Bizarre Patents
Self Containing Enclosure for Protection from Killer Bees
A self contained protective enclosure with an opening for entry and egress and a screen for ventilation and viewing.
PatentStorm News
Make the Most of PatentStorm
See this month's Top Inventors and Most Cited Patents.
Stay on top of the latest patents by subscribing to an RSS feed.
Got questions? Ask a Patent Expert!
Registered users: Manage your profile, comments and alerts.
| Number | Title | Issue Date |
| 7042561 | Device and method for alignment The present invention refers to a system and a device (10) for alignment of at least one alignable plane with reference to at least one reference plane. The device includes a main part (11), a light source (18) and a number of contact points ( | 05/09/2006 |
| 7028339 | High security wireless key for asynchronous delivery drop boxes A wireless key (6), capable of transmitting an ultra-low frequency radio wave signal (5), is used to gain access to a secure receptacle (1), the wireless key (6) and receptacle (1) comprising a system to ensure the secure transfer ... | 04/11/2006 |
| 7015267 | Polyethylene terephthalate compositions A method for increasing the crystallization rate of a polyethylene terepthalate (PET) prepared based on terepthalic acid (TPA) and ethylene glycol monomers, by adding into said TPA-based PET an effective amount of a polyethylene terepthalate prepared based on dimeth... | 03/21/2006 |
| RE38995 | Interfacial method of preparing ester-substituted diaryl carbonates High yields of ester-substituted diary carbonates such as bis-methyl salicyl carbonate were obtained by the condensation of methyl salicylate with phosgene in the presence of a phase transfer catalyst (PTC) in an interfacial reaction system in which the pH of the aq... | 02/28/2006 |
| 6991158 | Mobile paper record processing system A method is disclosed for electronically capturing and storing paper records for accounting purposes using a mobile handheld device with an integrated digital camera or scanner. This method involves digitalizing a paper receipt with a digital camera or scanner, manu... | 01/31/2006 |
| 6993610 | Data storage system having two disk drive controllers each having transmit and receive path connected in common to single port of disk drive via buffer or multiplexer A data storage apparatus arranged to provide redundancy in a storage enclosure containing multiple Serial ATA disk drives is disclosed. The apparatus comprises at least one disk drive of a kind having a single port for the input and output of serial data and at leas... | 01/31/2006 |
| 6989190 | Transparent polycarbonate polyester composition and process Disclosed is a transparent/translucent molding composition and process for making prepared from an impact modifier and a resin blend of polycarbonate and a cycloaliphatic polyester having a matching index of refraction. ... | 01/24/2006 |
| 6986902 | Polyanionic polymers which enhance fusogenicity The present invention relates generally to the amphiphilic polyelectrolyte, poly(2-ethylacrylic acid) and covalently bonded lipids to generate Lipo-PEAA. These Lipo-PEAA are then used to make pH-sensitive liposomes which become unstable, permeable or fusogenic with ... | 01/17/2006 |
| 6986776 | Suturing apparatus, method and system An apparatus used with a helical suture device has a first end and a second end. The first end includes a spatulate member having a length along a first axis. The second end includes a guide shaped to receive a cylindrical axle of the helical suture device for rotat... | 01/17/2006 |
| 6983363 | Reset facility for redundant processor using a fiber channel loop A processor resetting apparatus comprises a fibre channel arbitrated loop (FC-AL) interface arranged to receive a frame over the FC-AL containing an indicator of a reset command for a server comprising one of a redundant pair of servers and including a processor ass... | 01/03/2006 |
| 6975590 | Fiber-channel arbitrated-loop split loop operation An enclosure services processor card is arranged to selectively split a fiber-channel arbitrated-loop (FC-AL) into two split loops. The card is adapted to plug into a backplane for a rack enclosure and includes a first switch operatively connected to a hub for the F... | 12/13/2005 |
| 6963929 | Internet e-mail add-on service system A system and method is provided for constructing an internet e-mail add-on service system that can seamlessly operate on the conventional SMTP internet message transport network. The method and system make use of a recipient e-mail address extended by a domain suffi... | 11/08/2005 |
| 6961767 | Fibre channel diagnostics in a storage enclosure A fiber channel analyzer for analyzing the operation of a fiber channel arbitrated loop (FC-AL) to which a plurality of devices are connectable is disclosed. The analyzer is adapted to be housed in an enclosure which, in use, houses at least one of the fiber channel... | 11/01/2005 |
