacct taaaatatcc acactatttc cctgtcatga agaaatgttg 96ctgaa accagaagaa ggatggaaat ggcttttaat acaaggtgcaaagaggaaaa ccataatt ttgcagcagc tactcccact gcgaaccaag gtggccaaac tactcggtta gcacacat gctgacttcg tccttgaaat gaacactgca aagagcacaa gccgcgtaac cytttcta gatgatttaa gccagaagtt aaaacccttg ggtgaagcag aacgagagtt ttttgaat ttgaagaaaaaggaatgcaa agacaggggt tttgaatatg atgggaaaat atgcctgg gatctatatt actacatgac tcagacagag gaactcaagt attccataga aagagttc ctcaaggaat acttcccaat tgaggtggtc actgaaggct tgctgaacac accaggag ttgttgggac tttcatttga acaaatgaca gatgctcatgtttggaacaa gtgttaca ctttatactg tgaaggataa agctacagga gaagtattgg gacagttcta tggacctc tatccaaggg aaggaaaata caatcatgcg gcctgcttcg gtctccagcc gctgcctt ctgcctgatg gaagccggat gatggcagtg gctgccctcg tggtgaactt cacagcca gtggcaggtcgtccctctct cctgagacac gacgaggtga ggacttactt atgagttt ggtcacgtga tgcatcagat ttgtgcacag actgattttg cacgatttag gaacaaat gtggaaactg actttgtaga ggtgccatcg caaatgcttg aaaattgggt gggacgtc gattccctcc gaagattgtc aaaacattat aaagatggaagccctattgc acgatctg cttgaaaaac ttgttgcttc taggctggtc aacacaggtc ttctgaccct gccagatt gttttgagca aagttgatca gtctcttcat accaacacat cgctggatgc caagtgaa tatgccaaat actgctcaga aatattagga gttgcagcta ctccaggcac 2tatgcca gctacctttggacatttggc agggggatac gatggccaat attatggata 2ttggagt gaagtatttt ccatggatat gttttacagc tgttttaaaa aagaagggat 2gaatcca gaggttggaa tgaaatacag aaacctaatc ctgaaacctg ggggatctct 222gcatg gacatgctcc acaatttctt gaaacgtgag ccaaaccaaaaagcgttcct 228gtaga ggcctgcatg ctycgtgaac tggggatctt tggtagccgt ccatgtctgg 234aagtc gacatcacca tgtgttactg gcctggaaac tgaagggagt tttgcaagtg 24tttaga tttctattga catccttttg ttttctaatt ttaaaaatta taaagatgta 246aatta taaatactgtgacctaagaa aagacccact agaaagtaat tgtactataa 252cataa aactggattt gatttctttt tatgaaagtt tcatatgaat gtaacttgat 258actat tataatctag ataatatgat ataagagggc taagaatttt taaattgaat 264atatg atataatttg atccttcttg tatcttgaag ttttgtacttgggatttctg 27gataaa tgaatcatca cattcttctg gtaaatattt tcttggagct ctgtgtcaac 276tcctt tgtctcccag gaaggtgtga cctctccttt gcctgcatac ctcaaggcca 282atatg cctcagtgat gcatttatct ttgtatatca ggccgcatga ttcccaactt 288cacac ttaaattacgttcctccatt tcagttttgt cttttctgtc taaagttcag 294gagta tcaaaaaatt atgtttcagc tagactggtg taatgtataa gtttttgtat 3gtattag aggatttcgt agcttttatt agaggctcat ttccacctca gcatacaaga 3ttagtct tttggcatgt gtgccaatta gaatactaaa gcaagtccaagcacattttt 3ttctcac gtttctaata agtgttaggg actttgcctc ttttacttac cacgtcccca 3gtgtcag gtagacatgt cacaaatggc tctgtagaga gccatgggaa gagagaggag 324tgtgg aacataaagg gttcagaaac tccagaagag gagtgggttt tggatagaag 33tgagga cagctgctccaaagccttat gtgtatgatg aaacttaacc acggggaaga 336ttcag tagcctgttc tgtctggtga tttttatttt aagtgaacct ttggatctat 342actct ctttattgtg agtctaaatt ccaattctgc