InventorsAssigneeApplicationNo. 445801 filed on 05/22/1995US Classes:435/228, Acting on a linear amide linkage in linear amide435/227Acting on carbon to nitrogen bond other than peptide bond (3.5)ExaminersPrimary: Patterson, Charles L. Jr.Assistant: Hendricks, Keith Attorney, Agent or FirmInternational ClassesC12N 009/80C12N 009/78 DescriptionBACKGROUND OF THE INVENTIONThe present invention relates to the discovery of a specific enzyme that has not been previously described, a phthalyl amidase, which readily removes the phthalyl moiety from phthalyl-containing amides. The present invention also relates to an organism isolated from natural sources that produces the enzyme. DNA compounds that encode the enzyme, and methods for producing and using the enzyme. The phthalimido functional group is an important tool in organic synthesis because of the protection it provides against unwanted reactions. However, dephthalylation reactions generally require harsh conditions and often have low yields thereby limiting the situations in which phthalimido protection can be employed. Removal of a phthalyl protecting group from a phthalyl amide can be accomplished chemically, Kukolja et al., Croatica Chemica Acta 49:779, 1977, but yields are variable especially with substrates that are unstable to harsh reaction conditions. Certain enzymes have previously been found that could be used to remove benzoyl groups from benzoylated amino acids. Toyoura et al., Chem. Pharm. Bull. 7:789, 1959. These enzymes were specific for benzoyl groups and for the amino acid to which they were attached. Others have also reported enzymes that will hydrolyze phthalate esters. Kurane et al., Agric. Biol. Chem. 44:529, 1980. However, none of these enzymes have been shown to operate on phthalyl amides. In contrast, the phthalyl amidase enzyme of this invention catalyzes removal of the phthalyl group from a wide variety of phthalyl-containing compounds with improved yields over processes known in the art, exhibits stereochemical selectivity, and eliminates the need for harsh conditions to remove the protecting group. SUMMARY OF THE INVENTION The present invention provides an isolated phthalyl amidase enzyme, which catalyzes the following type of reaction: ##STR1## The phthalyl amidase enzyme is characterized by the following: a) Reactivity: said enzyme catalyzes the removal of the phthalyl group from phthalyl amides generating phthalic acid and an amine; b) Substrate specificity: said enzyme hydrolyzes phthalylated amino acids, peptides, beta-lactams, aromatic and aliphatic amines; substitutions allowed on the phthalyl group include 6-F, 6-NH2, 3-OH, and a nitrogen in the aromatic ring ortho to the carboxyl group attached to the amine; c) Reactive pH range: 5.5 to 9.0 with optimum pH of 8.0. -.0.4; d) Reactive temperature range: 10° to 50° C., with optimum temperature of 30° C.. -.4° C. at pH 8.0; e) Temperature stability: At 200 mM buffer, 80% of enzyme activity retained at 35° C. for 48 hours; f) Influence of effectors: Iodoacetate, p-HMB, and Cu.sup. exert inhibitory activity; g) Molecular weight: approximately 49,900 daltons; h) Subunits: one; i) Km : 0.9 mM in 50 mM potassium phosphate buffer, 30° C., pH 8.0, when phthalamido carbacephem is the substrate. The present invention also provides DNA compounds that comprise isolated nucleotide sequences encoding the phthalyl amidase enzyme and methods for expressing such compounds. Preferred DNA compounds comprise an isolated nucleotide sequence encoding SEQ ID NO:2, especially SEQ ID NO:1 isolated from Xanthobacter agilis. Other preferred compounds of the present invention include DNA compounds that comprise isolated DNA sequences encoding the proenzyme form of phthalyl amidase enzyme (SEQ ID NO:4), including SEQ ID NO:3, SEQ ID NO:5, and the phthalyl amidase gene of Xanthobacter agilis (SEQ ID NO:6). DNA compounds of the current invention include recombinant DNA vectors, including expression vectors. The present invention also provides for DNA sequences of the naturally-occurring phthalyl amidase gene that control transcription, translation, and extra-cellular secretion of proteins. Thus, the present invention includes SEQ ID NO:7, SEQ ID NO:8, and SEQ ID NO:10. Definitions: Coding sequence--the sequence of DNA in the open reading frame of a gene that encodes the amino acid residue sequence of the protein expressed from the gene. Gene--a segment of DNA that comprises a promoter, translational activating sequence, coding sequence; and 3' regulatory sequences, positioned to drive expression of the gene produce. Promoter--a DNA sequence that directs or initiates the transcription of DNA, Recombinant DNA vector--any autonomously replicating or integrating DNA agent, including but not limited to plasmids, comprising a promoter and other regulatory sequences positioned to drive expression of a DNA sequence that encodes a polypeptide or RNA. Recombinant DNA sequence--any DNA sequence, excluding the host chromosome from which the DNA is derived, which comprises a DNA sequence that has been isolated, synthesized, or partially synthesized. Restriction fragment--any linear DNA molecule generated by the action of one or more restriction enzymes. Translation activating sequence--a regulatory DNA sequence that, when transcribed into mRNA, promotes translation of mRNA into protein. All nucleotide and amino acid abbreviations used in this disclosure are those accepted by the United States Patent and Trademark Office as set forth in 37 C.F.R. .sctn.1.822(b)(1993). BRIEF DESCRIPTION OF THE FIGURES The restriction enzyme and function maps presented in the drawings are approximate representations of the recombinant DNA vectors discussed herein. The restriction site information is not exhaustive. There may be more restriction enzymes sites of a given type than are actually shown on the map. FIG. 1 is a restriction enzyme site and function map of plasmid pZPA600. FIG. 2 is a restriction enzyme site and function map of plasmid pZPA400. DETAILED DESCRIPTION OF THE INVENTION During the course of developing a chiral, shorter, and more efficient synthetic route to loracarbef ([6R-(6A,7B(R))]-7-[(aminophenylacetyl)amino ]-3-chloro-8-oxo-azabicyclo[4,2,0]oct-2-ene-2-carboxylic acid), the Mitsunobu reaction (see e.g. Hughes, D. L. Organic reactions 42:336, 1992; Bose, A. K. et al., Can. J. Chem. 62:2498, 1984) was selected for forming the beta-lactam ring from a chiral linear amino acid ester intermediate. Several reactants with on N-valence protected and a few reactants with both N-valences protected were examined in Mitsunobu reactions. They were either not cyclized or were cyclized in poor yield. It was discovered that problems in forming the beta-lactam ring via Mitsunobu reactions could be overcome if both valences of the α-nitrogen of the chiral linear amino acid ester intermediate were protected with a phthalimido group. However, no known chemical reaction was available to remove the phthalimido moiety and regenerate free amine in high yield. Thus, soil samples were examined for microorganisms that could catalyze removal of the phthalamido group from a test substrate (II) that was formed by base cleavage of the phthalimido ring of a bivalently N-protected compound. A culture was identified that demonstrated phthalyl amidase activity that liberated the free amine derivative of the test substrate. Native enzyme was purified and shown to catalyze the following desired reaction: ##STR2## Phthalyl amidase also has significant value in peptide synthesis applications. Phthalimido amino acid derivative are very effective reactants for enzymatic coupling of amino acids to form peptides. However, heretofore, methods for removing the phthalimido blocking group from the protected peptide were lacking. The phthalyl amidase of the current invention displays reactivity toward a wide range of substrates and can be used for deblocking phthalimido-protected peptide intermediates. The isolated phthalyl amidase of this invention demonstrates high specific activity toward phthalylated amides or esters (i.e., having a 1,2 dicarboxylate configuration). Such compounds may have other functional groups on the phthalyl aromatic ring and still serve as substrates for the enzyme. For example, acceptable functional groups include 6-F, 6-NH2, and 3-OH. Moreover, substrates may include a nitrogen in the aromatic ring ortho to the carboxyl group attached to the amine. Compounds lacking a 2-carboxylate, such as benzoyl, phenylacetate, phenoxyacetate, or their derivative, are not substrates for this enzyme. The enzyme also exhibits a broad substrate specificity in regard to the amine group attached to the phthalate side chain. For example, phthalylated amino acids and peptides, mono- and bicyclic beta-lactams, aromatic and non-aromatic amines, as well as phthalylated amines attached to heterocycles, are dephthalylated by this enzyme at acceptable catalytic rates. The enzyme also removes the methyl group from mono-methyl phthalate. The enzyme is stable in the broad range of pH from 6-9, having an optimum stability pH of 8.0. -.0.4. The enzyme also demonstrates a marked stability dependence on ionic strength. Ionic strength above 20 mM enhances pH and temperature stability of the enzyme. Optimum ionic strength occurs at 200mM and above. The enzyme retains good activity in low salt (50 mM) up to 30° C. and in high salt (200 mM) up to 40° C. In 200 mM salt, at least 80%of the enzyme activity is retained in temperatures up to 35° C. for 48 hours. Iodoacetic acid (10 mM), p-HMB (1 mM), and Cu.sup. (1 mM) significantly inhibited the enzyme. No organic co-factors, such as ATP, NADPH or others, stimulated enzyme activity. EDTA, phenanthroline, and metal ions besides Cu.sup. had little or no effect on enzyme activity. The molecular weight of the enzyme is approximately 49,900, as determined by electrospray mass spectrometry, and the molecule consists of one subunit. The Km, with phthalamido carbacephem (7-phthalamido-3-chloro-4-carboxy-1-carba-dethioceph-3-em) (III) as substrate, is 0.9 mM in 50 mM potassium phosphate buffer, pH 8.0, and 30° C. The Vmax for this substrate and under these conditions is 7.6 μmol/min/mg. Phthalyl amidase activity was recovered from a microorganism isolated from soil samples. The organism was characterized by comparison of its fatty acid methyl ester profile with that of known standards, and has been identified as a strain of Xanthobacter agilis. The organism can be