Did You Know...
...that after Parker Brothers executives turned down the game of Monopoly because it had "52 fundamental errors" (including taking too long to play), a copy of the game wound up in the home of the company president who stayed up until 1 a.m. to finish playing it? He was so impressed by the game that the next day he wrote to inventor Charles Darrow and offered to buy it!
PatentStorm News
Make the Most of Our Site
See this month's Top Inventors and Most Cited Patents.
Stay on top of the latest innovations by subscribing to an RSS feed.
Registered users: Manage your profile.
| Number | Title | Issue Date |
| 7334289 | Lubricant cleansing apparatus for dry-type wire drawing Disclosed herein is an apparatus for cleaning a lubricant for dry-type wire drawing. The apparatus comprises a case provided with a cover and piercing holes at opposite sides of the case such that a steel wire can pass through the case, a plurality of driving motors... | 02/26/2008 |
| 7334424 | Air conditioner having independent cooling and purifying paths Disclosed herein is an air conditioner having independent cooling and purifying paths. The air conditioner comprises a body casing formed by assembling a front panel with a rear panel, the front panel having a cooled air discharge opening and one or more suction ope... | 02/26/2008 |
| 7333348 | DC-DC converter There is provided a high-efficiency DC-DC converter which comprises a voltage resonance circuit to which electric power from a low-voltage direct-current power supply, including a household fuel cell and a solar cell, is input and performs DC-AC conversion by zero-v... | 02/19/2008 |
| 7323261 | Compressible printing blanket and method of manufacturing a compressible printing blanket Disclosed is a compressible printing blanket in which voids are formed in the compressible layer by using microballoons, comprising at least two fabric layers, an adhesive layer interposed between adjacent fabric layers, a surface rubber layer, and a compressible la... | 01/29/2008 |
| 7312081 | Genetic demonstration of requirement for nkx6.1, nkx2.2 and nkx6.2 in ventral neuron generation This invention provides a method of converting a stem cell into a ventral neuron which comprises introducing into the stem cell a nucleic acid which expresses homeodomain transcription factor Nkx6.1 or Nkx6.2 protein in the stem cell so as to thereby convert the ste... | 12/25/2007 |
| 7309578 | Therapeutic treatment of chronic obstructive pulmonary disease The present invention provides a method of treating or preventing a chronic obstructive pulmonary disease in a subject, comprising administering to said subject an amount of an agent affective to inhibit apoptosis of the subject's lung cells and thus treat or preven... | 12/18/2007 |
| 7303904 | Stable gene variants of lipases The present invention relates to the generation and production of novel thermostable, organic solvent stable and pH tolerant lipase gene variants. The invention also relates to methods of selecting lipase variants for high temperatures and for their purification. | 12/04/2007 |
| 7300520 | Crystallization reagent matrices and related methods and kits This invention provides methods, kits and automated systems for identifying a reagent in which a compound crystallizes, and methods for crystallizing a compound. ... | 11/27/2007 |
| 7295881 | Nerve-branch-specific action-potential activation, inhibition, and monitoring A dual electrode arrangement, is provided, wherein two, preferably unidirectional, electrode configurations flank a nerve junction from which a preselected nerve branch issues, proximally and distally to the junction, with respect to the brain. The arrangement is co... | 11/13/2007 |
| 7294687 | Parenteral formulations of a peptide for the treatment of systemic lupus erythematosus The subject invention provides a pharmaceutical composition comprising an aqueous carrier; from 0.1 mg/ml to 20 mg/ml of the composition of a pharmaceutically acceptable salt of a peptide having the structural formula NH2-... | 11/13/2007 |
| 7288715 | High-vacuum-maintaining structure of superconducting cable Disclosed herein is a high-vacuum-maintaining structure of a superconducting cable. The superconducting cable includes inner and outer metal tubes, and spacers disposed between the inner and outer metal tubes for spacing them by a prescribed distance. To the spacers... | 10/30/2007 |
| 7285391 | Methods for predicting pregnancy outcome in a subject by hCG assay The present invention provides a method of predicting pregnancy outcome in a subject by determining the amount of an early pregnancy associated molecular isoform of hCG in a sample. The present invention further provides a method for determining the amount of early ... | 10/23/2007 |