| 6951631 | Test kits and devices A test kit for determining qualitatively or quantitatively the presence of one or more analytes in a fluid sample, comprising an assay device together with a reading device which engages with the assay device and wherein precisely located engagement of the assay dev... | 10/04/2005 |
| 6949599 | Polycarbonate polyester molding composition A clear blend of three resin components includes a first polycarbonate resin component; a second resin component of a first polyester copolymer resin derived from a cycloaliphatic diol and a cycloaliphatic dicarboxylic acid, and a third resin component of a second p... | 09/27/2005 |
| 6946456 | Methods for treating cell proliferative disorders and viral infections The present invention concerns methods for treating cell proliferative diseases, tumors associated with viral infections, and certain viral infections. The disclosed methods use compounds which inhibit heat shock protein 90 proteins. Such methods block Rb negative o... | 09/20/2005 |
| 6944611 | Method and apparatus for digital media management, retrieval, and collaboration A system stores digital media records and has a search engine searching the stored digital media records. The system receives first search requests from a plurality of first users. The system performs, by the search engine, searches based upon the first search reque... | 09/13/2005 |
| 6941294 | Method and apparatus for digital media management, retrieval, and collaboration A system stores digital media records, and comprising a vocabulary file of words keyed to the digital media records. A search query is received by computer from a user, the search query including words. The search query is logged by computer, yielding a query log. T... | 09/06/2005 |
| 6927793 | Method and device for forming an image The method for forming an image with a wide dynamic range makes use of an image sensor containing subsets of pixels that can be individually reset. After an initial reset (21), a pixel or row of pixels is exposed (22) for a first time interval and the ... | 08/09/2005 |
| 6922691 | Method and apparatus for digital media management, retrieval, and collaboration A system has first and second metadata streams with respect to a video stream, the first metadata stream time-coded with respect to the video stream and the second metadata stream not time-coded with respect to the video stream. The the second metadata stream is ali... | 07/26/2005 |
| 6912572 | Server monitoring The invention concerns a method for causing a plugin to be executed, in particular for test purposes, on one or on several computers. The plugin is transmitted to at least one computer (11.1, 11.2, 11.3) through a network (2). Subsequently the plugin c... | 06/28/2005 |
| 6900187 | TRPM-2 antisense therapy using an oligonucleotide having 2′-O-(2-methoxy)ethyl modifications A compound consisting of an oligonucleotide of sequence CAGCAGCAGAGTCTTCATCAT, where the oligonucleotide has a phosphorothioate backbone throughout, the sugar moieties of nucleotides 1-4 and 18-21 bear 2′-O-methoxyethyl modifications, and the remaining nucleotides... | 05/31/2005 |
| 6895407 | Method and apparatus for digital media management, retrieval, and collaboration The software incorporates a glossary management tool that makes it easy for each client to customize terminology to the needs of a particular business. With this tool, termed a glossary manager, a company can customize a number of feature names in the system to prov... | 05/17/2005 |
| 6893147 | Lamp lens or bezel with visual effect Lenses and bezels for lamps provide an appealing aesthetic look in the form of a colored glow at the edges of the lens or bezel by incorportation of an photoluminescent material in a molded polycarbonate body. The lenses are particularly suitable for use as an autom... | 05/17/2005 |
| 6887969 | Method and apparatus to make high molecular weight melt polycarbonate Usually, polycarbonate polymerization is limited by the rate at which inhibitory byproducts, such as phenol and salicylate, can be removed from the reaction. To facilitate the removal of volatile reaction byproducts from the reaction as polymerization occurs, the pr... | 05/03/2005 |
| 6887467 | Double mutants of dihydrofolate reductase and methods of using same New mutant forms of human dihydrofolate reductase (DHFR) which have properties superior to the previously disclosed mutants have mutations at both amino acid 22 and amino acid 31. Specific mutant forms are Ser31Tyr22, Ser31Phe22, Gly31Tyr22, Gly31Phe22... | 05/03/2005 |