preserved as lyophilized culture and has been deposited with the National Center for Agricultural Utilization Research 1815 North University Street, Peoria, Ill. 61604-39999, under accession number NRRL B-21115 (date of deposit: 6/28/93). Working cultures are maintained as liquid cultures stored in liquid nitrogen or at temperatures below -78° C. In order to recover the phthalyl amidase of this invention, Xanthobacter agilis can be cultivated in an aqueous nutrient medium consisting of a source of carbon and nitrogen and mineral salts at an initial pH between 6 and 8 and at 25° to 37° C. A number of agents can be included in the culture medium as inducers of enzyme production, including, for example, phthalate (PAA), phthalyl glycine (PAG), and phthalyl monocyclic beta-lactam (PMBL). The enzyme can be recovered in larger amounts by cultivating Xanthobacter agilis in a known manner in a bioreactor of desired size, for example, with a working volume of 100 liters. Good aerating conditions, and the presence of nutrients in complex form, and a pH between 6 and 8 are important for a successful culture. The cell mass can be separated from the medium and the enzyme purified as shown in Example 4. It will be recognized by those skilled in the art that phthalyl amidase-producing mutants of the isolated Xanthobacter agilis organism can readily be made by methods known in the art. These mutants are considered within the scope of this invention. As described, phthalyl amidase, catalyzes the removal of the phthalyl moiety from a wide range of phthalimido-containing compounds. The enzyme actually cleaves the amide bond of a phthalamideo substrate, which is formed by the action of mild base on the corresponding phthalimido compound. This conversion proceeds readily under conditions that are suitable for enzyme activity. Thus, the phthalimido-containing compound and the enzyme being concurrently present under conditions that promote enzyme activity result in in situ removal of the phthalyl group. In some chemical reactions involving an amine reactant, the corresponding phthalimido compound is particularly suited to high reaction yields whereas the conversion proceeds poorly with the unprotected amine or with a monovalently protected amine or even when the amine is bivalently protected by an alternative means. Thus, the current invention, which provides an economic source of phthalyl amidase, allows practical synthesis of a variety of amine products via phthalimido-protected amine intermediates. It will be recognized that the enzyme can also be used in immobilized form to catalyze desired reactions according to procedures known in the art. A specific application of the current invention occurs in a new chiral synthesis of the antibiotic loracarbef. The phthalyl amidase-catalyzed reaction shown above is one step of that synthesis. Another application occurs in the synthesis of aspartame (N-L-α-aspartyl-L-phenylalanine, 1-methyl ester) as described in Example 16 below. In both casesphthalic anhydride (or other suitable activated forms of phthalic acid) is used to react with an intermediate containing a key amino group so that at phthalimido moiety is formed for bivalent protection of the amino group. The bivalently protected amine can then be converted efficiently to a desired intermediate. For example, cyclization of a α-phthalimido-β-hydroxy-acid to a beta-lactam, or for example, condensation of an α-phthalimido carboxy-activated amino acid with a carboxy-protected amino acid to form a dipeptide. The phthalimido moiety is hydrolyzed with mild base and the resulting phthalamido moiety is then exposed to phthalyl amidase to catalyze the removal of the phthalyl moiety and release free amine plus phthalic acid. In addition to identification and isolation of a naturally-occurring phthalyl amidase, the current invention provides DNA compounds that comprise an isolated nucleotide sequence encoding phthalyl amidase, recombinant DNA vectors encoding phthalyl amidase, host cells transformed with these DNA vectors, and a method for producing recombinant phthalyl amidase. These elements of the current invention provide the opportunity to use phthalyl amidase as a biocatalyst in industrial scale chemical processes. Phthalyl amidase may be produced by cloning DNA encoding phthalyl amidase into a variety of vectors by means that are well known in the art. A number of suitable vectors may be used, including cosmids, plasmids, bacteriophage, and viruses. One of the principle requirements for such a vector is that it be capable of reproducing itself and transforming a host cell. Preferably, the vector will be a recombinant DNA vector that is capable of driving expression of phthalyl amidase encoded by the DNA compounds of this invention. Typical expression vectors comprise a promoter region, a 5'-untranslated region, a coding sequence, a 3'-untranslated region, an origin of replication, a selective marker, and a transcription termination site. After the DNA compound encoding phthalyl amidase has been inserted into the vector, the vector may be used to transform a host cell. In general, the host cell may comprise any cellular organism, including a prokaryotic cell or eukaryotic cell, that is capable of being transformed with a vector comprising the DNA of this invention. The techniques of transforming and transfecting cells are well known in the art and may be found in such general references as Maniatis, et al. (1989) or Current Protocols in Molecular Biology (1989). A particularly preferred method of the current invention generates soluble, extra-cellular enzyme. The method makes use of a DNA compound that comprises SEQ ID NO:6, which enables, when transformed into Streptomyces lividans as part of a self-replicating vector, the host to produce and secrete soluble mature phthalyl amidase in an amount 20-fold in excess of the amount of a cell-bound form of the enzyme produced by Xanthobacter agilis, the bacterium from which the DNA compound was cloned. SEQ ID NO:6 comprises four functional components: SEQ ID NO:7; which includes the promoter-bearing nucleotides 1-135 of SEQ ID NO:6, promotes transcription of the coding sequences. SEQ ID NO:8 (nucleotides 136-261 of SEQ ID NO:6) encodes the signal peptide portion of a proenzyme form of phthalyl amidase (pro-phthalyl amidase SEQ ID NO:4)). The signal peptide (SEQ ID NO:9), which provides for transport of the proenzyme across the microbial cell wall of Streptomyces lividans, is cleaved from the proenzyme by the cell, thereby enabling extra-cellular production of the mature enzyme. SEQ ID NO:1 (nucleotides 262-1620 of SEQ ID NO:6) encodes mature phthalyl amidase (SEQ ID NO:2). SEQ ID NO:10 (nucleotides 1621-3029 of SEQ ID NO:6) is a 3'-untranslated region which assists proper and efficient translation termination of the mRNA that encodes pro-phthalyl amidase. Moreover, in a more general application of the expression method of the current invention, a wide variety of soluble, extra-cellular, properly-folded, functional proteins may be produced in Streptomyces. The current method comprises propagating Streptomyces lividans that has been transformed with a DNA compound, which encodes the desired enzyme, protein, or peptide, and which includes the transcriptional and translational regulatory elements of the phthalyl amidase gene isolated from the bacterium Xanthobacter agilis. These regulatory elements enable synthesis and secretion of the soluble, properly-folded, functional enzyme, protein, or peptide. To accomplish the general method, the DNA sequence encoding mature phthalyl amidase (SEQ ID NO:1) may be replaced in SEQ ID NO:6 by a heterologous open reading frame from a wide variety of organisms wherein the heterologous open reading frame encodes a mature protein or hormone and introns are absent from those open reading frames, either by nature or by virtue of precise removal from genomic DNA to form cDNA open reading frames. In this arrangement, the regulatory elements of the phthalyl amidase gene continue to function such that proteins and oligopeptides other than phthalyl amidase are produced and secreted from Streptomyces transformed with the modified DNA sequence. Thus, substitution of a desired protein-encoding sequence for the coding sequence of mature phthalyl amidase enables economic extra-cellular production of numerous enzymes, peptides, and peptide hormones. Synthesis of the phthalyl amidase gene and its various elements can be accomplished by recombinant DNA technology. Synthetic genes, the in vitro or in vivo transcription and translation of which will result in the production of the phthalyl amidase enzyme, may be constructed by techniques well known in the art. Owing to the degeneracy of the genetic code, the skilled artisan will recognize that a sizable, yet definite, number of DNA sequences may be constructed, which encode the phthalyl amidase enzyme. All such sequences are provided by the present invention. A preferred sequence encoding phthalyl amidase is the naturally-occurring phthalyl amidase gene of Xanthobacter agilis, which is SEQ ID NO:6. This preferred gene is available on an 3.2 kb SacI-BamHI restriction fragment of plasmid pZPA600, which can be isolated from Streptomyces lividans TK23/pZPA600 by techniques well known in the art. Streptomyces lividans TK23/pZPA600 designates Streptomyces lividans strain TK23 which has been transformed with vector pZPA600. Plasmid pZPA600 was derived by ligating SEQ ID NO:6 into Streptomyces vector, pIJ702 (Hopwood, D. A., Bibb, M. J., Smith, C. P., Ward, J. M., Schremph, H., Genetic Manipulations of Streptomyces: A Laboratory Manual, The John Innes Foundation, Norwich, England, 1985). The pIJ702 vector contains a pIJ101 Streptomyces replicon and a thiostrepton resistance gene for selection. The ligated material was transformed into Streptomyces lividans TK23 by a standard protoplast fusion technique. After selection on thiostrepton (45 mg/ml), the plasmid designated pZPA600, was isolated and confirmed by restriction analysis. A restriction site and function map of plasmid pZPA600 is found i FIG. 1. Streptomyces lividans TK23/pZPA600 is publicly available and on deposit at the National Center for Agricultural Utilization Research, 1815 North University Street, Peoria, Ill. 61604-39999, under accession number NRRL B21290 (date of deposit: 6/23/94). The Streptomyces lividans TK23 strain has been previously described in Plasmid 12:1936 (1984). Plasmid pZPA600 allows