| 7285360 | Polymer gel electrolyte composition and method of producing the same A polymer gel electrolyte composition includes a crosslinked polymer network matrix having a three-dimensional crosslinked structure that includes a solution of an electrolyte in a non-aqueous solvent, and a non-crosslinked polymer included within the crosslinked po... | 10/23/2007 |
| 7279172 | Treatment of autoimmune conditions with copolymer 1 and related copolymers The present invention provides heteropolymer compositions and peptide compositions, and methods of making and using therapeutic compositions comprising amino acid heteropolymers for treatment of a subject for an autoimmune or an inflammatory disease, the heteropolym... | 10/09/2007 |
| 7258857 | Rage-related methods for treating inflammation The present invention provides a method for treating inflammation in a subject which comprises administering to the subject soluble receptor for advanced glycation endproduct (sRAGE) in an amount effective to inhibit binding of advanced glycation endproducts (AGEs) ... | 08/21/2007 |
| 7244599 | Gene and uses therefor to modify pasture qualities of crops The invention relates generally to isolated leucoanthocyanidin reductase LAR polypeptides of the Reductase-Epimerase-Dehydrogenase (RED) protein family, and nucleic acid molecules encoding same and their use in regulating the biosynthesis and accumulation of proanth... | 07/17/2007 |
| 7245962 | System and method for determining reentrant ventricular tachycardia isthmus location and shape for catheter ablation A method and system for identifying and localizing a reentrant circuit isthmus in a heart of a subject during sinus rhythm is provided. The method may include (a) receiving electrogram signals from the heart during sinus rhythm via electrodes, (b) creating a map bas... | 07/17/2007 |
| 7241743 | Sir2α-based therapeutic and prophylactic methods This invention provides methods for treating and for inhibiting the onset of cancer in a subject comprising administering an agent that inhibits the ability of Sir2α to inhibit p53-dependent apoptosis. This invention also provides a related method for inducing the ... | 07/10/2007 |
| 7241881 | Genes encoding insect odorant receptors and uses thereof This invention provides an isolated nucleic acid molecule encoding an insect odorant receptor. This invention provides a nucleic acid molecule of at least 12 nucleotides capable of specifically hybridizing with the nucleic acid molecule encoding an insect odorant re... | 07/10/2007 |
| 7238359 | Antigen ORF Rv2430c and a method thereof The present invention relates to a PPE family antigenic protein Rv2430c of SEQ ID No. 1; a set of three high antigenic index peptides of SEQ ID Nos. 2 to 4; an antigenic ORF Rv2430c of SEQ ID No. 5 and lastly a method of inducing immune response against Mycobacte... | 07/03/2007 |
| 7233110 | Metal halide lamp and lighting device A metal halide lamp comprises a refractory, light-transmitting airtight container defining therein a discharge space with an internal volume of not more than 0.1 cc, electrodes sealed in the container, opposing each other with a distance of not more than 5 mm interp... | 06/19/2007 |
| 7232891 | Anti-human luteinizing hormone-related antibodies and uses thereof The subject invention provides a method for detecting the presence of human malignant cells in a sample of tumor cells, which comprises contacting the sample with an antibody directed to an epitope present on the β subunit of human luteinizing hormone or on intact ... | 06/19/2007 |
| 7229781 | Diagnostic kit for predicting the onset of menopause The present invention provides methods to quantitate the hLHβ core fragment in a sample. The present invention now makes it possible to evaluate the metabolism of hLH in premenopausal, perimenopausal and postmenopausal women and to distinguish between normal and ab... | 06/12/2007 |
| 7222496 | Heat pump type air conditioner having an improved defrosting structure and defrosting method for the same A heat pump type air conditioner having an improved defrosting structure and a defrosting method for the same. When frost is not excessively accumulated on piping of an outdoor heat exchanger, a solenoid valve is controlled such that warm refrigerant from a compress... | 05/29/2007 |
| 7223430 | Apparatus and method for making confectionery on a stick Apparatus (1) and method for moulding lollipops, the apparatus comprising stick receiving means (6) and a mould forming surface (3) of a mould (15), the stick receiving means being mounted for pivotal movement relative to the mould formin... | 05/29/2007 |
| 7223856 | Antisense compounds which prevent cell death and uses thereof The present invention provides for an antisense oligonucleotide having the sequence 5′GCTCGGCGCCGCCATTTCCAG3′. The invention also provides for an antisense oligonucleotide having the sequence 5′GTCAGCGGCCATCAGCTT3′. The present invention further provides for... | 05/29/2007 |
