Bizarre Patents
User-operated amusement apparatus for kicking the user's buttocks
An apparatus including a user-operated and controlled apparatus for self-infliction of repetitive blows to the user's buttocks by a plurality of elongated arms bearing flexible extensions that rotate under the user's control.
PatentStorm News
Make the Most of Our Site
See this month's Top Inventors and Most Cited Patents.
Stay on top of the latest innovations by subscribing to an RSS feed.
Registered users: Manage your profile.
| Number | Title | Issue Date |
| 6172003 | Strains of drechslera monoceras and weed control compositions containing the same Cells of a novel strain of Drechslera monoceras having practical weed controlling activity against barnyard grass (Echinochloa spp.) at temperatures ranging from 26° C. to 35° C., and exhibiting no pathogenicity to major crops, including rice, are used ... | 01/09/2001 |
| 6169171 | Hybrid protein between CS from plasmodium and HBSAG Isolated DNA sequences encoding a novel hybrid protein are provided which comprise a portion of the CS protein of P. falciparum and the surface antigen of Hepatitis B virus. Vectors and host cells containing the isolated DNA sequences are also disclosed.... | 01/02/2001 |
| 6168947 | Nematophagous fungus Esteya vermicola A fungus which has high infectivity toward a stem, leaf, bud, or flower nematode and is characterized by the production of a first type of conidiophores, conidiogenous cells, and conidia and a second type of conidiophores, conidiogenous cells, and conidia... | 01/02/2001 |
| 6162763 | Herbicidal composition for the control of annual bluegrass A herbicidal composition for the control of annual bluegrass, comprising, as active ingredients, a microorganism belonging to the genus Xanthomonas and having control ability against annual bluegrass and paraffin is disclosed. This composition exhibits ex... | 12/19/2000 |
| 6162636 | Fermentation process for preparing erythritol using mutant cells by controlling osmotic pressure The present invention relates to a fermentation process for preparing erythritol with high productivity with novel mutant of Trigonopsis variabilis, more specifically, for preparing erythritol under optimal fermentation conditions for maximum erythritol p... | 12/19/2000 |
| 6156553 | Recombinant enzyme with dextranase activity The present invention relates to a cloned DNA sequence encoding an enzyme with dextranase activity, a recombinant expression vector comprising said DNA sequence, a filamentous fungus host cell, a method for producing said recombinant dextranase, and the i... | 12/05/2000 |
| 6146880 | Methods for lyophilizing and using ericoid mycorrhizal fungi The present invention is directed to a method for preserving mycorrhizal fungi for long-term storage using lyophilization. This enables use of the fungi for growing and acclimatizing micropropagated plants. The invention is especially useful for preservin... | 11/14/2000 |
| 6143549 | Fungal inoculum preparation A fungal inoculum comprising a pelleted nutrient substrate coated with fungal propagules suspended in a hydrophilic material is disclosed.... | 11/07/2000 |
| 6140096 | Enzyme with endo-1,3(4)-ଲ-glucanase activity An enzyme having endo-1,3(4)-ଲ-glucanase activity is described which is encoded by the DNA sequence ATGTGGTCTCCCAAGGTTGCTGCTGCCGTCCTCGCCTTTGTTGGTGCTACCAACGCCT GGCAGCCCCCGACCTACAGCGGCTTCAACTTGGTCTGGACTGACACCTTCGCTGGCAACGGTGGCACTTCTCCT A ACCAGAACA... | 10/31/2000 |
| 6127137 | Acidic phospholipase, production and methods using thereof An acidic phospholipase is obtained from a strain of the genus Hyphozyma. It is able to hydrolyze both fatty acyl groups in intact phospholipid. Advantageously, it has no lipase activity and is active at very low pH; these properties make it very suitable... | 10/03/2000 |
| 6127160 | Protein having cellulase activities and process for producing the same The object of the present invention is to analyze the amino acid sequence of the protein constituting the cellulase system, to clone the gene coding for the components of the cellulase system, and to establish a technique of inserting a clonal gene into t... | 10/03/2000 |
| 6110715 | Method for producing erythritol using a microorganism The present invention provides a method for producing erythritol comprising cultivating microorganisms, which produce erythritol, belonging to Trichosporonoides megachiliensis in a culture medium having a high saccharide concentration and then recovering ... | 08/29/2000 |