high level expression of the pro-phythalyl amidase open reading frame and results in secretion of soluble mature phthalyl amidase, which process is especially preferred. Thus, the invention comprises a process in which Streptomyces lividans TK23/pZPA600 is grown and then separated from its extra-cellular broth so that high concentrations of phthalyl amidase are obtained in that cell-free broth. Other preferred sequences include, for example, SEQ ID NO:1, which encodes mature phthalyl amidase enzyme (SEQ ID NO:2), and SEQ ID NO:3, which encodes the proenzyme form of phthalyl amidase (SEQ ID NO:4). Thus, the present invention also comprises plasmid pZPA400 as a preferred embodiment. In plasmid pZPA400, the regulatory elements of the native gene were removed and a methionyl residue was attached to the 5'-terminal nucleotide of the mature phthalyl amidase coding sequence to generate an open reading frame (SEQ ID NO:11) encoding met-phthalyl amidase (SEQ ID NO:12). This sequence was positioned, via two-cistron configuration, to be driven by a temperature inducible lambda pL promoter. Plasmid pZPA400 also contains the temperature sensitive cI857 repressor gene, a tetracycline resistance gene, and the pBR322-based origin of replication minus the rop region, which controls copy number (Cesareni et al., Proc. Natl. Acad. Sci. 79:6313, 1982). E. coli cells harboring this plasmid (E. coli DH5α/pZPA400) are induced to produce met-phthalyl amidase (without signal peptide) when the culture temperature is raised from 30° to 42° C. A restriction site and function map of plasmid pZPA400, which can be isolated from E. coli DH5α/pZPA400 cells by techniques well known in the art, is found in FIG. 2. E. coli DH5α/pZPA400 designates the commercially available E. coli DH5α strain that has been transformed with plasmid pZPA400. E. coli DH5α/pZPA400 cells are publicly available and on deposit at the National Center for Agricultural Utilization Research, 1815 North University Street, Peoria, Ill. 61604-39999, under accession number NRRL 21289 (date of deposit: 6/23/94). The phthalyl amidase gene may also be created by synthetic methodology. Such methodology of synthetic gene construction is well known in the art. See Brown et al. (1979) Methods in Enzymology, Academic Press, N.T., 68:109. The phthalyl amidase DNA sequence may be generated using a conventional DNA synthesizing apparatus, such as the Applied Biosystems Model 380A of 380B DNA synthesizers (commercially available from Applied Biosystems, Inc., 850 Lincoln Center Drive, Foster City, Calif. 94404. Synthesis of the phthalyl amidase protein of the present invention may also proceed by solid phase synthesis. The principles of solid phase chemical synthesis of polypeptides are well known in the art and may be found in general texts, such as, Dugas, H. and Penny, C., Bioorganic Chemistry (1981), Springer-Verlag, N.Y., pp. 54-92. However, recombinant methods are preferred if a high yield is desired. A skilled artisan will recognize that the nucleotide sequences described in the present disclosure may be altered by methods known in the art to produce additional sequences that substantially correspond to the described sequences without changing their functional aspects. These altered sequences are considered to be included in the current invention. In order that the invention described herein may be fore fully understood, the following examples are set forth. It should be understood that the examples are for illustrative purposes only and are not to be construed as limiting the scope of the invention. EXAMPLE 1 Search for phthalyl amidase producing organisms 240 soil samples (8 to 15 mg of damp dry soil) were individually suspended in 10 ml sterile BL medium (hereinafter defined) containing 100 mg phthalyl monocyclic beta-lactam (PMBL) (I). ##STR3## BL medium had the following composition: ______________________________________ Na2 HPO4 6.0 g KH2 PO4 3.0 g NaCl 0.5 g NH4 Cl 2.0 g CaCl2 0.1 g MgSO4.7H.sub.2 O 0.25 g ZnSO4.7H.sub.2 O 70 mg FeCl3.6H.sub.2 O 270 mg MnSO4 80 mg CuCl2 7.4 mg CoSO4.7H.sub.2 O 28 mg H3 BO3 3 mg Yeast Extract 1.0 g Deionized water 1.0 L pH 7.0 ______________________________________ The cultures were incubated aerobically at 30° C. in a rotary shaker at 250 rpm for as long as 2 weeks. Cultures were examined by thin layer chromatography at 7 day intervals for the disappearance of the starting substrate and appearance of the beta-lactam nucleus product. A culture showing the desired catalytic activity was transferred at least two more times under similar conditions of medium and growth. The final culture was diluted with sterile water and plated out on agar plates containing either Trypticase Soy Broth (Difco) or Bac MI medium. Bac MI medium had the following composition: ______________________________________ Peptone 10.0 g Beef Extract 5.0 g Yeast Extract 2.0 g NaCl 5.0 g Deionized water 1.0 L pH 7.0 ______________________________________ (Agar plates were prepared by adding 20 g agar per L of medium). Individual colonies were picked from the agar and grown in Bac MI medium containing 10 mg/ml of PMBL for 12 days at 30° C. with aeration. Broths were examined for appearance of beta-lactam nucleus and phthalic acid using TLC. A pure isolated organism that demonstrated rapid hydrolysis of the substrate was then grown in Bac MI medium containing 1 mg/ml phthalate for 48 hours at 30° C. with aeration. Cells were centrifuged and then suspended in 50 mM Tris-HCl buffer, pH 8.0, at a ratio of 1 g wet weight cells to 8 ml of buffer. A solution of lysozyme, 2 mg in 1.0 ml 50 mM EDTA, pH 8.2, was added at the ratio of 1 ml lysozyme solution to 8 ml cell suspension. After mixing well and holding at room temperature for 1 hour, the suspension was cooled to 4° C. and held overnight. The resultant viscous solution was sonicated only long enough to liquefy the solution. This solution was centrifuged at 10,000 rpm for 15 minutes. The pellet was discarded and the supernatant tested for phthalyl amidase activity. The cell-free extract was chromatographed on a size exclusion column (1.5×100 cm; Sephacryl S-300; Pharmacia, Piscataway, N.J.) at 4° C. with an elution buffer consisting of 50 mM potassium phosphate and 150 mM KCl at a flow rate of 0.5 ml/min. The eluant was monitored at a wavelength of 280 nm. UV-absorbing fractions were tested for hydrolysis of PMBL by HPLC. Reference proteins for molecular weight (daltons) determination were chymotrypsinogen (25,000), ovalbumin (43,000), albumin (67,000), aldolase (158,000), catalase (232,000), ferritin (440,000), and thyroglobulin (669,000). Cell-free extract of the organism subsequently identified as Xanthobacter agilis was determined to contain an enzyme that catalyzed the hydrolysis of PMBL, and which had an approximate molecular weight of 54,000 daltons and a specific activity of 39.7 nmol/min/mg. EXAMPLE 2 Production of phthalyl amidase from Xanthobacter agilis Fermentation of Xanthobacter agilis on a 100 L scale was conducted in 100 L working volume bioreactors, with automatic control for pH (7.9-8.1), temperature (30° C.), air flow (1 scfm), agitation (300 rpm), and back pressure (5 lb). Dissolved oxygen levels (>50%) were kept constant by small increases in agitation speed. The medium consisted of 1.25% Bacto peptone, 0.3% yeast extract, 0.5% beef extract, 0.5% phthalic acid, 0.5% NaCl, and 0.05% anti-foam. After sterilization, the medium was brought to pH 8.0 with 30% sulfuric acid. The fermenter was inoculated with 1 L of pre-culture which had been incubated at 30° C. for 24 hours in the same medium with shaking at 300 rpm. After 48 hours of growth, the fermentation broth was cooled and centrifuged at 17,000 rpm with a flow rate of 1 to 2 L/min to remove the biomass. The cell paste was harvested and stored at -20° C. yielding 6.0 g wet cell weight/L. EXAMPLE 3 Induction of phthalyl amidase Three compounds at different concentrations were added to aerated cultures of the organism growing at 30° C. in Bac MI medium. The compounds tested were phthalate (PAA), phthalyl glycine (PAG), and PMBL. Cells of Xanthobacter agilis were grown with aeration for 24 hours. This vegetative culture was used to inoculate Bac MI medium (50 ml) containing different concentrations of the compounds to be tested. After 48 hours growth under standard conditions, cells were harvested by centrifugation and wet weight of the cells was determined. Crude cell extracts were prepared by lysozyme treatment of the cells as in Example 1. Suspensions were briefly sonicated to break up the viscous suspension. A cell-free supernatant was obtained by centrifugation of the suspension at 14,000 rpm for 15 minutes. Enzyme activity in cell-free lysates was determined by monitoring conversion of the chromogenic substrate 4-(2'-carboxy-N-benzoyl)amino-2-carboxy-nitrobenzene (II) to 2-nitro-5-amino benzoic acid and phthalic acid, a reaction catalyzed by phthalyl amidase as shown below: ##STR4## The assay reaction mixture (1 ml) consisted of 0.3 μmol of the chromogenic substrate (II) and 0.001-0.5 μg of enzyme preparation in 50 mM potassium phosphate buffer, pH 8.0 (buffer A). The enzymatic reaction was conducted at 30° C. for 10 minutes and the appearance of product was monitored at 380 nm (or 430 nm). The amount of substrate hydrolyzed was calculated from a standard curve of the amine product. As can be seen in Table 1, PAG and PAA increased the wet weight cell mass while PMBL had no effect. However, all three substrates produced a dramatic concentration-dependent increase in the total number of enzyme units recovered. The units of enzyme per gram of wet weight cells also increased with all additions but the increase was most pronounced at high PAA concentrations TABLE 1 ______________________________________ Total units/ Addition Cell weight mg protein Units/ Inducer (mg/ml) (g/50 ml) (μmol/min/mg) g/cells ______________________________________ Control -- 0.29 0.017 0.06 PAG 1 0.33 0.35 1.04 5 0.5 4.4 9.4 PMBL 1 0.35 0.28 0.79 5 0.24 2.0 8.1 PAA 1 0.35 1.4 3.9 2 0.47 4.3 9.3 5 0.7 3.7 5.5 10 0.6 12.0 19.8 ______________________________________ EXAMPLE 4 Purification of phthalyl amidase A. Analytical scale purification of phthalyl amidase Cells of Xanthobacter agilis (200 grams, wet weight), which contained significant amounts of phthalyl amidase activity, were resuspended to 1800 ml in 50 mM Tris-HCl, pH 8.0, plus 5 mM EDTA. The cells were broken by sonication for 22 minutes at a maximal power