agcagatcag taaactcaca 348tttcc tgtggaaatc tattcaataa ggaaaccaag acaggataataaaatttaaa 354aacaa ctttgaattc ccctgcctag gtcttccagt tgttttccag cgcatacctc 36atgact ttgctagccg gggacaaaat tagcaccttc cgattctcta gtccaaatga 366gtgct aaataaaaaa ttattatact acataataaa gttacagata gcaggaaatg 372gctag gagattcctagattatatct gccaagcaaa taccttaaac atccacctga 378tacta ccccctcttc tgagataatt tgcccagccc ttctcttccc acacactcac 384gtcac ccccttctaa tccccaaaac tgtttttgtg gtctttgtag cctatagtag 39ctcaca tctttccccc tagacttttc tgtttttcag tttcagacaaaaaaactctt 396ttttc cagtgtgtct ccttaacagt aactttacca cttgaaatct tatttcatag 4aactaaa ttggtgtgga aaggctgcac acaataaagt tatattatta tccatgaaaa 4actcata tttctttcat actttaacgt taaaaccgaa atgcatgaga gcaaaagcac 4ggtgttc tttctatttagggcctacct ctaatattta aaatctacca aagagcagtc 42aattaa aactcagccc gggcgcagtg gctcatgcct gtaatcccag cactttggga 426aggca ggaggatcac ctgaggtcag agttcaagac cagcatggtc aacatggtga 432tgtct ctacaaaaat acaaaaagct gggcatgatg ttgggttcctgtagtcccag 438tagga ggctgaggca ggagaatagc ttgaacccgg gaggtggagg ttgcagtgag 444atcat gccattgcac tccagcctgg acgacagagt gagattcagt ctcaaaaaaa 45atactc aaagaattat ctagcataat ttaaaagaaa ggacttttta aaaattctct 456aattc aaaagaaaggacttaacttt tttttttttt tagtgtggtc atccgtctag 462ctttt tttccagatc agagcagaga atatcactga catgcttgaa atggtggata 468gtaaa ttgtaattgg acaaatgtac actttagatt tatggactga gccacatata 474gtctc tcctggtaat tgatccaggg gatttaggcc tctttcgggttttttgtttt 48ttaggc attgttatgt tgtgaaggat aaaatcttca acatcttatg caaatggata 486catga tcctaaaggt ttagttttac gatgctgcag agaagagaaa tgtcttgacg 492ccacc tgatgtagac tttgtccccc tctagtataa atgttgcatg ttacctagat 498actaa aaattgccttgagttatcac ctgagctact tatgccaagg tcttgccttt 5aagctaa taaggtgaga ggtggatatc tgtagctctt cggatgaaaa attgcattgt 5agatacc aaaattgagg aaatagctct tcaaagaaaa attactgata tgatcattgt 5tgtaaat gccttaagta gcaggcagtg actcaatttt ctactttaccattttacctt 522tttat gtatgaatta taggtctgtg gagattctgc ctccccacta ggccagtgtg 528accat ttattcattt tctatcatac acaggtggat taaaatttac attaaaattt 534aaaat accatcatac ttcaggcttc tataacaaaa tatcagactg ggtggcttca 54cagaca tttcttacagttctggaagc tgggaagtcc cacaatccac atgctggtaa 546gttcg tggtgaggcc cctcttcctc ttttactgac cacatcccca aaagtgtcag 552catgt tacaaatagc tctgtagaga gccatgggaa gagacaggag gcagatgtgg 558aaagg gtttagaaac ttctgcaggc agcagtggca gggagcaagccctagagtgt 564tttac gagagcagga atcccatcat gagagttcct tcctcatgac tttatctaaa 57gtcacc cccaacaaag gccccacccc ctaaccccat cacattggct gttacggctt 576taggg gatggggcac aaacattcag tccataacga atactgattc ctcaaatagg 582aacat agttaactgagcccccaaag aatgttaaaa gagaaaatcc attttatttg 588atgca gtgaccacag cttcttccct caaatcaaca cattacagtt agatgtctcc 594gaaat tggatagccc actgaaattg aacatgcctt ctcttataaa tgtgtggtga 6taaaagc aacaaagaaa tgaatgtggt ggctcacacc tgtaatcctaacactttgga 6ttgaggc aggaggatcc tttgtgctca agagtttgag accagcctga gcaacacagt 6accctgt ctctacaaaa actaaaaaaa ttagctaggg atggtggcac atgcctgtag 6cagctac ttgggaggct gaggtgggag gattgcttga gcccaagaag gtcaaggctg 624agcca taatcacgccactgcactcc agcctgggtg acagagaccc tgtcttaaaa 63at 63

