U.S. patents available from 1976 to present.
U.S. patent applications available from 2005 to present.

Icon_funbox Did You Know...

...that power steering was invented by independent inventor Francis W. Davis? As chief engineer in the 1920s of the truck division of the Pierce Arrow Motor Car Company, he saw how hard it was to steer heavy vehicles. So that he would be able to keep the profits from his future invention, Davis left his job, rented a small engineering shop in Waltham, Mass., and developed a hydraulic power steering system that led to power steering.

Newsletter  PatentStorm News

Make the Most of Our Site

See this month's Top Inventors and Most Cited Patents.

Stay on top of the latest innovations by subscribing to an RSS feed.

Registered users: Manage your profile.

 

Degen, Nancy


Primary examiner statistics: 459 patents; average approval time: 945 days
Assistant examiner statistics: 161 patents; average approval time: 891 days

Patents as Assistant Examiner


1          
NumberTitleIssue Date
6090574Process for preparing a protein by a fungus transformed by multicopy integration of an expression vector
A process is disclosed for preparing a protein by a eukaryote transformed by multicopy integration of an expression vector into the genome of a yeast, such as Saccharomyces, Hansenula, and Kluyveromyces, or of a mould such as Aspergillus, Rbizopus and Tri...
07/18/2000
5968815Promoter of M. paratuberculosis and its use for the expression of immunogenic sequences
The invention relates to a nucleotide sequence which is present at a position adjacent to the 5' end of the reverse sequence complementary to the open reading frame coding for a potential transposase contained in the insertion element IS900 in Mycobacteri...
10/19/1999
5863759Process for the production of protein products in aspergillus
A process for expression of a protein product in Aspergillus oryzae is disclosed. The process comprises transforming Aspergillus oryzae with a vector system comprising DNA-sequences encoding functions facilitating gene expression, a suitable marker for se...
01/26/1999
5861273Chromosomal expression of heterologous genes in bacterial cells
The present invention provides compositions and methods for producing a heterologous protein of interest by inserting a copy of a gene encoding the heterologous protein of interest into the chromosome of a host cell, such as E. coli. A chromosomal transfe...
01/19/1999
5849874Process for the purification of serum albumin
Recombinantly produced serum albumin is purified in a series of steps, optionally by incubation with an anion-exchange adsorbent, followed by affinity chromatography employing a hydrophobic solid phase and using a water-soluble lipid anion as desorbens in...
12/15/1998
5837679Agents affecting thrombosis and hemostasis
Analogs of blood factors which are transiently inactive are useful in treatment of diseases characterized by thrombosis. In addition, modified forms of activated blood factors that generate the active blood factor in serum but have extended half-lives are...
11/17/1998
5830745Recombinant cytomegalovirus containing foreign gene and use thereof
The present invention provides a virus comprising a DNA sequence essential for replication of a human cytomegalovirus and at least one foreign DNA sequence adapted for expression in a host. The foreign DNA sequence may encode a human immunodeficiency viru...
11/03/1998
5824497High efficiency translation of mRNA molecules
An increased level of translation of a selected mRNA molecule is effected by coupling specific nucleotide sequences at the 5'- and 3'-ends of a nucleic acid molecule transcribable to or which itself is the mRNA molecule. The nucleotide sequence at the 5'-...
10/20/1998
5763186Use of antisense oligomers in a process for controlling contamination in nucleic acid amplification reactions
A novel process for the use of antisense oligonucleotides and analogs thereof has been developed. Namely, this technique is useful for the elimination of contamination in the nucleic acid amplification area. Elimination of unwanted contamination has made ...
06/09/1998
5759828Cyclic di-guanylate metabolic enzymes
The present invention provides the nucleotide sequences of Acetobacter operons, cdg operons encoding genes for the biosynthesis and degradation of cyclic diguanosine monophosphate (c-di-GMP). Specifically, the nucleotide sequences and deduced amino acid s...
06/02/1998
5756680Sequential separation of whey proteins and formulations thereof
A method is disclosed for the sequential separation of whey proteins using radial-flow chromatography. Different buffer systems adjusted to suitable pH and ionic strength are utilized in the separation process. The method separates at least five different...
05/26/1998
5731425Polypeptide surface marker for cells