| 6110520 | Process for preparing GAMM-hexalactone, products produced therefrom dan organoleptic uses of said products A process for producing high yields of γ-hexalactone and 2-pentanone from the corresponding hexanoic acid starting material is carried out with high amounts of oxygen and sugar in the presence of a mold microorganism. Fragrance compositions and foodstuff... | 08/29/2000 |
| 6111170 | Tall fescue endophytes Selected endophytes of the genus Neotyphodium (formerly Acremonium) form stable synthetic combinations with tall fescue hosts (Festuca arundinacea). The combinations have improved resistance to invertebrate pests as compared to tall fescue cultivars not c... | 08/29/2000 |
| 6107040 | Pharmacological targeting of mRNA cap formation This invention provides methods for the discovery of molecules that target an essential aspect of eukaryotic gene expression--the formation of the mRNA 5' cap m7GpppN. An underlying principle of this invention is the use of a different strains of a test o... | 08/22/2000 |
| 6107079 | Degradation of polychlorinated biphenyl mixtures in soil using phanerochaete chrysosporium in nutrient rich, non-ligninolytic conditions Substantial degradation of polychlorinated biphenyl (PCB) mixtures is carried out using the white rot fungus Phanerochaete chrysosporium, under nutrient, carbon and nitrogen source rich, non-ligninolytic conditions. The PCBs with various numbers of ortho,... | 08/22/2000 |
| 6090607 | Enhanced expression of proteolytic enzymes in koji mold The present invention has for an object a koji mold which expresses at least 2 times more endo- and exo-peptidases than the wild type strain of Aspergillus oryzae CNCM I-1882, and especially at least 30 mU of endopeptidase activity, at least 30 mU of leuc... | 07/18/2000 |
| 6087169 | HKABY60: polynucleotide encoding a helix-loop-helix ubiquitous kinase family polypeptide HKABY60 polypeptides and polynucleotides and methods for producing such polypeptides by recombinant techniques are disclosed. Also disclosed are methods for utilizing HKABY60 polypeptides and polynucleotides in the design of protocols for the treatment of... | 07/11/2000 |
| 6087131 | ଲ-glucosidase from filamentous fungi, and uses thereof An acid-stable ଲ-glucosidase that may be prepared from filamentous fungi and has very low glucose inhibition sensitivity is disclosed. Said ଲ-glucosidase is particularly useful for preparing fruit juices and in enzymatic cellulose hydrolysis m... | 07/11/2000 |
| 6080567 | Enzymes with xylanase activity from Aspergillus aculeatus An enzyme exhibiting xylanase activity, which enzyme is immunologically reactive with antibody raised against a purified xylanase derived from Aspergillus aculeatus, CBS 101.43. The enzyme may be used for degrading plant cell wall components, e.g., in the... | 06/27/2000 |
| 6077703 | Methods for isolation of Penicillium molds from artemisia plant material A method of inducing accelerated and increased mold yields from Artemesia and similar high temperature water extracts thereof in very thin shallow standing planar solution layers exposed to daylight; in particular, molds yielding Pennicillium rinseseum an... | 06/20/2000 |
| 6074855 | Process for preparing spirolaxine and spirolaxine methyl ether Processes for preparing spirolaxine and spirolaxine methyl ether, the compounds of formulas (I) and (II) respectively, ##STR1## comprising fermenting fungi selected from the group consisting of Sporotrichum pruinosum FD 29585, ATCC 74327; Sporotrichu... | 06/13/2000 |
| 6072107 | Ryegrass endophytes Selected endophytes of the genus Neotyphodium (formerly Acremonium) form stable synthetic combinations with ryegrass hosts (preferably Lolium perenne). The combinations have improved resistance to invertebrate pests and drought effects as compared to ryeg... | 06/06/2000 |
| 6071716 | DNA encoding, B7, a new member of the IG superfamily with unique expression on activated and neoplastic B cells Isolated nucleic acid molecules encoding a B cell activation antigen, B7, are provided. In one embodiment, the nucleic acid molecules are DNA sequences. The DNA sequences of the invention can be integrated into various expression vectors, which in turn ca... | 06/06/2000 |
| 6060291 | Fermentation process for preparing erythritol using Trichosporonoides madida DS 911 The present invention relates to a fermentation process for preparing erythritol with high productivity using Trichosporonoides madida DS 911, more specifically, for preparing erythritol by optimizing the culture conditions such as pH, temperature, aerati... | 05/09/2000 |
| 6060298 | Peniophora phytase The present invention relates to an isolated polypeptide exhibiting phytase activity, the corresponding cloned DNA sequences, a process for preparing the polypeptide, and the use thereof for a number of industrial applications, in particular in animal fee... | 05/09/2000 |