| 7220559 | Development of human monoclonal antibodies and uses thereof This invention provides: a heteromyeloma, other than B6B11, capable of producing a trioma when fused with a human lymphoid cell, wherein the trioma is capable of producing a monoclonal antibody-secreting tetroma when fused with a second, antibody-secreting human lym... | 05/22/2007 |
| 7220411 | Compositions comprising anti-CCR5 antibody This invention provides a composition for inhibiting HIV-1 infection comprising at least two compounds in synergistically effective amounts for inhibiting HIV-1 infection, wherein at least one of the compounds prevents the productive interaction between HIV-1 and an... | 05/22/2007 |
| 7202215 | Long-acting follicle stimulating hormone analogues and uses thereof This invention provides FSH analogues having increased serum half-life relative to FSH. This invention also provides related compositions and methods for increasing fertility, egg production and spermatogenesis in a subject. ... | 04/10/2007 |
| 7202211 | Methods of preventing or treating brain ischemia or brain injury The present invention relates to use of Narp inhibitor in order to promote or enhance recovery from ischemic events, particularly focal ischemia of the central nervous system, as well as for preventing or diminishing chronic degenerative changes. ... | 04/10/2007 |
| 7198775 | Detectably labeled porphyrin compound for identifying the sentinel lymph node A detectably labeled porphyrin compound for identifying a sentinel lymph node in patients, particularly those with cancer. A method of identifying a sentinel lymph node, comprising the steps of: injecting the detectably labeled porphyrin compound into a tumor, where... | 04/03/2007 |
| 7192916 | Gene encoding MNR2 and uses thereof This invention provides isolated nucleic acids encoding a motor neuron restricted MNR2 protein, and a homeobox HB9 protein. Also provided are purified MNR2 and HB9 proteins, antibodies recognizing these proteins, transgenic animals expressing these proteins, and fun... | 03/20/2007 |
| 7192588 | Vaccine composition and method of using the same The present invention relates to a stable compacted, compressed or hard tableted injectable composition, including a vaccine composition comprising at least one freeze dried antigenic component and a dissolution aid. A package containing the above injectable composi... | 03/20/2007 |
| 7192395 | Modification of polymer surfaces as radioisotope carriers A radioactive source is made by forming a polymer layer substantially free of inorganic polymers on a substrate material, and exposing the polymer layer to a radioactive isotope. The source is useful for inhibition of restenosis in coronary arteries after balloon an... | 03/20/2007 |
| 7186534 | Potent inhibitors of human 9-cis retinol dehydrogenase The cDNA sequence of the human 9-cis-retinol dehydrogenase enzyme is disclosed. ... | 03/06/2007 |
| 7181356 | Device and method for analyzing the structure of a material The invention relates to a device that is used to analyse the structure of a material. The inventive device comprises: probe elements (5) which are used to (i) emit a wave, in the material, with emission delay laws that correspond to several simultaneous devi... | 02/20/2007 |
| 7173113 | Long-acting hormone and growth factor compositions and uses thereof This invention provides VEGF-FSH compounds having increased serum half-lives relative to either native VEGF or FSH, in which both VEGF and FSH are biologically active. This invention also provides related compositions and methods for increasing fertility, egg produc... | 02/06/2007 |
| 7165324 | Method for manufacturing a composite high voltage insulator Disclosed is a method for manufacturing a composite high voltage insulator in which a plurality of skirts are manufactured and joined to a rod, and more particularly to a method for manufacturing a composite high voltage insulator in which an expanding pipe is inser... | 01/23/2007 |
| 7167921 | Full duplex re-transmitter Method for efficiently exploiting an upstream channel bandwidth of full-duplex connection between a user and network. Data from the network is received by a user. The data is stored on the user's storage device, for a predetermined period of time for further use. Th... | 01/23/2007 |
| 7166288 | Use of insulin-like growth factor binding protein 3 (IGF-BP3) for inhibition of tumor growth A method of inhibiting proliferation of cells associated with a tumor in a subject which comprises administering to the subject a tumor cell proliferation amount of IGF-BP3, thereby inhibiting proliferation of the cells. An improved surgical method which comprises s... | 01/23/2007 |