This invention discloses a gene for the identification of cells comprising a selection leader segment, a cell marker segment and a transmembrane segment. The gene can be used to identify cells transfected with the gene by the steps of: inserting the gene ...
03/24/1998
5731193Recombinant DNA and transformant containing the same
Insertion of IFN-alpha promoters in recombinant DNAs improves their expression efficiencies for useful polypeptides. Expression of such a recombinant DNA in host cells of mammalian origin is artificially controllable by the presence and absence of externa...
03/24/1998
5721137Plasmid vector and its use for the production of heterologous proteins
A new plasmid vector operable in Escherichia coli and Bacillus subtilis, comprising a synthetic promoter capable of directing with great efficiency the expression of the heterologous gene under its control is described. This vector which has a high stabil...
02/24/1998
5719021Protein activation
A method is disclosed for producing a biochemically active polypeptide from a biochemically inactive polypeptide. The polypeptide is normally but need not be expressed in a precursor form containing a pro-sequence. The inactive polypeptide is reacted with...
02/17/1998
5710251Purification of bacterially expressed human interleukin-10
Disclosed is a method for purifying Interleukin-10 (IL-10). The method is comprised of subjecting an IL-10 containing solution to cation exchange chromatography, anion exchange chromatography, hydroxyapatite chromatography, and gel filtration chromatograp...
01/20/1998
5710033Superoxide dismutase cloning and expression in microorganisms
Methods and compositions are provided for the production of human superoxide dismutase and a novel protocol for enhancing efficiency of expression. The gene encoding for human superoxide dismutase is isolated and inserted into a vector in conjunction with...
01/20/1998
5707827Mutant AOX2 promoter, vector carrying same, transformant and production of heterologous protein
A mutant AOX2 promoter wherein 1 to 3 oligonucleotide(s) GATAGGCTATTTTTGTCGCATAAAT (SEQUENCE ID NO: 2) is (are) added in the normal direction, the reverse direction or in both the normal and reverse directions at the 5' end side of a partial DNA fragment ...
01/13/1998
5705610Method and apparatus for biopolymer synthesis
Method and apparatus for synthesizing biopolymers, such as polypeptides and polynucleotides. The apparatus includes plural reaction vessels in which subunit coupling to biopolymers in a particle suspension is carried out. The vessels are connected to comm...
01/06/1998
5683893Mutant AOX2 promoter, vector carrying same, transformant, and production of heterlogous protein
A mutant AOX2 promoter obtained by mutating a sequence of natural AOX2 promoter in a manner comprising at least one of the three mutation modes of (1) a region extending upstream from nucleotide 1187 inclusive and comprising at least nucleotides 845-960 i...
11/04/1997
5679517Analytical methods and probes for the identification of chromosomal aberrations and the diagnosis of genetically-based disease states
Methods for identifying the existence, and optionally the location, of chromosomal aberration(s) in the genome of an organism are disclosed. Intact, chromosomal DNA is hybridized with one or more clones constructed from chromosomal DNA derived from an org...
10/21/1997
5679352Synthetic Haemophilus influenzae conjugate vaccine
Synthetic peptides have an amino acid sequence corresponding to at least one antigenic determinant of at least one protein, usually a structural protein, particularly the P1, P2 and P6 protein, of Haemophilus influenzae (Hi), particularly type b, and are ...
10/21/1997
5679540Cloning and identification of a two component signal transducing regulatory system from bacteroides fragilis
This invention relates to a purified isolated DNA fragment of Bacteroides fragilis comprising a sequence for an operon containing two genes designated rprX and rprY. These genes encode two signal transducing regulatory proteins designated RprX and RprY. T...
10/21/1997
5674733Method and materials for introducing DNA into Prevotella ruminicola
A method of introducing expressible heterologous DNA into Prevotella ruminicola is provided. The method involves conjugal transfer of a shuttle vector comprising the heterologous DNA operatively linked to a promoter functional in P. ruminicola. The invent...
10/07/1997
5670333Expression of polypeptides in E. coli under control of the E. coli MDH-gene promoter
Expression vector for expressing the E. coli a polypeptide other than E. coli malate dehydrogenase coded for by a DNA coding sequence. The vector includes a DNA coding for the polypeptide and also includes an initiation codon wherein the DNA sequence is o...
09/23/1997
5665346Human interleukin-8 analogs
