Did You Know...
...that when IBM conducted a market study of Chester Carlson's invention in 1959, the company concluded that it would take only 5000 units of his new product to saturate the market? IBM therefore declined to be part of the new product introduction. Too bad for IBM. Carlson's invention was the xerography process, and his new product was the beginning of the Xerox Corporation. It is estimated that every day, worldwide, 3,000,000,000 copies are made!!
PatentStorm News
Make the Most of Our Site
See this month's Top Inventors and Most Cited Patents.
Stay on top of the latest innovations by subscribing to an RSS feed.
Registered users: Manage your profile.
| Number | Title | Issue Date |
| 8058069 | Lipid formulations for nucleic acid delivery The present invention provides novel, stable lipid particles comprising one or more active agents or therapeutic agents, methods of making the lipid particles, and methods of delivering and/or administering the lipid particles. More particularly, the present inventi... | 11/15/2011 |
| 8058068 | Peptide-enhanced transfections The present invention provides compositions useful for transfecting eukaryotic cells comprising nucleic acid complexes with peptides, wherein the peptide is optionally covalently coupled to a nucleic acid-binding group, and cationic lipids or dendrimers as transfect... | 11/15/2011 |
| 8030075 | Carrier composition for nucleic acid transport An object of the present invention is to provide a nucleic acid delivery carrier composition of low toxicity and high safety, the carrier composition, when used to administer a nucleic acid such as an siRNA into an animal-derived cell or organism, being capable of d... | 10/04/2011 |
| 7951595 | Methods for screening modulators of SLC17-type anion transport activity It is an object of the invention to isolate a transporter responsible for ATP transport and a gene encoding the transporter. It is another object of the invention to provide a method for the screening of a medicament for treating and/or regulating pain in central ne... | 05/31/2011 |
| 7846730 | Antisense modulation of BCL2-associated X protein expression Antisense compounds, compositions and methods are provided for modulating the expression of BCL2-associated X protein. The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding BCL2-associated X protei... | 12/07/2010 |
| 7799565 | Lipid encapsulated interfering RNA The present invention provides lipid-based formulations for delivering, e.g., introducing, nucleic acid-lipid particles comprising an interference RNA molecule to a cell, and assays for optimizing the delivery efficiency of such lipid-based formulations. ... | 09/21/2010 |
| 7772003 | Lipid derivatives of aminoglycosides Transfecting compounds which include an aminoglycoside linked to a lipid via a spacer, and their polyguanidylated derivatives are provided. These compounds are useful for the in vitro, ex vivo, or in vivo transfection of nucleic acids into various cell types. ... | 08/10/2010 |
| 7741300 | Methods of using nucleic acid vector-lipid complexes This invention relates to a vaccine and a method for immune activation which is effective for eliciting both a systemic, non-antigen specific immune response and a strong antigen-specific immune response in a mammal. The method is particularly effective for protecti... | 06/22/2010 |
| 7655468 | Stable lipid-comprising drug delivery complexes and methods for their production Novel stable, concentrated, biologically active and ready-to-use lipid-comprising drug delivery complexes and methods for their production are described. The biological activity of the complexes produced are comparable to the formulations prepared according to the p... | 02/02/2010 |
| 7524680 | Polyampholytes for delivering polyions to a cell An polyampholyte is utilized in a condensed polynucleotide complex for purposes of nucleic acid delivery to a cell. The complex can be formed with an appropriate amount of positive and/or negative charge such that the resulting complex can be delivered to the extrav... | 04/28/2009 |
| 7491538 | Gene expression with covalently modified polynucleotides A process and compound wherein nucleic acids can be modified with a host of molecules and maintain their ability to be expressed. A modifying chemical attachment of polyions to polynucleotides can be used to facilitate the change of tertiary structure of the nucleic... | 02/17/2009 |
| 7482160 | Process of making a compound by forming a polymer from a template drug A method of forming polymers in the presence of nucleic acid using template polymerization. These methods can be used for the delivery of nucleic acids, for condensing the nucleic acid, for forming nucleic acid binding polymers, for forming supramolecular complexes ... | 01/27/2009 |