Other References

  • Database EMBL ‘Online, ’ Entry HSA300837, Acc. No. AJ300837, Jan. 26, 2001, Chen, J.M. et al., “Homo sapiens mRNA for neurolysin,” XP002171897.
  • Vincent, B. et al., “Purification and Characterization of human endopeptidase 3.4.24.16. Comparison with the procrine counterpart indicates a unique cleavage site on neurotensin, ” Brain Research, vol. 709, No. 1, 1996, pp. 51-58, XP001010406.
  • Krause, Darren R., et al., “Characterization and Localization of Mitochondrial Oligopeptidase (MOP) (EC 3.4.24.16) Activity in the Human Cervical Adenocarcinoma Cell Line HeLa,” Journal of Cellular Biochemistry, vol. 66, No. 3, 1997, pp. 297-308, XP002172752.
  • Dauch, Pascale, et al., “Molecular Cloning and Expression of Rat Brain Endopeptidase 3.4.24.16,” Journal of Biological Chemistry, vol. 270, No. 45, 1995, pp. 27266-27241, XP002171871.
  • Kawabata, Shun-ichiro, et al., “Rabbit Liver Microsomal Endopeptidase with Substrate Specificity for Processing Proproteins is Structually Related to Rat testes Metalloendopeptidase 24.15,” Journal of Biological Chemistry, vol. 268, No. 17, 1993, pp. 12498-12503, XP002171870.
  • Sugiura, Naoaki, et al., “Molecular Cloning of Porcine Soluble Angiotensin-binding Protein,” Journal of Biological Chemistry, vol. 267, No. 25, 1992, pp. 18067-18072, XP002171869.
  • Nagase, Takahiro, et al., “Prediction of the Coding Sequences of Unidentified Human Genes. XV. The Complete Sequences of 100 New (cDNA Clones from Brain which Code for Large Proteins in vitro,” DNA Research, Universal Academy Press, JP, vol. 6, 1999, pp. 337-345, XP000865804.
  • Database EMBL ‘Online, ’ entry/acc. No. AW003054, Sep. 9, 1999. Strausberg, R., “wq61h05.x1 NCICGAPGC6 Homo sapiens cDNA clone Image: 2475801 3′ similar to SW:NEULPIG Q02038 Neurolysin Precursor: mRNA sequence,” XP002171872.
  • Serizawa A. Characterization of a Mitochondrial Metallopeptidase Reveals Neurolysin as a Homologue of Thimet Oligopeptidase, J. Biol. Chem. 1995, 270, 2092-2098.
  • Kato A. et al, Targeting of Endopeptidase 24.16 to Different Subcellular Compartments by Alternative Promoter Usage, J. Biol. Chem. 1997, 272/24, 15313-15322.
PatentsPlus Images
Enhanced PDF formats
loading...
PatentsPlus: add to cart
PatentsPlus: add to cartSearch-enhanced full patent PDF image
$9.95more info
 
Sign InRegister
Username  
Password   
forgot password?