The present invention provides human interleukin-8 (IL-8) analogs that are modified in the Glu4 Leu5 Arg6 region, and have a core structure corresponding to the IL-8 (7-51) sequence are provided. These neutrophil binding analogs display altered IL-8 activ...
09/09/1997
5665600Pichia pastoris linear plasmids and DNA fragments thereof
Two novel linear DNA plasmids are described. Also, novel fragments of the plasmids containing the autonomous replication sequence (ARS), and thus capable of self-maintenance as extra chromosomal elements are provided. These novel DNA sequences of the pres...
09/09/1997
5658755Method for extra-cellular expression of protein
Heterologous extra-cellular expression of recombinant proteins in soluble functional form is desirable because of the ease associated with purification of the secreted proteins and avoidance of the need for cell extraction and protein refolding procedures...
08/19/1997
5656593Morphogen induced periodontal tissue regeneration
Disclosed are methods and compositions for inducing periodontal tissue morphogenesis in a mammal which include a therapeutically effective concentration of a morphogen. The methods and compositions are useful for integrating an implanted tooth in a tooth ...
08/12/1997
5656598Use of fibroblast growth factors to stimulate bone growth
The present invention provides therapeutic compositions for the prevention and treatment of pathological conditions involving bone and dental tissue. The present invention also provides a method to promote bone repair and/or growth for the treatment of pa...
08/12/1997
5656467Methods and materials for producing gene libraries
Methods for producing libraries of diverse nucleotide sequences, and libraries of polypeptides encoded thereby, are provided. The nucleotide sequences comprise a first and a second constant region coupled to a coding sequence, wherein the coding sequence ...
08/12/1997
5652358Solid-phase synthesis of oligoribonucleotides
A process for the preparation of oligoribonucleotides of the formula ##STR1## in which n, L, BB, W, T, Y', U, C1 and C2 are as defined in the description, by solid-phase synthesis is described, as are intermediates of the oligor...
07/29/1997
5652118Nucleic acid encoding a novel morphogenic protein, OP-3
Disclosed are (1) nucleic acid and amino acid sequences for a novel morphogenic protein; (2) methods for producing and expressing the protein in a biologically active form; and (3) methods for utilizing the protein to induce tissue morphogenesis in a mamm...
07/29/1997
5648250Tissue plasminogen activator
The invention relates to a new tissue plasminogen activator which has strong activity for converting plasminogen into plasmin that degrades the fibrin network of blood clots to form soluble products and therefore is useful as a thrombolytic agent. The inv...
07/15/1997
5646017Methods of generating desired amino-terminal residues in proteins
Methods of designing or modifying protein structure at the protein or genetic level to produce specified amino-termini in vivo or in vitro are described. The methods can be used to alter the metabolic stability and other properties of the protein or, alte...
07/08/1997
5646044Expression systems for the production of target proteins in bacillus
This invention discloses an expression system which is useful in industrial Bacilli to produce target proteins which include, but are not limited to, alkaline proteases, amylases, cellulases, lipases or other hydrolyases which are normally excreted outsid...
07/08/1997
5643564Glycosylated cytokines
Disclosed is a sugar-modified cytokine which ensures migration of almost all of the dose of cytokine to the liver rapidly after administration to the live body and which can be advantageously used to enhance the effect of liver disease therapy and mitigat...
07/01/1997
5643756Fusion glycoproteins
Novel expression vectors are provided for expressing a fusion glycoprotein. The fusion glycoprotein contains the N-terminal globular domain of a retroviral env surface protein linked to a selected glycopeptide. Truncation glycoproteins as well as insertio...
07/01/1997
5643790Plasmid vector and a method for regulation of gene expression using the same
A plasmid vector capable of replicating in a Coryneform bacterial cell bearing a base sequence (a) functioning as an promoter in a Coryneform bacterium, a base sequence (b) functioning as an operator downstream from the base sequence (a), a base sequence ...
07/01/1997
5641868Interlekin-6 compositions, and a production process thereof
The present invention relates to compositions containing human interleukin-6 with sugar chains, a process for preparing human interleukin-6 by culturing cells in a medium containing ascorbic acid or any of its derivatives, and a process for purifying a cr...
06/24/1997
1          
 
Sign InRegister
Username  
Password   
forgot password?