| 6882985 | Marketplace system fees enhancing market share and participation A method for use by buyers and sellers in the execution of trades. The price of each executed trade within the system is logged. Next, a trend line is derived from the logged trades. The trading fee for a particular trade is determined based on the difference betwee... | 04/19/2005 |
| 6883106 | System for communicating a signal to a device indicating an output supply level being provided to a backplane from a power supply unit A power supply unit controller for a rack enclosure in which a plurality of devices communicate via a backplane is disclosed. The controller reads at least one signal indicative of an output supply level being provided to the backplane by a power supply unit associa... | 04/19/2005 |
| 6877023 | Messaging system for delivering data in the form of portable message formats between message clients A messaging system is disclosed for the purpose of delivering data in the form of a portable message format from a producer of any kind, over any transport protocol, using any delivery guarantee, to one or more recipients of any kind. The method for running said mes... | 04/05/2005 |
| 6876954 | Method for characterizing samples Physical samples are characterized to determine the content of the samples. A physical sample, or pair of physical samples, and the sample(s) are processed to generate a multidimensional response, calculating the 1-dimensional response of the components, to provide ... | 04/05/2005 |
| 6874774 | Method for producing images in the edge of a volume of paper sheets The present invention concerns a method for producing an image in the edge of a volume of paper sheets. The invention can be used for numerous stationary products, note pads, exercise books, and the like. In the present invention, the images are printed not on the e... | 04/05/2005 |
| 6860984 | pH electrode and methods of preparing and using same A pH electrode having a pH-sensitive region on an electrically conductive support, said pH-sensitive region comprising a mixture of between 50% and 85% of the total mixture by weight of particles of a Group VA or G... | 03/01/2005 |
| 6858671 | Method of manufacture of polyester molding compositions and articles produced therefrom A thermoplastic molding composition comprises a resin composition having 50 to about 90 weight percent of a polyester, about 8 to about 48 weight percent of a polyetherimide, about 2 to about 25 weight percent of a high rubber graft impact modifier, each based on th... | 02/22/2005 |
| 6858224 | Method of preventing aggregation of a lipid:nucleic acid complex Particle aggregation of lipid:nucleic acid complex particles is prevented by incorporating a non-cationic lipid into lipid:nucleic acid complex particles containing a cationic lipid and a nucleic acid polymer. The non-cationic lipid is a polyethylene glycol-based po... | 02/22/2005 |
| 6852334 | Cationic peg-lipids and methods of use The present invention provides cationic-polymer-lipid conjugates (CPLs) such as distal cationic-poly(ethylene glycol)-lipid conjugates which can be incorporated into conventional and stealth liposomes or other lipid-based formulation for enhancing cellular uptake. T... | 02/08/2005 |
| 6840919 | Percutaneous bone anchored transferring device The present invention relates to a percutaneous bone anchored transferring device and a connecting device for obtaining a transfer of an electrical signal and/or energy and/or distribution of a drug and/or airing of a body cavity and a system and a method for using ... | 01/11/2005 |
| 6837932 | Pressure feed coating application system The present invention includes a device and a method of applying a coating to a web. The preferred device comprises a feed nozzle coupled to a stiffener coupled to a spring coupled to a position/force adjuster. The feed nozzle comprises a fluid reservoir, a feed pip... | 01/04/2005 |
| 6835395 | Composition containing small multilamellar oligodeoxynucleotide-containing lipid vesicles Lipidic compositions with superior characteristics for in vivo delivery of oligodeoxynucleotides (ODN) can easily and efficiently be made in the form of small multilamellar vesicles. The compositions contain a population of nucleic acid-containing lipid vesicles in ... | 12/28/2004 |
| 6834064 | Mode-locked thin-disk laser A pulsed solid-state thin-disk laser comprises an optical resonator and a solid-state laser gain medium placed inside the optical resonator. The laser gain medium is in the shape of a thin plate or layer with two end faces, the extension of the end faces being great... | 12/21/2004 |
| 6826714 | Data gathering device for a rack enclosure A data gathering device for a rack enclosure which is, in use, cooperable with at least one SES processor, each processor being incorporated in a respective plug-in card. The data gathering device comprises at least one port adapted to communicate with a respective ... | 11/30/2004 |