below 8° C. DNase (1 μg/ml) and magnesium sulfate (10 mM) were added during the sonication to minimize viscosity and improve cell breakage. After a high-speed centrifugation, the resulting crude extract supernatant served as the source for further enzyme purification. All subsequent purification steps were conducted at 4° C. The crude extract was loaded onto a Q-Sepharose column (4.4×23 cm; Pharmacia), previously equilibrated with buffer A. After washing with buffer A, a linear gradient of 0-1.5 M KCl in buffer A was applied and the phthalyl amidase eluted as a single activity peak between 1 and 1.1 M KCl. Selected fractions containing most of the enzyme activity were pooled as Q-Sepharose eluate. The Q-Sepharose eluate was subjected to ammonium sulfate fractionation. The majority of the enzyme activity was recovered from 67-77, 77-87 and 87-97% ammonium sulfate pellets. Those pellets were solubilized in buffer A with 0.2 M ammonium sulfate. ammonium sulfate was added to the 67-97% ammonium sulfate enzyme pool to a final concentration of approximately 2 M. The enzyme pool was loaded onto a Phenyl-Sepharose column (2.6×16 cm; Pharmacia), which was previously equilibrated with buffer A plus 2.6 M ammonium sulfate. The phthalyl amidase eluted with a linear gradient decreasing from 2.6 to 0 M ammonium sulfate in buffer A as a single activity peak between 0 M and 0.5 M ammonium sulfate. Selected fractions containing the majority of the enzyme activity were pooled as Phenyl-Sepharose eluate. The Phenyl-Sepharose eluate was dialyzed against buffer A and then loaded onto a hydroxylapatite column (1.5×90 cm; Clarkson Chemical Company, Williamsport, Pa.), which was previously equilibrated with buffer A. After washing the column with buffer A, the enzyme eluted with a linear gradient of 50-500 mM potassium phosphate, pH 8.0, as a single activity peak between 150 and 190 mM potassium phosphate. Selected fractions containing most of the enzyme activity were pooled as hydroxylapatite eluate. After a dilution of the buffer strength from 120 to 50 mM potassium phosphate, the hydroxylapatite eluate was loaded onto a Mono P column (0.5×20 cm; Pharmacia), which was previously equilibrated with buffer A. After washing with 3 column volumes of buffer A, a linear gradient of 0-1.5 m KCl in buffer A was applied and the enzyme eluted as a single activity peak between 0.72 and 0.8 M KCl. Those fractions containing the majority of the enzyme activity were pooled as Mono P eluate. The most active enzyme preparation was derived from Mono P FPLC (Fast Protein Liquid Chromatography). Table 2 summarizes the results of the purification. Based on sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and Laser Densitometric Scanning, the phthalyl amidase was greater than 95% pure. The phthalyl amidase activity reported in Table 2 was determined using the chromogenic substrate as in Example 3. A typical reaction mixture in a total volume of 1 ml contained 0.2 mg of the chromogenic substrate and an aliquot of phthalyl amidase in buffer A. The enzymatic reaction was conducted at 30° C. for 10-15 min. Formation of the reaction product was monitored with a spectrophotometer at 430 nm (or 380 nm) and quantitated from a standard curve of the product. TABLE 2 ______________________________________ Purifi- Protein Activity Spec. Act. cation Yield Step (mg) (Units) (Units/mg) (fold) (%) ______________________________________ Crude 5475 345 0.063 1 100 Extract Q Sepharose 230 279 1.214 19 81 Ammonium 145 224 1.547 25 65 Sulfate: 67-97% cut Phenyl- 63 158 2.505 40 46 Sepharose Hydroxyl- 28 154 5.52 88 45 apatite Mono P 16.5 119 7.2 119 34 ______________________________________ B. Preparative scale purification of phthalyl amidase Crude extract of Xanthobacter agilis was prepared by adding 1 g of cells (wet weight) and 2 mg lysozyme per 9 ml of 50 nM Tris-HCl buffer, pH 8.0 1 mM EDTA (600 g cells total). After 30 minutes at room temperature, DNase (100 U/g of cells) in 10 mM magnesium sulfate was added. The cells were homogenized using a cell homogenizer for 30 minutes at room temperature. After 17 hours of incubation at 8° C., the lysate was centrifuged at 10,000 rpm for 30 minutes. The crude extract supernatant (4.5 L) was applied to a Super-Q column (7×40 cm; TosoHaas, Montgomeryville, Pa.) equilibrated in buffer A. After loading crude extract, the column was washed with 2 column volumes of 50 mM phosphate buffer containing 3.5 M urea, pH 8.0. A second wash (5 L) was used to re-equilibrate the column in buffer A. Phthalyl amidase eluted from the column using a 10 column-volume linear gradient of 0-1.5 M KCl in buffer A. Fractions were collected and assayed for enzyme activity. The active fractions were pooled (1.5 L), concentrated (250 ml), and diafiltered with buffer A at 7°-20° C. The concentrated and diafiltered Super-Q mainstream was applied to a hydroxylapatite column (3.2×40 cm) equilibrated in buffer A. After washing the column with this buffer, phthalyl amidase was eluted using a linear gradient of 0-500 mM phosphate buffer, pH 8.0. Fractions were assayed according to the chromogenic substrate method (see Example 3) and the active fractions were pooled (1 L) and concentrated (400 ml). Table 3 shows the results of this purification. TABLE 3 ______________________________________ Activity Spec. Act. Purification Yield Step (Units) (Units/mg) (Fold) (%) ______________________________________ Crude 14,846 0.8 1 100 Extract Super-Q 6,828 3.0 4 46 Hydroxyl- 4,985 9.0 11 34 apatite ______________________________________ EXAMPLE 5 Effect of pH on phthalyl amidase activity The effect of pH on the reaction rate of the analytical scale purified enzyme was determined using phthalamido carbacephem (III) as substrate. ##STR5## A typical reaction mixture consisted of 1 ml total volume and contained 0.1 mM III, 0.1 μM phthalyl amidase in 50 mM potassium phosphate buffer (pH 5.5-9.0) at 32° C. for 20 minutes. The reactions were stopped by the addition of 1 ml methanol. After removal of precipitate by centrifugation, an aliquot of the supernatant fraction (typically 30 μl) was monitored for the beta-lactam nucleus and phthalic acid by HPLC using a Zorbax C8 column (0.46×15 cm; MacMod Analytical Inc., Chadds Ford, Pa.). The two reaction products were eluted by a mobile phase constructed as continuous mixed gradients from (a) 1% ACN (acetonitrile)/0.2% TFA (trifluoroacetic acid) and (b) 80% ACN/0.2% TFA as follows: 1) 0% (b), 3min; 2) 0-50% (b), 0.5 min; 3) 50-100% (b), 3 min; 4) 100% (b), 2.5 min; 5) 100-1% (b), 0.1 min; and 6) 0% (b), 5 min. At a flow rate of 1.5 ml/min, retention times of the beta-lactam nucleus and phthalic acid, as measured at 254 nm, were 2.3 and 7.2 min, respectively. The results are shown in Table 4. Optimal range for enzyme activity occured between pH 7.8 and TABLE 4 ______________________________________ Specific Activity pH (μmol/min/μmol enzyme) ______________________________________ 7.0 125.4 7.2 130.4 7.4 155.2 7.6 172.5 7.8 184.2 8.0 195.3 8.2 201.2 8.4 208.0 8.6 181.7 8.8 185.1 9.0 33.1 ______________________________________ EXAMPLE 6 Optimum reaction temperature Test reactions were carried out similar to Example 5 except that all incubations were performed in 50 mM potassium phosphate buffer at pH 8.2.Solutions of the substrate were pre-incubated for 5 minutes at temperatures between 2° and 60° C. The enzymatic reaction was initiated by the addition of phthalyl amidase and stopped by the addition of 1 ml methanol. Specific activity of the enzyme was determined by monitoring the hydrolysis of III by HPLC as in Example 5. The maximum reaction rate for the enzyme was reached at 34° C. Little enzyme activity as found below 10° C. and above 50° C. EXAMPLE 7 Optimum salt concentration Test reactions were carried out similar to Example 6 except that buffer concentrations ranging from 10 to 200 mM at 32° C. were examined. All other conditions and analyses were the same. As is apparent in Table 5, high salt concentration markedly improved the specific activity of the enzyme. The effect was of a general nature and did not appear to be dependent on specific anions or cations. TABLE 5 ______________________________________ Buffer Conc. Specific Activity (μmol/min/μmol enzyme) (mM) K Phosphate Tris-HCl NH4 Acetate ______________________________________ 10 148 73 25 50 300 230 50 100 350 275 75 200 360 300 100 ______________________________________ EXAMPLE 8 Stability of phthalyl amidase A. Effect of ionic strength The stability of phthalyl amidase at pH values ranging from 6-9 was determined as described in Example 5 at 30° C. in both 20 and 200 mM potassium phosphate buffer. In 20 mM buffer, all enzyme activity as lost within 2 hours at any pH of the incubation medium. In 200 mM buffer, the enzyme retained at least 80% of its activity for 100 hours irrespective of the pH of the incubating medium. Twenty mM buffer that was supplemented with 200 mM KCl or NaCl also protected against activity loss, indicating that the enzyme stabilization was primarily dependent on the high ionic strength of the buffer. B. Temperature stability The phthalyl amidase enzyme was also tested for stability at varying temperature. The enzyme was incubated at pH 8.2 in the temperature range of 4°-50° C. for 48 hours in 50 and 200 mM phosphate buffer. In 50 mM buffer, the enzyme retained 90% of its activity for 48 hours when maintained at temperatures below 25° C., while all enzyme activity was lost within 48 hours when the incubation temperature was above 40° C. In 200 mM buffer, 80% of the enzyme activity was retained in temperatures up to 35° C. and 30% of the enzyme activity was retained after 48 hours incubation at 40° C. EXAMPLE 9 Influence of effectors on enzyme activity The effect of various agents on the enzymatic activity of phthalyl amidase was determined using standard conditions (see Example 5). All agents were tested at 1 mM final concentration unless otherwise indicated. It can be seen from the data in Table 6 that iodoacetate, p-HMB, and copper ions significantly reduced phthalyl amidase activity. None of the tested compounds stimulated enzyme activity significantly above that of the control. Table 7 shows the effects of four organic solvents at three concentrations on enzyme catalysis. All four solvents tested significantly decreased enzyme activity at a concentration of 10%. Glycerol caused the least amount of inhibition of the enzyme at the highest concentration tested. TABLE 6 ______________________________________ Effector Agent % of Control Activity ______________________________________ Sulfhydryl agents p-HMB 65 DTNB 98 NEM 100 Iodoacetate, 1 mM 91 Iodoacetate, 10 mM 46 Metal chelators Phenanthroiine 104 EDTA 103 Co-factors and reducing agents Mercaptoethanol 105 DTT 100 NAD 101 NADH 96 NADP 99 NADPH 99 ATP 96 PLP 106 THF 100 CoASH 102 THF DTT 100 FAD 101 FAD DTT 100 Metal Cations NaCl 104 KCl 100 CaCl2 89 CoCl2 101 CuCl2 36 FeCl2 102 FeCl3 96 MgCl2 102 MnCl2 84 NiCl2 94 ZnCl2 100 ______________________________________ DTT: dithiothreitol pHMB: parahydroxy mercuric benzoate DTNB: dithionitrobenzoate NEM: Nethylmaleimide NAD: nicotinamide adenine nucleotide NADP: nicotinamide adenine dinucleotide phosphate NADPH: reduced form of NADP ATP: adenosine 5triphosphate PLP: pyridoxyl5-phosphate THF: tetrahydrofolate FAD: flavin adenine dinucleotide TABLE 7 ______________________________________ % Residual enzyme activity Solvent 1.0% 5.0% 10.0% ______________________________________ Ethanol 99 85 45 DMSO 101 80 71 Glycerol 100 94 85 Methanol 100 90 69 ______________________________________ DMSO: dimethyl sulfoxide EXAMPLE 10 Physical and chemical properties of phthalyl amidase The molecular weight of the phthalyl amidase was determined to be 49,000 by electrospray mass spectrometry. The enzyme is monomeric with an isoelectric point estimated by isoelectric focusing to be pH 5.5. Chemical hydrolysis and amino acid analysis of the protein by standard methods are shown in Table 8. Repeated attempts to sequence the N-terminus of the purified enzyme failed, indicating that the enzyme was blocked. TABLE 8 ______________________________________ Number of residues Amino Acid in protein ______________________________________ Aspartate/Asparagine 62 Threonine 21 Serine 37 Glutamate/Glutamine 52 Proline 26 Glycine 34 Alanine 50 Cysteine* 2 Valine 23 Methionine 12 Isoleucine 20 Leucine 35 Tyrosine 17 Phenylalanine 13 Histidine 11 Lysine 4 Arginine 20 Tryptophan* 13 ______________________________________ *derived from nucleotide sequence of the gene EXAMPLE 11 Substrate specificity of phthalyl amidase A. Chemical structure requirements for enzyme activity the activity of phthalyl amidase against 25 compounds was determined. The compounds were divided into beta-lactams (Table 9), phthalyl amides (Table 10), and aromatic ring substituted amides (Table 11). Each reaction mixture (1 ml total volume) contained 2.5 μmol of compound and 0.3 units of enzyme (based on the chromogenic substrate) of the preparative scale purified enzyme, in 50 mM phosphate buffer, pH 8.0. The reactions were conducted at 30° C. Samples of the reaction mixture were taken at various times, and methanol (equal value) was added to stop the reaction. The samples were examined by HPLC to determine the extent of substrate hydrolysis. The amount of compound hydrolyzed was calculated from a standard curve of the test compound. All substrates were stable in buffer at 30° C. and pH 8.0 in the absence of enzyme for 24 hours. As the results in Table 9 indicate, the enzyme recognizes mono- and bicyclic beta-lactam compounds containing a phthalyl group attached to the exocyclic nitrogen. However, the side chain apparently requires a 2-carboxylate group, for example, phthalate, since no hydrolysis is observed in the absence of this functional group. A wide variety of phthalyl amides are substrates for the enzyme as shown in Table 10. Substrates include phthalylated amino acids, dipeptides, monocyclic and bicyclic beta-lactams, phenyl, benzyl, and aliphatic amines. The enzyme also exhibited esterase activity as demonstrated by its ability to hydrolyze phthalate mono methyl ester (IX). In this series, compound XIII was the most active compound found. Using compound XIII as a standard, a variety of aromatic ring substituted compounds were examined for reactivity with the enzyme. Results are shown in Table 11. Aromatic ring substituents at the 6 position of the phthalyl ring such as F and NH2 were accepted by the enzyme. A hydroxyl group at the 3 position (XXI) of the ring and a nitrogen within the aromatic ring (XX) is also acceptable. Low levels of hydrolysis occur if a tetrazole is substituted for the 2-carboxylate group (XXII). Moving the carboxylate group to the 3 (XXIV) or 4 (XXIII) position of the aromatic ring completely eliminates hydrolytic activity. Compounds lacking the 2-carboxylate (XXV-XXVIII) are not suitable substrates for the enzyme. These results are consistent with the enzyme being a novel catalyst that removes phthalyl protecting groups from a variety of amines under mild conditions. TABLE 9 __________________________________________________________________________ Compound Relative number Structure activity __________________________________________________________________________ ##STR6## 47.9 III ##STR7## 100 IV ##STR8## 0 V ##STR9## 0 VI ##STR10## 0 __________________________________________________________________________ TABLE 10 ______________________________________ ##STR11## Compound Relative number R Group Activity ______________________________________ II ##STR12## 295.7 VII ##STR13## 100.0 VIII ##STR14## 544.6 IX OCH3 207.6 ##STR15## 40.2 XI ##STR16## 31.8 XII ##STR17## 9.7 XIII ##STR18## 1027.2 XIV LAspLPheOMe 118.5 XV D,L-methionine 220.1 XVI D,L-leucine 90.2 ______________________________________ TABLE 11 ______________________________________ ##STR19## Compound Relative number R Group Activity ______________________________________ XVII 2-COOH 100.0 XVIII 6-F, 2-COOH 159.00 XVIX 6-NH2, 2-COOH 10.2 XX 2-COOH 85.9 (with N at position 6) XXI 3-OH, 2-COOH 1.3 XXII ##STR20## 0.2 XXIII 4-COOH 0 XXIV 3-COOH 0 XXV 2-OH 0 XXVI 3-OH 0 XXVII 3,5-OH 0 XXVIII 2-H 0 ______________________________________ B. Kinetic parameters for phthalyl amidase The kinetic parameters of the enzyme were determined for several representative substrates. Compounds II, XVII, and XVIII were tested using 0.9 μg/ml of enzyme. Compounds III and XI were tested using 5.14 μg/ml of enzyme. Substrate concentrations were between 0 and 25 mM and reaction time was between 2 and 20 minutes, depending on the substrate used. All reactions were run at 32° C. and at pH 8.2. The Km, Vmax, Kcat, and Kcat /Km for these substrates are shown in Table 12. Km is the Michaelis constant for enzyme kinetics, Vmax is the maximal rate of reaction calculated by the Michaelis-Menten equation, and Kcat is the catalytic constant for an enzyme reaction. TABLE 12 ______________________________________ Substrate Parameter II IIIa XI XVII XVIIIb ______________________________________ Km (mM) 0.05 0.9 0.14 0.09 0.17 Vmax (μmol/sec/μmol) 5.95 7.6 0.27 1.41 1.94 Kcat (1/sec) 4.95 6.33 0.22 1.18 1.61 Kcat /Km 99.0 7.0 1.6 13.1 9.5 ______________________________________ a carbacepham nucleus (7amino-3-chloro-4-carboxy-1-carba-dethioceph-3-em) (XXXIV) quantitativel monitored as the product of substrate III. b for the other substrates, phthalic acid was the product monitored during the reaction. C. Chiral and additional substrate selectivity of phthalyl amidase. Several additional substrates were tested in a total volume of 1 ml. Reaction mixtures contained 0.009 mg (0.6 units) of enzyme, 2.5 μmol of substrate, and buffer A. All reactions were run at 30° C. for 2 minutes except for compounds XXX and XXXII, which were run for a longer time period since they were poor substrates for the enzyme. Reactions were stopped by the addition of methanol, and phthalic acid formation was monitored by HPLC. Results are shown in Table 13. The results show that the enzyme has a marked preference for the D isomer of N-phthalyl-phenylglycine. The L isomer was an extremely poor substrate for the enzyme. Compound XXXI had a relative activity twice that of compound III as a substrate for the enzyme. However, by substituting a sulfonate group for the carboxyl group of the phthalyl moiety, enzyme reactivity is completely lost. Again, these results show the selectivity of this enzyme for N-phthalylated amines and indicate that the enzyme has a chiral preference on the amine side of the substrate. TABLE 13 ______________________________________ Com- pound Relative Number Structure Activity ______________________________________ III ##STR21## 100 XVIX ##STR22## 136 D-isomer XXX ##STR23## 1.3 L-isomer XXXI ##STR24## 200 XXXII ##STR25## 0.0 ______________________________________ EXAMPLE 12 Preparative scale synthesis of carbacephem nucleus Phthalimido carbacephem (XXXIII) readily hydrolyzes to phthalamido carbacephem (III) in buffer at pH 8.0. Thus, either compound XXXIII or III can be used to prepare the carbacephem nucleus (XXXIV). Substrate (5 grams) was added to 20 ml of deionized water and the pH of the solution was adjusted to 8.0 with concentrated ammonium hydroxide. Phthalyl amidase, 80 units as determined using the chromogenic substrate (II), was added to start the reaction. Temperature was maintained at 30° C. and the pH maintained at 8.0 by adding 2 N ammonium hydroxide. After 510 minutes under these conditions, HPLC analysis of the samples from the reaction indicated that compound III was 90.0% hydrolyzed and compound XXXIII was 98% hydrolyzed. The pH of the reaction was lowered to 5.0 thereby precipitating the carbacephem nucleus. Isolated yields of the nucleus were between 65% and 77%. ##STR26## EXAMPLE 13 Expression of met-phthalyl amidase in Escherichia coli Several small sale temperature inductions of E, coli DH5α/pZPA400 were carried out to assess the amount of met-phthalyl amidase protein and enzymatic activity generated by E. coli DH5α/pZPA400. Enzymatic activity was observed by incubation of a soluble cell extract with the chromogenic substrate (II) under conditions as described in Example 3. Results are reported in Table 14. SDS-PAGE gels of the cell extract showed a Coomassie-stained protein band corresponding to approximately 50,000 daltons that increased upon temperature induction. Partial purification of the cell extract by anion exchange chromatography yielded fractions with increased phthalyl amidase specific activity. Phthalyl amidase in these fractions catalyzed cleavage of the phthalyl group from compound III to form compound XXXIV and phthalic acid. EXAMPLE 14 Expression of pro-phthalyl amidase open reading frame in Streptomyces lividans A 5 inoculum of Streptomyces lividans TK23/pZPA600 (grown for 48 hours at 30° C., 280 rpm) was added to each of two 2 L shake flasks containing 500 ml Trypticase Soy Broth