| 7470539 | Formation of polyampholytes in the presence of a polyion Polyampholyte are able to condense nucleic acid to form small complexes which can be utilized in the delivery of nucleic acid to mammalian cells. The polyampholytes can be formed prior to interaction with nucleic acid or they can be formed in the presence of nucleic... | 12/30/2008 |
| 7439066 | Methods for producing and using in vivo pseudotyped retroviruses using envelope glycoproteins from lymphocytic choriomeningitis virus (LCMV) The present invention provides novel pseudotyped retroviral vectors that can transduce human and other cells. Vectors are provided that are packaged efficiently in packaging cells and cell lines to generate high titer recombinant virus stocks expressing novel envelo... | 10/21/2008 |
| 7435595 | Method for transfer of molecular substances with prokaryotic nucleic acid-binding proteins The invention relates to a method for the transfer of molecular substances, for example proteins or nucleic acids in cells, in the case of using DNA combined with a possible gene expression. A prokaryotic nucleic acid-binding protein is used for the transfer, which ... | 10/14/2008 |
| 7422902 | Lipid-nucleic acid particles prepared via a hydrophobic lipid-nucleic acid complex intermediate and use for gene transfer Novel lipid-nucleic acid particulate complexes which are useful for in vitro or in vivo gene transfer are described. The particles can be formed using either detergent dialysis methods or methods which utilize organic solvents. Upon removal of a solubilizing compone... | 09/09/2008 |
| 7405205 | Antitumor antisense sequences directed against R1 and R2 components of ribonucleotide reductase Compounds and methods for modulating cell proliferation, preferably inhibiting the proliferation of tumor cells are described. Compounds that may be used to modulate cell proliferation include antisense oligonucleotides complementary to regions of the mammalian ribo... | 07/29/2008 |
| 7361640 | Stable lipid-comprising drug delivery complexes and methods for their production Novel stable, concentrated, biologically active and ready-to-use lipid-comprising drug delivery complexes and methods for their production are described. The biological activity of the complexes produced are comparable to the formulations prepared according to the p... | 04/22/2008 |
| 7345025 | Methods for genetic modification of hematopoietic progenitor cells and uses of the modified cells Described are compositions and methods relating to gene therapy, particularly as applied to hematopoietic progenitor (HP) cells, to transduced cells and methods of obtaining them, and to methods of using them to provide prolonged engraftment of modified hematopoieti... | 03/18/2008 |
| 7341738 | Lipid-encapsulated polyanionic nucleic acid Methods for the preparation of a lipid-nucleic acid composition are provided. According to the methods, a mixture of lipids containing a protonatable or deprotonatable lipid, for example an amino lipid and a lipid such as a PEG- or Polyamide oligomer-modified lipid ... | 03/11/2008 |
| 7335509 | Stable lipid-comprising drug delivery complexes and methods for their production Novel stable, concentrated, biologically active and ready-to-use lipid-comprising drug delivery complexes and methods for their production are described. The biological activity of the complexes produced are comparable to the formulations prepared according to the p... | 02/26/2008 |
| 7332339 | Transferring materials into cells using porous silicon Porous and/or polycrystalline silicon are used in the delivery of substances into cells. The porous and/or polycrystalline silicon can be formed into micropiercers, microneedles and biolistic bullets for penetration of the cell. The control of the pore size and poro... | 02/19/2008 |
| 7323594 | Transfection reagents Disclosed are compounds capable of facilitating transport of biologically active agents or substances into cells having the general structure: wherein Q is selected from the gro... | 01/29/2008 |
| 7319094 | Increased and sustained in vivo gene expression using a nucleic acid, histone and amphipathic compound composition The invention features a non-transgenic model of Alzheimer's Disease, method for inducing prolonged in vivo gene expression in a mammal, and methods of inhibiting Alzheimer's Disease-associated neuronal cell death. ... | 01/15/2008 |
| 7294504 | Methods and compositions for DNA mediated gene silencing DNA compositions that mediate gene silencing via RNA interference are provided. Also provided are methods of using such compositions to silence gene expression in a cell. ... | 11/13/2007 |
| 7294511 | Methods for delivering nucleic acid molecules into cells and assessment thereof Methods for delivering nucleic acid molecules into cells and methods for measuring nucleic acid delivery into cells and the expression of the nucleic acids are provided. The methods are designed for introduction of large nucleic acid molecules, including artificial ... | 11/13/2007 |