| 6060264 | Multiple drug resistance gene atrc of Aspergillus nidulans The invention provides isolated nucleic acid compounds encoding a multiple drug resistance protein of Aspergillus nidulans. Vectors and transformed host cells comprising the multiple drug resistance-encoding DNA of Aspergillus nidulans atrC are also provi... | 05/09/2000 |
| 6057435 | Tie ligand homologues The present invention concerns isolated nucleic acid molecules encoding the novel TIE ligands NL1, NL5, NL8, and NL4, the proteins encoded by such nucleic acid molecules, as well as methods and means for making and using such nucleic acid and protein mole... | 05/02/2000 |
| 6048714 | Composition having nematicidal activity A pesticide composition that includes a metabolite from a fungus selected from homeocarpic basidiomycetes and homeocarpic ascomycetes is described. In one embodiment, the fungus from which the metabolite is derived is one grown under conditions effective ... | 04/11/2000 |
| 6046022 | Methods and compositions employing red rice fermentation products Methods and compositions are disclosed which comprise red rice fermentation products, that can be used as natural dietary supplements and/or medicaments for the treatment or prevention of hyperlipidemia and associated disorders and symptoms, such as cardi... | 04/04/2000 |
| 6033879 | Process for the preparation of substituted aryl lactic acid containing cyclodepsipeptides with 24 ring atoms The present invention relates to a new process for the preparation of substituted aryllactic acid-containing cyclodepsipeptides having 24 ring atoms of the formula (I): ##STR1## in which R1, R2, R3, R4 have... | 03/07/2000 |
| 6013493 | Taxol production by a microbe Taxol is produced from taxol-producing micro-organisms. Methods of obtain the taxol-producing microorganisms are described. Radioactive labelled taxol products and methods for use of the radioactive labelled taxol and for the treatment of leukemia and ca... | 01/11/2000 |
| 6010899 | High molecular weight pullulan and method for its production A method for obtaining a substantially biologically pure culture strain of Aureobasidium pullulans from a wild type strain by enriching the collected strain for organisms which grow as fungal yeastlike cells, growing colonies from isolated yeastlike cells... | 01/04/2000 |
| 6011147 | Fungal promoters active in the presence of glucose A method is described for the identification and cloning of promoters that express under a defined environmental condition, such as growth in glucose medium. Using this method, five Trichodermal promoters capable of the high expression of operably linked ... | 01/04/2000 |
| 6008159 | Control of annual grass weeds Method for controlling the proliferation of annual grass weeds in an area by applying to the area a composition of one or more species of Pyrenophora fungi or anamorphs thereof, or a toxin or toxin-containing preparation derived from one or more species o... | 12/28/1999 |
| 5998197 | Fungi for pitch reduction and their preparation Ascospores of wood-penetrating, pitch-grading fungi of the class of Ascomycotina and Deuteromycotina, eg. Ophiostromas, may be screened to provide fungi combining the properties of good growth on non-sterile wood substrates and minimized or even enhanced ... | 12/07/1999 |
| 5993802 | Process for biological control of Calamagrostis canadensis using a low temperature basidiomycete The invention disclosed relates to a substantially biologically pure isolate of a low temperature basidiomycelte (LTB) fungus, (.tbd.Coprinus psychromorbidus), to a delivery composition comprising the fungus and an agriculturally acceptable carrier capabl... | 11/30/1999 |
| 5989898 | Method for storing fungal conidia Methods for packaging Metarhizium fungal cultures or conidia are described. In one embodiment, the fungal culture is provided within an insect infection chamber that attracts insects, then infects them with a lethal dosage of fungus, where the packaging m... | 11/23/1999 |
| 5989543 | Myconematicides and methods for using the same Isolates of Paecilomyces lilacinus, Paecilomyces lilacinus 251 (AGAL 89/030550), Paecilomyces lilacinus 252 (AGAL 90/028188A), Paecilomyces lilacinus 253 (AGAL 90/028188B), and Paecilomyces lilacinus 254 (AGAL 90/028188C), which exhibit aggressive and fas... | 11/23/1999 |
| 5981265 | Methods for regulating MEKK protein activity The present invention relates to isolated MEKK proteins, nucleic acid molecules having sequences that encode such proteins, and antibodies raised against such proteins. The present invention also includes methods to use such proteins to regulate signal tr... | 11/09/1999 |