medium and cultured at 30° C., 280 rpm for 24 hours. Incubations beyond 24 hours were deleterious to production of phthalyl amidase. Cells were removed by centrifugation (4° C., 15 min. 12,000× g) and phthalyl amidase activity in the cell-free broth was determined with compound III as substrate as in Example 13 (Table 14). The cell-free broth (800 ml, 0.10 mg/ml) was passed at 1 ml/min through a Mono Q column (10×10 mm (8 ml); Pharmacia). A linear gradient of 0 to 1.5 M KCl in buffer A was passed over the column and 2 ml fractions were collected. Most of the phthalyl amidase activity eluted in fractions 19 and 20 (about 0.75 M KCl). A 1 ml aliquot of fraction 19 was concentrated 10-fold via ultrafiltration and analyzed by SDS-PAGE. A major protein band was observed at about 50,000 daltons, which corresponded to the molecular weight observed by electrospray mass spectrometry for purified mature phthalyl amidase obtained from Xanthobacter agilis. It also corresponded closely to the theoretical molecular weight predicted for a protein encoded by SEQ ID NO:1. TABLE 14 ______________________________________ Activity in Activity in Expressing Crude Extract Culture Broth Organism Plasmid (nmol/min/mg) (nmol/min/L) ______________________________________ Xanthobacter agilis none 63.0 3465 Escherichia coli pZPA400 0.96 438 Streptomyces lividans pZPA600 748.8 76,378 ______________________________________ EXAMPLE 15 Use of recombinant phthalyl amidase to remove the phthalyl blocking group from phthalamido carbacephem Activity was assayed by the addition of phthalyl amidase (30 μl of Mono Q fraction 19 from Example 14, 1.83 μg total protein) to 1.82 μg of compound III in a 1 ml reaction mixture buffered by 200 mM potassium phosphate, pH 8.2. The reaction was carried out at 32° C. for 20 minutes and stopped with the addition of 1 ml methanol. After removal of precipitate by centrifugation, an aliquot (30 μl) of the supernatant fraction was monitored by HPLC (254 nm absorbance) for both the carbacephem nucleus (XXXIV) and phthalic acid using a Zorbax C8 column (0.46×15 cm; MacMod Analytical Inc.). The reaction products were eluted by a mobile phase constructed as continuous mixed gradients from (a) 1% acetonitrile/0.2% trifluoroacetic acid and (b) 80% acetonitrile/0.2% trifluoroacetic acid. The above substrate, loracarbef nucleus, and phthalic acid eluted at 11.0, 3.4, and 5.9 minutes, respectively. HPLC peaks were identified and quantitated using data generated by known amounts of authentic compounds. The specific activity of recombinant phthalyl amidase derived from fraction 19 for conversion of substrate was 9.5 μmol/min/mg protein. EXAMPLE 16 Use of recombinant phthalyl amidase to remove the phthalyl blocking group from phthalimido-aspartame In the synthesis of aspartame, the bivalent protection of the amino group of L-aspartic acid via a phthalimido moiety gives a superior substrate for a lyase-catalyzed condensation with L-phenylalanine methyl ester. However, an efficient method to convert the phthalimido-protected compound back to the amine was previously lacking. Following the condensation reaction, mild base was used to open the phthalimido moiety to a phthalamido moiety and recombinant phthalyl amidase was then used to catalyze hydrolysis of the latter to aspartame and phthalic acid (see Table 10). __________________________________________________________________________ SEQUENCE LISTING (1) GENERAL INFORMATION: (iii) NUMBER OF SEQUENCES: 12 (2) INFORMATION FOR SEQ ID NO:1: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 1359 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 1..1356 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:1: CAGGCGCCGTCTGTGCACCAACACGTCGCCTTCACTGAGGAAATTGGA48 GlnAlaProSerValHisGlnHisValAlaPheThrGluGluIleGly 151015 GACCTTCCCGACGGCTCAAGTTACATGATCCGTGTGCCGGAGAACTGG96 AspLeuProAspGlySerSerTyrMetIleArgValProGluAsnTrp 202530 AACGGCGTGTTAATTCGCGACCTAGACCTTGTCAGCGGCACCAGCAAT144 AsnGlyValLeuIleArgAspLeuAspLeuValSerGlyThrSerAsn 354045 TCTAACGCCGCAAGGTACGAAACCATGCTGAAAGAAGGTTTTGCCGTT192 SerAsnAlaAlaArgTyrGluThrMetLeuLysGluGlyPheAlaVal 505560 GCTGGCACGGCGAGGCATCCCCTTCGGCAATGGCAATATGACCCCGCT240 AlaGlyThrAlaArgHisProLeuArgGlnTrpGlnTyrAspProAla 65707580 CACGAGATTGAAAACCTCAATCACGTGCTGGACACATTCGAGGAAAAT288 HisGluIleGluAsnLeuAsnHisValLeuAspThrPheGluGluAsn 859095 TACGGTTCACCTGAAAGAGTTATCCAGTACGGTTGCTCGGGTGGGGCA336 TyrGlySerProGluArgValIleGlnTyrGlyCysSerGlyGlyAla 100105110 CACGTGTCACTAGCCGTGGCAGAGGACTTCTCGGACCGCGTAGATGGC384 HisValSerLeuAlaValAlaGluAspPheSerAspArgValAspGly 115120125 TCAGTTGCTCTAGCTGCTCATACTCCTGTCTGGATAATGAATTCTTTC432 SerValAlaLeuAlaAlaHisThrProValTrpIleMetAsnSerPhe 130135140 TTGGACGGATGGTTTTCGCTGCAGTCTCTGATCGGCGAGTACTATGTA480 LeuAspGlyTrpPheSerLeuGlnSerLeuIleGlyGluTyrTyrVal 145150155160 GAAGCTGGTCACGGCCCACTTTCGGATCTCGCTATTACGAAACTGCCC528 GluAlaGlyHisGlyProLeuSerAspLeuAlaIleThrLysLeuPro 165170175 AATGATGGTAGCTCTAATTCGAGCGGTCATGGAATGGAAGGAGATCTT576 AsnAspGlySerSerAsnSerSerGlyHisGlyMetGluGlyAspLeu 180185190 CCTGCCGCGTGGCGCAACGCGTTCACCGCTGCTAACGCCACACCTGAG624 ProAlaAlaTrpArgAsnAlaPheThrAlaAlaAsnAlaThrProGlu 195200205 GGTCGCGCACGCATGGCACTAGCCTTTGCGCTCGGTCAGTGGTCTCCG672 GlyArgAlaArgMetAlaLeuAlaPheAlaLeuGlyGlnTrpSerPro 210215220 TGGTTGGCCGACAACACGCCCCAACCTGATCTCGATGATCCTGAGGCC720 TrpLeuAlaAspAsnThrProGlnProAspLeuAspAspProGluAla 225230235240 ATCGCGGATTCCGTATATGAGTCTGCCATGCGACTTGCAGGAAGCCCT768 IleAlaAspSerValTyrGluSerAlaMetArgLeuAlaGlySerPro 245250255 GGGGGAGAAGCGCGCATAATGTTCGAGAACGCCGCTCGAGGGCAACAG816 GlyGlyGluAlaArgIleMetPheGluAsnAlaAlaArgGlyGlnGln 260265270 CTCTCTTGGAACGACGACATCGACTATGCGGATTTCTGGGAGAACTCA864 LeuSerTrpAsnAspAspIleAspTyrAlaAspPheTrpGluAsnSer 275280285 AACCCAGCCATGAAGAGCGCCGTTCAGGAGCTGTACGACACGGCCGGC912 AsnProAlaMetLysSerAlaValGlnGluLeuTyrAspThrAlaGly 290295300 CTTGATCTGCAGTCCGATATAGAAACGGTAAATTCCCAGCCACGCATA960 LeuAspLeuGlnSerAspIleGluThrValAsnSerGlnProArgIle 305310315320 GAGGCATCGCAGTATGCGCTCGACTACTGGAACACGCCAGGTCGCAAT1008 GluAlaSerGlnTyrAlaLeuAspTyrTrpAsnThrProGlyArgAsn 325330335 GTCATTGGCGACCCCGAAGTTCCTGTGCTGCGCCTGCATATGATAGGC1056 ValIleGlyAspProGluValProValLeuArgLeuHisMetIleGly 340345350 GACTACCAAATTCCCTATAGTCTTGTACAGGGCTACAGCGATCTTATC1104 AspTyrGlnIleProTyrSerLeuValGlnGlyTyrSerAspLeuIle 355360365 TCAGAGAACAACAATGATGACTTGTACAGAACTGCTTTTGTGCAATCC1152 SerGluAsnAsnAsnAspAspLeuTyrArgThrAlaPheValGlnSer 370375380 ACTGGACACTGCAATTTCACAGCTGCAGAAAGTTCCGCTGCGATTGAG1200 ThrGlyHisCysAsnPheThrAlaAlaGluSerSerAlaAlaIleGlu 385390395400 GTCATGATGCAACGGCTTGACACGGGTGAGTGGCCGAGCACCGAGCCG1248 ValMetMetGlnArgLeuAspThrGlyGluTrpProSerThrGluPro 405410415 GATGATCTGAATGCAATTGCCGAAGCCTCAAACACCGGAACTGAAGCA1296 AspAspLeuAsnAlaIleAlaGluAlaSerAsnThrGlyThrGluAla 420425430 CGTTTCATGGCCCTAGATGGCTGGGAAATACCCGAGTACAATCGTACT1344 ArgPheMetAlaLeuAspGlyTrpGluIleProGluTyrAsnArgThr 435440445 TGGAAGCCTGAATAA1359 TrpLysProGlu 450 (2) INFORMATION FOR SEQ ID NO:2: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 452 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:2: GlnAlaProSerValHisGlnHisValAlaPheThrGluGluIleGly 151015 AspLeuProAspGlySerSerTyrMetIleArgValProGluAsnTrp 202530 AsnGlyValLeuIleArgAspLeuAspLeuValSerGlyThrSerAsn 354045 SerAsnAlaAlaArgTyrGluThrMetLeuLysGluGlyPheAlaVal 505560 AlaGlyThrAlaArgHisProLeuArgGlnTrpGlnTyrAspProAla 65707580 HisGluIleGluAsnLeuAsnHisValLeuAspThrPheGluGluAsn 859095 TyrGlySerProGluArgValIleGlnTyrGlyCysSerGlyGlyAla 100105110 HisValSerLeuAlaValAlaGluAspPheSerAspArgValAspGly 115120125 SerValAlaLeuAlaAlaHisThrProValTrpIleMetAsnSerPhe 130135140 LeuAspGlyTrpPheSerLeuGlnSerLeuIleGlyGluTyrTyrVal 145150155160 GluAlaGlyHisGlyProLeuSerAspLeuAlaIleThrLysLeuPro 165170175 AsnAspGlySerSerAsnSerSerGlyHisGlyMetGluGlyAspLeu 180185190 ProAlaAlaTrpArgAsnAlaPheThrAlaAlaAsnAlaThrProGlu 195200205 GlyArgAlaArgMetAlaLeuAlaPheAlaLeuGlyGlnTrpSerPro 210215220 TrpLeuAlaAspAsnThrProGlnProAspLeuAspAspProGluAla 225230235240 IleAlaAspSerValTyrGluSerAlaMetArgLeuAlaGlySerPro 245250255 GlyGlyGluAlaArgIleMetPheGluAsnAlaAlaArgGlyGlnGln 260265270 LeuSerTrpAsnAspAspIleAspTyrAlaAspPheTrpGluAsnSer 275280285 AsnProAlaMetLysSerAlaValGlnGluLeuTyrAspThrAlaGly 290295300 LeuAspLeuGlnSerAspIleGluThrValAsnSerGlnProArgIle 305310315320 GluAlaSerGlnTyrAlaLeuAspTyrTrpAsnThrProGlyArgAsn 325330335 ValIleGlyAspProGluValProValLeuArgLeuHisMetIleGly 340345350 AspTyrGlnIleProTyrSerLeuValGlnGlyTyrSerAspLeuIle 355360365 SerGluAsnAsnAsnAspAspLeuTyrArgThrAlaPheValGlnSer 370375380 ThrGlyHisCysAsnPheThrAlaAlaGluSerSerAlaAlaIleGlu 385390395400 ValMetMetGlnArgLeuAspThrGlyGluTrpProSerThrGluPro 405410415 AspAspLeuAsnAlaIleAlaGluAlaSerAsnThrGlyThrGluAla 420425430 ArgPheMetAlaLeuAspGlyTrpGluIleProGluTyrAsnArgThr 435440445 TrpLysProGlu 450 (2) INFORMATION FOR SEQ ID NO:3: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 1485 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 1..1482 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:3: ATGATAATCAAGGGTAGTGTACCGGGTAAAGCCGGAGGAAAACCTCGA48 MetIleIleLysGlySerValProGlyLysAlaGlyGlyLysProArg 151015 GCGACCATCTTTCATAGTTCTATTGCAACGCTACTTTTAACCACAGTC96 AlaThrIlePheHisSerSerIleAlaThrLeuLeuLeuThrThrVal 202530 TCACTGTCAGGAGTAGCGCCAGCATTTGCACAGGCGCCGTCTGTGCAC144 SerLeuSerGlyValAlaProAlaPheAlaGlnAlaProSerValHis 354045 CAACACGTCGCCTTCACTGAGGAAATTGGAGACCTTCCCGACGGCTCA192 GlnHisValAlaPheThrGluGluIleGlyAspLeuProAspGlySer 505560 AGTTACATGATCCGTGTGCCGGAGAACTGGAACGGCGTGTTAATTCGC240 SerTyrMetIleArgValProGluAsnTrpAsnGlyValLeuIleArg 65707580 GACCTAGACCTTGTCAGCGGCACCAGCAATTCTAACGCCGCAAGGTAC288 AspLeuAspLeuValSerGlyThrSerAsnSerAsnAlaAlaArgTyr 859095 GAAACCATGCTGAAAGAAGGTTTTGCCGTTGCTGGCACGGCGAGGCAT336 GluThrMetLeuLysGluGlyPheAlaValAlaGlyThrAlaArgHis 100105110 CCCCTTCGGCAATGGCAATATGACCCCGCTCACGAGATTGAAAACCTC384 ProLeuArgGlnTrpGlnTyrAspProAlaHisGluIleGluAsnLeu 115120125 AATCACGTGCTGGACACATTCGAGGAAAATTACGGTTCACCTGAAAGA432 AsnHisValLeuAspThrPheGluGluAsnTyrGlySerProGluArg 130135140 GTTATCCAGTACGGTTGCTCGGGTGGGGCACACGTGTCACTAGCCGTG480 ValIleGlnTyrGlyCysSerGlyGlyAlaHisValSerLeuAlaVal 145150155160 GCAGAGGACTTCTCGGACCGCGTAGATGGCTCAGTTGCTCTAGCTGCT528 AlaGluAspPheSerAspArgValAspGlySerValAlaLeuAlaAla 165170175 CATACTCCTGTCTGGATAATGAATTCTTTCTTGGACGGATGGTTTTCG576 HisThrProValTrpIleMetAsnSerPheLeuAspGlyTrpPheSer 180185190 CTGCAGTCTCTGATCGGCGAGTACTATGTAGAAGCTGGTCACGGCCCA624 LeuGlnSerLeuIleGlyGluTyrTyrValGluAlaGlyHisGlyPro 195200205 CTTTCGGATCTCGCTATTACGAAACTGCCCAATGATGGTAGCTCTAAT672 LeuSerAspLeuAlaIleThrLysLeuProAsnAspGlySerSerAsn 210215220 TCGAGCGGTCATGGAATGGAAGGAGATCTTCCTGCCGCGTGGCGCAAC720 SerSerGlyHisGlyMetGluGlyAspLeuProAlaAlaTrpArgAsn 225230235240 