| 7285542 | Hyperthermic inducible expression vectors for gene therapy and methods of use thereof Methods and compositions are provided for transgene expression in target cells. Expression constructs using an inducible amplification system to drive expression of a therapeutic gene or other gene of interest in mammalian host cells are provided, as well as methods... | 10/23/2007 |
| 7279322 | Electrospraying apparatus and method for coating particles An electrospraying apparatus and/or method is used to coat particles. For example, a flow including at least one liquid suspension may be provided through at least one opening at a spray dispenser end. The flow includes at least particles and a coating material. A s... | 10/09/2007 |
| 7279326 | Composition for delivery of a mitochondrial genome to a cell The invention provides composition and methods for delivering a composition according to the invention comprising a wild-type (wt) mitochondrial DNA (mtDNA) molecule to a mammalian cell. The wt-mtDNA molecule is a functional mtDNA molecule that includes the entire m... | 10/09/2007 |
| 7264969 | Carrier system for specific artery wall gene delivery An artery wall binding peptide (AWBP) based on the artery wall cell-binding domain of apolipoprotein B-100 was conjugated to a cationic backbone configured for forming a complex with a nucleic acid to produce a composition that enhances gene transfer to artery wall ... | 09/04/2007 |
| 7262173 | Chemosensitizing with liposomes containing oligonucleotides The invention relates to the use of oligonucleotide containing cationic liposomal formulations to enhance the efficacy of chemotherapy and/or radiotherapy, particularly as a means to sensitize cancerous tumor tissues to the efficiencies of chemotherapy. This is part... | 08/28/2007 |
| 7256043 | Transfection complexes The invention provides a peptide having at least 3 amino acids comprising an amino acid sequence selected from a) X1SM [SEQ.ID.NO.:1] b) LX2HK [SEQ.ID.NO.:2] c) PSGX3ARA [SEQ.ID.NO.:9] d) SX4RSMNF [SEQ.ID. NO.:16] e) LX | 08/14/2007 |
| 7252943 | In Vitro sorting method The invention describes a method for isolating one or more genetic elements encoding a gene product having a desired activity, comprising of the steps of: compartmentalizing genetic elements into microcapsules; expressing the genetic elements to produce their respec... | 08/07/2007 |
| 7250403 | Biodegradable immunomodulatory formulations and methods for use thereof The invention provides new compositions and methods for immunomodulation of individuals. Immunomodulation is accomplished by administration of immunomodulatory polynucleotide/microcarrier (IMP/MC) complexes. The IMP/MC complexes may be covalently or non-covalently b... | 07/31/2007 |
| 7250404 | Lipid-mediated polynucleotide administration to deliver a biologically active peptide and to induce a cellular immune response A method for delivering an isolated polynucleotide to the interior of a cell in a vertebrate, comprising the interstitial introduction of an isolated polynucleotide into a tissue of the vertebrate where the polynucleotide is taken up by the cells of the tissue and e... | 07/31/2007 |
| 7238673 | Treatment of diseases by site-specific instillation of cells or site-specific transformation of cells and kits therefor A method for the direct in vivo transformation of cells in and surrounding a solid tumor is disclosed. This method is based on the site-specific delivery of proteins to solid tumors and to tissue surrounding the solid tumor by direct injection of a nucleic acid sequ... | 07/03/2007 |
| 7223856 | Antisense compounds which prevent cell death and uses thereof The present invention provides for an antisense oligonucleotide having the sequence 5′GCTCGGCGCCGCCATTTCCAG3′. The invention also provides for an antisense oligonucleotide having the sequence 5′GTCAGCGGCCATCAGCTT3′. The present invention further provides for... | 05/29/2007 |
| 7217572 | Modulation of HIF1α and HIF2α expression Compounds, compositions and methods are provided for modulating the expression of HIF1α and/or HIF2α. The compositions comprise oligonucleotides, targeted to nucleic acid encoding HIF1α and HIF2α. Methods of using these compounds for modulation of HIF1α and/or ... | 05/15/2007 |
| 7214369 | Devices and processes for distribution of genetic material to mammalian limb A process is described for the delivery of a therapeutic polynucleotide to limb muscle tissue suffering from or potentially suffering from ischemia. The polynucleotide is inserted into a mammalian limb vessel such as an artery. Delivery efficiency and distribution i... | 05/08/2007 |
| 7208314 | Compositions and methods for drug delivery using pH sensitive molecules A system relating to the delivery of desired compounds (e.g., drugs and nucleic acids) into cells using pH-sensitive delivery systems. The system provides compositions and methods for the delivery and release of a compound to a cell. ... | 04/24/2007 |