GCGTTCACCGCTGCTAACGCCACACCTGAGGGTCGCGCACGCATGGCA768 AlaPheThrAlaAlaAsnAlaThrProGluGlyArgAlaArgMetAla 245250255 CTAGCCTTTGCGCTCGGTCAGTGGTCTCCGTGGTTGGCCGACAACACG816 LeuAlaPheAlaLeuGlyGlnTrpSerProTrpLeuAlaAspAsnThr 260265270 CCCCAACCTGATCTCGATGATCCTGAGGCCATCGCGGATTCCGTATAT864 ProGlnProAspLeuAspAspProGluAlaIleAlaAspSerValTyr 275280285 GAGTCTGCCATGCGACTTGCAGGAAGCCCTGGGGGAGAAGCGCGCATA912 GluSerAlaMetArgLeuAlaGlySerProGlyGlyGluAlaArgIle 290295300 ATGTTCGAGAACGCCGCTCGAGGGCAACAGCTCTCTTGGAACGACGAC960 MetPheGluAsnAlaAlaArgGlyGlnGlnLeuSerTrpAsnAspAsp 305310315320 ATCGACTATGCGGATTTCTGGGAGAACTCAAACCCAGCCATGAAGAGC1008 IleAspTyrAlaAspPheTrpGluAsnSerAsnProAlaMetLysSer 325330335 GCCGTTCAGGAGCTGTACGACACGGCCGGCCTTGATCTGCAGTCCGAT1056 AlaValGlnGluLeuTyrAspThrAlaGlyLeuAspLeuGlnSerAsp 340345350 ATAGAAACGGTAAATTCCCAGCCACGCATAGAGGCATCGCAGTATGCG1104 IleGluThrValAsnSerGlnProArgIleGluAlaSerGlnTyrAla 355360365 CTCGACTACTGGAACACGCCAGGTCGCAATGTCATTGGCGACCCCGAA1152 LeuAspTyrTrpAsnThrProGlyArgAsnValIleGlyAspProGlu 370375380 GTTCCTGTGCTGCGCCTGCATATGATAGGCGACTACCAAATTCCCTAT1200 ValProValLeuArgLeuHisMetIleGlyAspTyrGlnIleProTyr 385390395400 AGTCTTGTACAGGGCTACAGCGATCTTATCTCAGAGAACAACAATGAT1248 SerLeuValGlnGlyTyrSerAspLeuIleSerGluAsnAsnAsnAsp 405410415 GACTTGTACAGAACTGCTTTTGTGCAATCCACTGGACACTGCAATTTC1296 AspLeuTyrArgThrAlaPheValGlnSerThrGlyHisCysAsnPhe 420425430 ACAGCTGCAGAAAGTTCCGCTGCGATTGAGGTCATGATGCAACGGCTT1344 ThrAlaAlaGluSerSerAlaAlaIleGluValMetMetGlnArgLeu 435440445 GACACGGGTGAGTGGCCGAGCACCGAGCCGGATGATCTGAATGCAATT1392 AspThrGlyGluTrpProSerThrGluProAspAspLeuAsnAlaIle 450455460 GCCGAAGCCTCAAACACCGGAACTGAAGCACGTTTCATGGCCCTAGAT1440 AlaGluAlaSerAsnThrGlyThrGluAlaArgPheMetAlaLeuAsp 465470475480 GGCTGGGAAATACCCGAGTACAATCGTACTTGGAAGCCTGAATAA1485 GlyTrpGluIleProGluTyrAsnArgThrTrpLysProGlu 485490 (2) INFORMATION FOR SEQ ID NO:4: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 494 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:4: MetIleIleLysGlySerValProGlyLysAlaGlyGlyLysProArg 151015 AlaThrIlePheHisSerSerIleAlaThrLeuLeuLeuThrThrVal 202530 SerLeuSerGlyValAlaProAlaPheAlaGlnAlaProSerValHis 354045 GlnHisValAlaPheThrGluGluIleGlyAspLeuProAspGlySer 505560 SerTyrMetIleArgValProGluAsnTrpAsnGlyValLeuIleArg 65707580 AspLeuAspLeuValSerGlyThrSerAsnSerAsnAlaAlaArgTyr 859095 GluThrMetLeuLysGluGlyPheAlaValAlaGlyThrAlaArgHis 100105110 ProLeuArgGlnTrpGlnTyrAspProAlaHisGluIleGluAsnLeu 115120125 AsnHisValLeuAspThrPheGluGluAsnTyrGlySerProGluArg 130135140 ValIleGlnTyrGlyCysSerGlyGlyAlaHisValSerLeuAlaVal 145150155160 AlaGluAspPheSerAspArgValAspGlySerValAlaLeuAlaAla 165170175 HisThrProValTrpIleMetAsnSerPheLeuAspGlyTrpPheSer 180185190 LeuGlnSerLeuIleGlyGluTyrTyrValGluAlaGlyHisGlyPro 195200205 LeuSerAspLeuAlaIleThrLysLeuProAsnAspGlySerSerAsn 210215220 SerSerGlyHisGlyMetGluGlyAspLeuProAlaAlaTrpArgAsn 225230235240 AlaPheThrAlaAlaAsnAlaThrProGluGlyArgAlaArgMetAla 245250255 LeuAlaPheAlaLeuGlyGlnTrpSerProTrpLeuAlaAspAsnThr 260265270 ProGlnProAspLeuAspAspProGluAlaIleAlaAspSerValTyr 275280285 GluSerAlaMetArgLeuAlaGlySerProGlyGlyGluAlaArgIle 290295300 MetPheGluAsnAlaAlaArgGlyGlnGlnLeuSerTrpAsnAspAsp 305310315320 IleAspTyrAlaAspPheTrpGluAsnSerAsnProAlaMetLysSer 325330335 AlaValGlnGluLeuTyrAspThrAlaGlyLeuAspLeuGlnSerAsp 340345350 IleGluThrValAsnSerGlnProArgIleGluAlaSerGlnTyrAla 355360365 LeuAspTyrTrpAsnThrProGlyArgAsnValIleGlyAspProGlu 370375380 ValProValLeuArgLeuHisMetIleGlyAspTyrGlnIleProTyr 385390395400 SerLeuValGlnGlyTyrSerAspLeuIleSerGluAsnAsnAsnAsp 405410415 AspLeuTyrArgThrAlaPheValGlnSerThrGlyHisCysAsnPhe 420425430 ThrAlaAlaGluSerSerAlaAlaIleGluValMetMetGlnArgLeu 435440445 AspThrGlyGluTrpProSerThrGluProAspAspLeuAsnAlaIle 450455460 AlaGluAlaSerAsnThrGlyThrGluAlaArgPheMetAlaLeuAsp 465470475480 GlyTrpGluIleProGluTyrAsnArgThrTrpLysProGlu 485490 (2) INFORMATION FOR SEQ ID NO:5: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 1620 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 136..1617 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:5: GGATCCTTAGGAATCTAAACATTCTGGTTGACACTCCACATTTTGAATGTCAGCATTTCG60 GCCATGGCTGCTATGCAGCCTGTTATTGCATTTGAAATGGAATAGATCAGCAAACTTATC120 GGGAGGATGAGTATTATGATAATCAAGGGTAGTGTACCGGGTAAAGCCGGA171 MetIleIleLysGlySerValProGlyLysAlaGly 1510 GGAAAACCTCGAGCGACCATCTTTCATAGTTCTATTGCAACGCTACTT219 GlyLysProArgAlaThrIlePheHisSerSerIleAlaThrLeuLeu 152025 TTAACCACAGTCTCACTGTCAGGAGTAGCGCCAGCATTTGCACAGGCG267 LeuThrThrValSerLeuSerGlyValAlaProAlaPheAlaGlnAla 303540 CCGTCTGTGCACCAACACGTCGCCTTCACTGAGGAAATTGGAGACCTT315 ProSerValHisGlnHisValAlaPheThrGluGluIleGlyAspLeu 45505560 CCCGACGGCTCAAGTTACATGATCCGTGTGCCGGAGAACTGGAACGGC363 ProAspGlySerSerTyrMetIleArgValProGluAsnTrpAsnGly 657075 GTGTTAATTCGCGACCTAGACCTTGTCAGCGGCACCAGCAATTCTAAC411 ValLeuIleArgAspLeuAspLeuValSerGlyThrSerAsnSerAsn 808590 GCCGCAAGGTACGAAACCATGCTGAAAGAAGGTTTTGCCGTTGCTGGC459 AlaAlaArgTyrGluThrMetLeuLysGluGlyPheAlaValAlaGly 95100105 ACGGCGAGGCATCCCCTTCGGCAATGGCAATATGACCCCGCTCACGAG507 ThrAlaArgHisProLeuArgGlnTrpGlnTyrAspProAlaHisGlu 110115120 ATTGAAAACCTCAATCACGTGCTGGACACATTCGAGGAAAATTACGGT555 IleGluAsnLeuAsnHisValLeuAspThrPheGluGluAsnTyrGly 125130135140 TCACCTGAAAGAGTTATCCAGTACGGTTGCTCGGGTGGGGCACACGTG603 SerProGluArgValIleGlnTyrGlyCysSerGlyGlyAlaHisVal 145150155 TCACTAGCCGTGGCAGAGGACTTCTCGGACCGCGTAGATGGCTCAGTT651 SerLeuAlaValAlaGluAspPheSerAspArgValAspGlySerVal 160165170 GCTCTAGCTGCTCATACTCCTGTCTGGATAATGAATTCTTTCTTGGAC699 AlaLeuAlaAlaHisThrProValTrpIleMetAsnSerPheLeuAsp 175180185 GGATGGTTTTCGCTGCAGTCTCTGATCGGCGAGTACTATGTAGAAGCT747 GlyTrpPheSerLeuGlnSerLeuIleGlyGluTyrTyrValGluAla 190195200 GGTCACGGCCCACTTTCGGATCTCGCTATTACGAAACTGCCCAATGAT795 GlyHisGlyProLeuSerAspLeuAlaIleThrLysLeuProAsnAsp 205210215220 GGTAGCTCTAATTCGAGCGGTCATGGAATGGAAGGAGATCTTCCTGCC843 GlySerSerAsnSerSerGlyHisGlyMetGluGlyAspLeuProAla 225230235 GCGTGGCGCAACGCGTTCACCGCTGCTAACGCCACACCTGAGGGTCGC891 AlaTrpArgAsnAlaPheThrAlaAlaAsnAlaThrProGluGlyArg 240245250 GCACGCATGGCACTAGCCTTTGCGCTCGGTCAGTGGTCTCCGTGGTTG939 AlaArgMetAlaLeuAlaPheAlaLeuGlyGlnTrpSerProTrpLeu 255260265 GCCGACAACACGCCCCAACCTGATCTCGATGATCCTGAGGCCATCGCG987 AlaAspAsnThrProGlnProAspLeuAspAspProGluAlaIleAla 270275280 GATTCCGTATATGAGTCTGCCATGCGACTTGCAGGAAGCCCTGGGGGA1035 AspSerValTyrGluSerAlaMetArgLeuAlaGlySerProGlyGly 285290295300 GAAGCGCGCATAATGTTCGAGAACGCCGCTCGAGGGCAACAGCTCTCT1083 GluAlaArgIleMetPheGluAsnAlaAlaArgGlyGlnGlnLeuSer 305310315 TGGAACGACGACATCGACTATGCGGATTTCTGGGAGAACTCAAACCCA1131 TrpAsnAspAspIleAspTyrAlaAspPheTrpGluAsnSerAsnPro 320325330 GCCATGAAGAGCGCCGTTCAGGAGCTGTACGACACGGCCGGCCTTGAT1179 AlaMetLysSerAlaValGlnGluLeuTyrAspThrAlaGlyLeuAsp 335340345 CTGCAGTCCGATATAGAAACGGTAAATTCCCAGCCACGCATAGAGGCA1227 LeuGlnSerAspIleGluThrValAsnSerGlnProArgIleGluAla 350355360 TCGCAGTATGCGCTCGACTACTGGAACACGCCAGGTCGCAATGTCATT1275 SerGlnTyrAlaLeuAspTyrTrpAsnThrProGlyArgAsnValIle 365370375380 GGCGACCCCGAAGTTCCTGTGCTGCGCCTGCATATGATAGGCGACTAC1323 GlyAspProGluValProValLeuArgLeuHisMetIleGlyAspTyr 385390395 CAAATTCCCTATAGTCTTGTACAGGGCTACAGCGATCTTATCTCAGAG1371 GlnIleProTyrSerLeuValGlnGlyTyrSerAspLeuIleSerGlu 400405410 AACAACAATGATGACTTGTACAGAACTGCTTTTGTGCAATCCACTGGA1419 AsnAsnAsnAspAspLeuTyrArgThrAlaPheValGlnSerThrGly 415420425 CACTGCAATTTCACAGCTGCAGAAAGTTCCGCTGCGATTGAGGTCATG1467 HisCysAsnPheThrAlaAlaGluSerSerAlaAlaIleGluValMet 430435440 ATGCAACGGCTTGACACGGGTGAGTGGCCGAGCACCGAGCCGGATGAT1515 MetGlnArgLeuAspThrGlyGluTrpProSerThrGluProAspAsp 445450455460 CTGAATGCAATTGCCGAAGCCTCAAACACCGGAACTGAAGCACGTTTC1563 LeuAsnAlaIleAlaGluAlaSerAsnThrGlyThrGluAlaArgPhe 465470475 ATGGCCCTAGATGGCTGGGAAATACCCGAGTACAATCGTACTTGGAAG1611 MetAlaLeuAspGlyTrpGluIleProGluTyrAsnArgThrTrpLys 480485490 CCTGAATAA1620 ProGlu (2) INFORMATION FOR SEQ ID NO:6: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 3029 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 136..1617 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:6: GGATCCTTAGGAATCTAAACATTCTGGTTGACACTCCACATTTTGAATGTCAGCATTTCG60 GCCATGGCTGCTATGCAGCCTGTTATTGCATTTGAAATGGAATAGATCAGCAAACTTATC120 GGGAGGATGAGTATTATGATAATCAAGGGTAGTGTACCGGGTAAAGCCGGA171 MetIleIleLysGlySerValProGlyLysAlaGly 1510 GGAAAACCTCGAGCGACCATCTTTCATAGTTCTATTGCAACGCTACTT219 GlyLysProArgAlaThrIlePheHisSerSerIleAlaThrLeuLeu 152025 TTAACCACAGTCTCACTGTCAGGAGTAGCGCCAGCATTTGCACAGGCG267 LeuThrThrValSerLeuSerGlyValAlaProAlaPheAlaGlnAla 303540 CCGTCTGTGCACCAACACGTCGCCTTCACTGAGGAAATTGGAGACCTT315 ProSerValHisGlnHisValAlaPheThrGluGluIleGlyAspLeu 45505560 CCCGACGGCTCAAGTTACATGATCCGTGTGCCGGAGAACTGGAACGGC363 ProAspGlySerSerTyrMetIleArgValProGluAsnTrpAsnGly 657075 GTGTTAATTCGCGACCTAGACCTTGTCAGCGGCACCAGCAATTCTAAC411 ValLeuIleArgAspLeuAspLeuValSerGlyThrSerAsnSerAsn 808590 GCCGCAAGGTACGAAACCATGCTGAAAGAAGGTTTTGCCGTTGCTGGC459 AlaAlaArgTyrGluThrMetLeuLysGluGlyPheAlaValAlaGly 95100105 ACGGCGAGGCATCCCCTTCGGCAATGGCAATATGACCCCGCTCACGAG507 ThrAlaArgHisProLeuArgGlnTrpGlnTyrAspProAlaHisGlu 110115120 ATTGAAAACCTCAATCACGTGCTGGACACATTCGAGGAAAATTACGGT555 IleGluAsnLeuAsnHisValLeuAspThrPheGluGluAsnTyrGly 125130135140 TCACCTGAAAGAGTTATCCAGTACGGTTGCTCGGGTGGGGCACACGTG603 SerProGluArgValIleGlnTyrGlyCysSerGlyGlyAlaHisVal 145150155 TCACTAGCCGTGGCAGAGGACTTCTCGGACCGCGTAGATGGCTCAGTT651 SerLeuAlaValAlaGluAspPheSerAspArgValAspGlySerVal 160165170 GCTCTAGCTGCTCATACTCCTGTCTGGATAATGAATTCTTTCTTGGAC699 AlaLeuAlaAlaHisThrProValTrpIleMetAsnSerPheLeuAsp 175180185 GGATGGTTTTCGCTGCAGTCTCTGATCGGCGAGTACTATGTAGAAGCT747 GlyTrpPheSerLeuGlnSerLeuIleGlyGluTyrTyrValGluAla 190195200 GGTCACGGCCCACTTTCGGATCTCGCTATTACGAAACTGCCCAATGAT795 GlyHisGlyProLeuSerAspLeuAlaIleThrLysLeuProAsnAsp 205210215220 GGTAGCTCTAATTCGAGCGGTCATGGAATGGAAGGAGATCTTCCTGCC843 GlySerSerAsnSerSerGlyHisGlyMetGluGlyAspLeuProAla 225230235 GCGTGGCGCAACGCGTTCACCGCTGCTAACGCCACACCTGAGGGTCGC891 AlaTrpArgAsnAlaPheThrAlaAlaAsnAlaThrProGluGlyArg 240245250 GCACGCATGGCACTAGCCTTTGCGCTCGGTCAGTGGTCTCCGTGGTTG939 AlaArgMetAlaLeuAlaPheAlaLeuGlyGlnTrpSerProTrpLeu 255260265 GCCGACAACACGCCCCAACCTGATCTCGATGATCCTGAGGCCATCGCG987 AlaAspAsnThrProGlnProAspLeuAspAspProGluAlaIleAla 270275280 GATTCCGTATATGAGTCTGCCATGCGACTTGCAGGAAGCCCTGGGGGA1035 AspSerValTyrGluSerAlaMetArgLeuAlaGlySerProGlyGly 285290295300 GAAGCGCGCATAATGTTCGAGAACGCCGCTCGAGGGCAACAGCTCTCT1083 GluAlaArgIleMetPheGluAsnAlaAlaArgGlyGlnGlnLeuSer 305310315 TGGAACGACGACATCGACTATGCGGATTTCTGGGAGAACTCAAACCCA1131 TrpAsnAspAspIleAspTyrAlaAspPheTrpGluAsnSerAsnPro 320325330 GCCATGAAGAGCGCCGTTCAGGAGCTGTACGACACGGCCGGCCTTGAT1179 AlaMetLysSerAlaValGlnGluLeuTyrAspThrAlaGlyLeuAsp 335340345 CTGCAGTCCGATATAGAAACGGTAAATTCCCAGCCACGCATAGAGGCA1227 LeuGlnSerAspIleGluThrValAsnSerGlnProArgIleGluAla 350355360 TCGCAGTATGCGCTCGACTACTGGAACACGCCAGGTCGCAATGTCATT1275 SerGlnTyrAlaLeuAspTyrTrpAsnThrProGlyArgAsnValIle 365370375380 GGCGACCCCGAAGTTCCTGTGCTGCGCCTGCATATGATAGGCGACTAC1323 GlyAspProGluValProValLeuArgLeuHisMetIleGlyAspTyr 385390395 CAAATTCCCTATAGTCTTGTACAGGGCTACAGCGATCTTATCTCAGAG1371 GlnIleProTyrSerLeuValGlnGlyTyrSerAspLeuIleSerGlu 400405410 AACAACAATGATGACTTGTACAGAACTGCTTTTGTGCAATCCACTGGA1419 AsnAsnAsnAspAspLeuTyrArgThrAlaPheValGlnSerThrGly 415420425 CACTGCAATTTCACAGCTGCAGAAAGTTCCGCTGCGATTGAGGTCATG1467 HisCysAsnPheThrAlaAlaGluSerSerAlaAlaIleGluValMet 430435440 ATGCAACGGCTTGACACGGGTGAGTGGCCGAGCACCGAGCCGGATGAT1515 MetGlnArgLeuAspThrGlyGluTrpProSerThrGluProAspAsp 445450455460 CTGAATGCAATTGCCGAAGCCTCAAACACCGGAACTGAAGCACGTTTC1563 LeuAsnAlaIleAlaGluAlaSerAsnThrGlyThrGluAlaArgPhe 465470475 ATGGCCCTAGATGGCTGGGAAATACCCGAGTACAATCGTACTTGGAAG1611 MetAlaLeuAspGlyTrpGluIleProGluTyrAsnArgThrTrpLys 480485490 CCTGAATAATCACCATTCTGGAGGCTCACGTTCGCGAAGGGTTGCGGCGAAGAAAA1667 ProGlu CATGCGCCGCAACCTATCCTCCAAACAAGGGCCAGTTCAACGACGAACAAGCCAGACCGG1727 CGCAAGCCGCGCTAATCTAATTCACCGCTCCAACCCGCGATCTCGCGACCGCCCGCGCTG1787 CATGTCGAGCTTCTGTTGCTGCGCCCGCTCAAGCGTATAATCACGCCGGATAATCGTTTC1847 CCGCGCTTTGTTCGTGATCCTTGCAACGTCCTTGATGCGATCGACGTTACGGGCTGTCTC1907 TGAAGGCTGTGAGCGTGTGCGATCAAGCGCCTGATCGATATCGCGATGATTGCTTGATCC1967 GAACCGGATCTGCATAGCCCGGGCAATACGTTTGGCTTCATCAAGCGCCTGTTTGCCATC2027 AGCCGTCTTTTCGAGCTGATCGACAAAGCCCGTCCGTGCCTTCGCATCCTTGATCTGATC2087 GAGCTGCCTGAGCAGGGTTTCGCTGCGAGGTGAGAGGCCAGGAATCTCGACGCGATCATT2147 ATTGTCACGCCGCCATTGTTCGGCTTCCTTTTCCTCGGCAAAGCGCCGCGTCCAGGTCTT2207 CCCCGCCGCGTCCAGATGCGAACTCATCGCCTCGGCCCGCTTGAGGGCATTTTTTGCGCT2267 CGGCATTGGCACCGAACAGGCCGAACTTGCCGCGCAGCTGTTGATTTCTGCTGAGAAGTG2327 ACCCGGTATTGGAGTGAACCCCTGGGACTGGACCAGCGGGGAAGAAAAGCTGATACGCTC2387 TGTGGGCCTTGAATGGAGAAGGTCCATGTCACCAAGAGGTCCCTACCGCCGTCACTCGAT2447 GCAGTTCAAGCGTAAGCGCCAAGCCTGGCCCGTCTGGTGATGGCTGCCTTTGAGCGCTAT2507 CGACACCCCGGAGTTAGTGATGGGTGTCATGTTCTATGTCTGCGACTATGCCTGCAGATA2567 GAAGTTTCCAGTTGATCGAGGCGGTTCCGGATCGGATGGAGGGCGCTCCGGTTGCGCGGC2627 GACGCCGGTGGTCGGACGCGTTCAAGGCCGAGATGGTAGCGCGCAGCTTCGAACCTGGAA2687 CGAATGTGTCGGCACTGGCGCGCGAGATCGGCATCCAGTCCTCGCAGTTGTTCGGCTGGC2747 GCGCCGAGGCCCTCAAGCGCGGAGAGGTGGAAAGGCGCGATGTTGATATCGTTGCAACGC2807 AAGCCTCTCGCTTGGTGAGCGGGACGGTCGAGATCGCGGTCAACGACACGGTGATCCGGG2867 TCGGCATTGATATCGGGGAAGACCATTTGCGGCGCGTGATCCGCGCTGTGCGGTCGGCAT2927 GATCCCTGCGGGTGTGAAGGTCTATCTGGCCAGCCAGCCGGTAGACTTCAGGAAAGGTCC2987 AGACGGCCTTGTTGGCCTGGTGCGCGATGCTGGAGCGGATCC3029 (2) INFORMATION FOR SEQ ID NO:7: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 135 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:7: GGATCCTTAGGAATCTAAACATTCTGGTTGACACTCCACATTTTGAATGTCAGCATTTCG60 GCCATGGCTGCTATGCAGCCTGTTATTGCATTTGAAATGGAATAGATCAGCAAACTTATC120 GGGAGGATGAGTATT135 (2) INFORMATION FOR SEQ ID NO:8: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 126 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 1..126 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:8: ATGATAATCAAGGGTAGTGTACCGGGTAAAGCCGGAGGAAAACCTCGA48 MetIleIleLysGlySerValProGlyLysAlaGlyGlyLysProArg 151015 GCGACCATCTTTCATAGTTCTATTGCAACGCTACTTTTAACCACAGTC96 AlaThrIlePheHisSerSerIleAlaThrLeuLeuLeuThrThrVal 202530 TCACTGTCAGGAGTAGCGCCAGCATTTGCA126 SerLeuSerGlyValAlaProAlaPheAla 3540 (2) INFORMATION FOR SEQ ID NO:9: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 42 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:9: MetIleIleLysGlySerValProGlyLysAlaGlyGlyLysProArg 151015 AlaThrIlePheHisSerSerIleAlaThrLeuLeuLeuThrThrVal 202530 SerLeuSerGlyValAlaProAlaPheAla 3540 (2) INFORMATION FOR SEQ ID NO:10: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 1409 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (xi) SEQUENCE DESCRIPTION: SEQ ID NO:10: TCACCATTCTGGAGGCTCACGTTCGCGAAGGGTTGCGGCGAAGAAAACATGCGCCGCAAC60 CTATCCTCCAAACAAGGGCCAGTTCAACGACGAACAAGCCAGACCGGCGCAAGCCGCGCT120 AATCTAATTCACCGCTCCAACCCGCGATCTCGCGACCGCCCGCGCTGCATGTCGAGCTTC180 TGTTGCTGCGCCCGCTCAAGCGTATAATCACGCCGGATAATCGTTTCCCGCGCTTTGTTC240 GTGATCCTTGCAACGTCCTTGATGCGATCGACGTTACGGGCTGTCTCTGAAGGCTGTGAG300 CGTGTGCGATCAAGCGCCTGATCGATATCGCGATGATTGCTTGATCCGAACCGGATCTGC360 ATAGCCCGGGCAATACGTTTGGCTTCATCAAGCGCCTGTTTGCCATCAGCCGTCTTTTCG420 AGCTGATCGACAAAGCCCGTCCGTGCCTTCGCATCCTTGATCTGATCGAGCTGCCTGAGC480 AGGGTTTCGCTGCGAGGTGAGAGGCCAGGAATCTCGACGCGATCATTATTGTCACGCCGC540 CATTGTTCGGCTTCCTTTTCCTCGGCAAAGCGCCGCGTCCAGGTCTTCCCCGCCGCGTCC600 AGATGCGAACTCATCGCCTCGGCCCGCTTGAGGGCATTTTTTGCGCTCGGCATTGGCACC660 GAACAGGCCGAACTTGCCGCGCAGCTGTTGATTTCTGCTGAGAAGTGACCCGGTATTGGA720 GTGAACCCCTGGGACTGGACCAGCGGGGAAGAAAAGCTGATACGCTCTGTGGGCCTTGAA780 TGGAGAAGGTCCATGTCACCAAGAGGTCCCTACCGCCGTCACTCGATGCAGTTCAAGCGT840 AAGCGCCAAGCCTGGCCCGTCTGGTGATGGCTGCCTTTGAGCGCTATCGACACCCCGGAG900 TTAGTGATGGGTGTCATGTTCTATGTCTGCGACTATGCCTGCAGATAGAAGTTTCCAGTT960 GATCGAGGCGGTTCCGGATCGGATGGAGGGCGCTCCGGTTGCGCGGCGACGCCGGTGGTC1020 GGACGCGTTCAAGGCCGAGATGGTAGCGCGCAGCTTCGAACCTGGAACGAATGTGTCGGC1080 ACTGGCGCGCGAGATCGGCATCCAGTCCTCGCAGTTGTTCGGCTGGCGCGCCGAGGCCCT1140 CAAGCGCGGAGAGGTGGAAAGGCGCGATGTTGATATCGTTGCAACGCAAGCCTCTCGCTT1200 GGTGAGCGGGACGGTCGAGATCGCGGTCAACGACACGGTGATCCGGGTCGGCATTGATAT1260 CGGGGAAGACCATTTGCGGCGCGTGATCCGCGCTGTGCGGTCGGCATGATCCCTGCGGGT1320 GTGAAGGTCTATCTGGCCAGCCAGCCGGTAGACTTCAGGAAAGGTCCAGACGGCCTTGTT1380 GGCCTGGTGCGCGATGCTGGAGCGGATCC1409 (2) INFORMATION FOR SEQ ID NO:11: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 1362 base pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear (ii) MOLECULE TYPE: DNA (genomic) (ix) FEATURE: (A) NAME/KEY: CDS (B) LOCATION: 1..1359 (xi) SEQUENCE DESCRIPTION: SEQ ID NO:11: ATGCAGGCGCCGTCTGTGCACCAACACGTCGCCTTCACTGAGGAAATT48 MetGlnAlaProSerValHisGlnHisValAlaPheThrGluGluIle 151015 GGAGACCTTCCCGACGGCTCAAGTTACATGATCCGTGTGCCGGAGAAC96 GlyAspLeuProAspGlySerSerTyrMetIleArgValProGluAsn 202530 TGGAACGGCGTGTTAATTCGCGACCTAGACCTTGTCAGCGGCACCAGC144 TrpAsnGlyValLeuIleArgAspLeuAspLeuValSerGlyThrSer 354045 AATTCTAACGCCGCAAGGTACGAAACCATGCTGAAAGAAGGTTTTGCC192 AsnSerAsnAlaAlaArgTyrGluThrMetLeuLysGluGlyPheAla 505560 GTTGCTGGCACGGCGAGGCATCCCCTTCGGCAATGGCAATATGACCCC240 ValAlaGlyThrAlaArgHisProLeuArgGlnTrpGlnTyrAspPro 65707580 GCTCACGAGATTGAAAACCTCAATCACGTGCTGGACACATTCGAGGAA288 AlaHisGluIleGluAsnLeuAsnHisValLeuAspThrPheGluGlu 859095 AATTACGGTTCACCTGAAAGAGTTATCCAGTACGGTTGCTCGGGTGGG336 AsnTyrGlySerProGluArgValIleGlnTyrGlyCysSerGlyGly 100105110 GCACACGTGTCACTAGCCGTGGCAGAGGACTTCTCGGACCGCGTAGAT384 AlaHisValSerLeuAlaValAlaGluAspPheSerAspArgValAsp 115120125 GGCTCAGTTGCTCTAGCTGCTCATACTCCTGTCTGGATAATGAATTCT432 GlySerValAlaLeuAlaAlaHisThrProValTrpIleMetAsnSer 130135140 TTCTTGGACGGATGGTTTTCGCTGCAGTCTCTGATCGGCGAGTACTAT480 PheLeuAspGlyTrpPheSerLeuGlnSerLeuIleGlyGluTyrTyr 145150155160 GTAGAAGCTGGTCACGGCCCACTTTCGGATCTCGCTATTACGAAACTG528 ValGluAlaGlyHisGlyProLeuSerAspLeuAlaIleThrLysLeu 165170175 CCCAATGATGGTAGCTCTAATTCGAGCGGTCATGGAATGGAAGGAGAT576 ProAsnAspGlySerSerAsnSerSerGlyHisGlyMetGluGlyAsp 180185190 CTTCCTGCCGCGTGGCGCAACGCGTTCACCGCTGCTAACGCCACACCT624 LeuProAlaAlaTrpArgAsnAlaPheThrAlaAlaAsnAlaThrPro 195200205 GAGGGTCGCGCACGCATGGCACTAGCCTTTGCGCTCGGTCAGTGGTCT672 GluGlyArgAlaArgMetAlaLeuAlaPheAlaLeuGlyGlnTrpSer 210215220 CCGTGGTTGGCCGACAACACGCCCCAACCTGATCTCGATGATCCTGAG720 ProTrpLeuAlaAspAsnThrProGlnProAspLeuAspAspProGlu 225230235240 GCCATCGCGGATTCCGTATATGAGTCTGCCATGCGACTTGCAGGAAGC768 AlaIleAlaAspSerValTyrGluSerAlaMetArgLeuAlaGlySer 245250255 CCTGGGGGAGAAGCGCGCATAATGTTCGAGAACGCCGCTCGAGGGCAA816 ProGlyGlyGluAlaArgIleMetPheGluAsnAlaAlaArgGlyGln 260265270 CAGCTCTCTTGGAACGACGACATCGACTATGCGGATTTCTGGGAGAAC864 GlnLeuSerTrpAsnAspAspIleAspTyrAlaAspPheTrpGluAsn 275280285 TCAAACCCAGCCATGAAGAGCGCCGTTCAGGAGCTGTACGACACGGCC912 SerAsnProAlaMetLysSerAlaValGlnGluLeuTyrAspThrAla 290295300 GGCCTTGATCTGCAGTCCGATATAGAAACGGTAAATTCCCAGCCACGC960 GlyLeuAspLeuGlnSerAspIleGluThrValAsnSerGlnProArg 305310315320 ATAGAGGCATCGCAGTATGCGCTCGACTACTGGAACACGCCAGGTCGC1008 IleGluAlaSerGlnTyrAlaLeuAspTyrTrpAsnThrProGlyArg 325330335 AATGTCATTGGCGACCCCGAAGTTCCTGTGCTGCGCCTGCATATGATA1056 AsnValIleGlyAspProGluValProValLeuArgLeuHisMetIle 340345350 GGCGACTACCAAATTCCCTATAGTCTTGTACAGGGCTACAGCGATCTT1104 GlyAspTyrGlnIleProTyrSerLeuValGlnGlyTyrSerAspLeu 355360365 ATCTCAGAGAACAACAATGATGACTTGTACAGAACTGCTTTTGTGCAA1152 IleSerGluAsnAsnAsnAspAspLeuTyrArgThrAlaPheValGln 370375380 TCCACTGGACACTGCAATTTCACAGCTGCAGAAAGTTCCGCTGCGATT1200 SerThrGlyHisCysAsnPheThrAlaAlaGluSerSerAlaAlaIle 385390395400 GAGGTCATGATGCAACGGCTTGACACGGGTGAGTGGCCGAGCACCGAG1248 GluValMetMetGlnArgLeuAspThrGlyGluTrpProSerThrGlu 405410415 CCGGATGATCTGAATGCAATTGCCGAAGCCTCAAACACCGGAACTGAA1296 ProAspAspLeuAsnAlaIleAlaGluAlaSerAsnThrGlyThrGlu 420425430 GCACGTTTCATGGCCCTAGATGGCTGGGAAATACCCGAGTACAATCGT1344 AlaArgPheMetAlaLeuAspGlyTrpGluIleProGluTyrAsnArg 435440445 ACTTGGAAGCCTGAATAA1362 ThrTrpLysProGlu 450 (2) INFORMATION FOR SEQ ID NO:12: (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 453 amino acids (B) TYPE: amino acid (D) TOPOLOGY: linear (ii) MOLECULE TYPE: protein (xi) SEQUENCE DESCRIPTION: SEQ ID NO:12: MetGlnAlaProSerValHisGlnHisValAlaPheThrGluGluIle 151015 GlyAspLeuProAspGlySerSerTyrMetIleArgValProGluAsn 202530 TrpAsnGlyValLeuIleArgAspLeuAspLeuValSerGlyThrSer 354045 AsnSerAsnAlaAlaArgTyrGluThrMetLeuLysGluGlyPheAla 505560 ValAlaGlyThrAlaArgHisProLeuArgGlnTrpGlnTyrAspPro 65707580 AlaHisGluIleGluAsnLeuAsnHisValLeuAspThrPheGluGlu 859095 AsnTyrGlySerProGluArgValIleGlnTyrGlyCysSerGlyGly 100105110 AlaHisValSerLeuAlaValAlaGluAspPheSerAspArgValAsp 115120125 GlySerValAlaLeuAlaAlaHisThrProValTrpIleMetAsnSer 130135140 PheLeuAspGlyTrpPheSerLeuGlnSerLeuIleGlyGluTyrTyr 145150155160 ValGluAlaGlyHisGlyProLeuSerAspLeuAlaIleThrLysLeu 165170175 ProAsnAspGlySerSerAsnSerSerGlyHisGlyMetGluGlyAsp 180185190 LeuProAlaAlaTrpArgAsnAlaPheThrAlaAlaAsnAlaThrPro 195200205 GluGlyArgAlaArgMetAlaLeuAlaPheAlaLeuGlyGlnTrpSer 210215220 ProTrpLeuAlaAspAsnThrProGlnProAspLeuAspAspProGlu 225230235240 AlaIleAlaAspSerValTyrGluSerAlaMetArgLeuAlaGlySer 245250255 ProGlyGlyGluAlaArgIleMetPheGluAsnAlaAlaArgGlyGln 260265270 GlnLeuSerTrpAsnAspAspIleAspTyrAlaAspPheTrpGluAsn 275280285 SerAsnProAlaMetLysSerAlaValGlnGluLeuTyrAspThrAla 290295300 GlyLeuAspLeuGlnSerAspIleGluThrValAsnSerGlnProArg 305310315320 IleGluAlaSerGlnTyrAlaLeuAspTyrTrpAsnThrProGlyArg 325330335 AsnValIleGlyAspProGluValProValLeuArgLeuHisMetIle 340345350 GlyAspTyrGlnIleProTyrSerLeuValGlnGlyTyrSerAspLeu 355360365 IleSerGluAsnAsnAsnAspAspLeuTyrArgThrAlaPheValGln 370375380 SerThrGlyHisCysAsnPheThrAlaAlaGluSerSerAlaAlaIle 385390395400 GluValMetMetGlnArgLeuAspThrGlyGluTrpProSerThrGlu 405410415 ProAspAspLeuAsnAlaIleAlaGluAlaSerAsnThrGlyThrGlu 420425430 AlaArgPheMetAlaLeuAspGlyTrpGluIleProGluTyrAsnArg 435440445 ThrTrpLysProGlu 450 __________________________________________________________________________ Other References
|
| ||||||||||||||