Celebrity Inventors
Penn Jillette of Penn and Teller fame has patented a "Hydro-Therapeutic Stimulator", which uses a hot tub for stimulation.
PatentStorm News
Make the Most of Our Site
See this month's Top Inventors and Most Cited Patents.
Stay on top of the latest innovations by subscribing to an RSS feed.
Registered users: Manage your profile.
| Number | Title | Issue Date |
| 7842674 | Methods of treatment of acute renal failure The invention relates to a double-stranded compound, preferably an oligoribonucleotide, which down-regulates the expression of a human p53 gene. The invention also relates to a pharmaceutical composition comprising the compound, or a vector capable of expressing the... | 11/30/2010 |
| 7671659 | Clock control circuit and voltage pumping device using the same A clock control circuit is provided. The clock control circuit includes a voltage supplier for supplying a first voltage in response to a first clock signal, a voltage booster for boosting the first voltage in response to the first clock signal input to the voltage ... | 03/02/2010 |
| 7609871 | Automatic region of interest locator for AP spinal images and for hip images in bone densitometry In DEXA (dual energy x-ray absorptiometry), a system for automatically or nearly so identifying a region of interest in an AP (anterior/posterior) spinal image by processing the pixel values within a global region to find the lateral extent of the vertebra and the s... | 10/27/2009 |
| 7577282 | Image handling and display in X-ray mammography and tomosynthesis A method and system for acquiring, processing, storing, and displaying x-ray mammograms Mp tomosynthesis images Tr representative of breast slices, and x-ray tomosynthesis projection images Tp taken at different angles to a breast, where the Tr images are reconstruc... | 08/18/2009 |
| 7556602 | Breast cancer screening with adjunctive ultrasound mammography Ultrasound mammography in which an automated transducer scans the patient's breast to generate many images of thin slices that are processed into few images of thick slices that can be displayed simultaneously for practical rapid assessment of the breast. The thin-s... | 07/07/2009 |
| 7274180 | Constant voltage outputting method and apparatus capable of changing output voltage rise time A constant voltage outputting apparatus includes an input terminal, an output terminal, a control unit, a plurality of output control transistors, and a switching unit. The input terminal receives an input voltage, and the output terminal outputs an output voltage. ... | 09/25/2007 |
| 7264477 | Underwater drawing tablet An underwater writing and drawing tablet that stretches a length of waterproof (plastic) vellum between two rollers over a flat surface thereby enabling the user to easily draw or write on said vellum and permanently save the drawing and writing. ... | 09/04/2007 |
| 7264347 | Recording-medium conveying device conveying a recording medium on a conveying belt charged with a positive charge and a negative charge alternately This recording-medium conveying device comprises a conveying belt, the conveying belt, a belt charging unit, and a pressing roller. The conveying belt is wound around a driving roller and a driven roller so as to convey a recording medium to an image recording part.... | 09/04/2007 |
| 7264338 | Recording head, carriage and image forming apparatus A recording head is provided with a plurality of nozzles for ejecting a fluid, a plurality of pressure-applied chambers arranged in a predetermined direction and each communicating with a corresponding one of the nozzles, and a common chamber having a plurality of w... | 09/04/2007 |
| 7223856 | Antisense compounds which prevent cell death and uses thereof The present invention provides for an antisense oligonucleotide having the sequence 5′GCTCGGCGCCGCCATTTCCAG3′. The invention also provides for an antisense oligonucleotide having the sequence 5′GTCAGCGGCCATCAGCTT3′. The present invention further provides for... | 05/29/2007 |
| 7200081 | Write strategy circuit, write strategy method, and optical disk apparatus A write strategy circuit and a write strategy method for capturing data are disclosed. A strategy clock generator generates a strategy clock signal based on a channel clock signal. A phase controller produces a capturing channel clock signal by controlling a phase o... | 04/03/2007 |
| 7052264 | Molding metal mold, method of producing molding metal mold, and articles molded by molding metal mold A forming metal mold for molding synthetic resin includes a base mold (4), a first forming mold (5) secured to the base mold (4) and having a molding recess (9), and a second forming mold (6) secured to the base mold (4) as ... | 05/30/2006 |
| 6673137 | Apparatus and method for purifying air in a ventilation system An air purifier includes a housing having a purification chamber with an inlet to the housing for drawing in contaminated air and an outlet from the housing for releasing purified air. The air purifier also includes an inlet for introducing a fluid contai... | 01/06/2004 |
| 6429961 | Methods for retrofitting windows with switchable and non-switchable window enhancements A method for retrofitting a window by combining the window with a switchable or non-switchable window enhancement. The method includes providing a window comprising at least one relatively transparent viewing pane with first and second opposed viewing sur... | 08/06/2002 |
| 6424860 | Myocardial ischemia and infarction analysis and monitoring method and apparatus A myocardial analysis and monitoring method, comprising the steps of receiving a number of ECG signals relating to a heartbeat of at least one patient, converting the received number of ECG signals into three perpendicular ECG signals, determining an aver... | 07/23/2002 |
| 6278456 | Web calendar architecture and uses thereof An architecture for facilitating Web-based client-side calendar event scheduling includes a Web Calendar scheduling tool which takes input via either a mouse and/or a keyboard to achieve a) an Internet personal organizer, b) multimedia effects associated ... | 08/21/2001 |
| 6187819 | Protein kinase C activators and their use in decreasing expression of cell antigens A composition for the upregulation of expression of cell antigens, without inducing shedding, which comprises a protein kinase C activator is provided by this invention. Further provided by this invention is a method of detecting and treating tumor cells ... | 02/13/2001 |
| 6057458 | Production of 3-alkoxyalkanals by hydroformylation of enol ether substrates The present invention provides a process for producing an optically active aldehyde which comprises hydroformylating a terminal olefin substrate represented by the formula: Q1 Q2 C.dbd.CH2 wherein Q1 is an atom or gr... | 05/02/2000 |
| 5897515 | Ankle-foot orthosis An ankle-foot orthosis made of a carbon fiber reinforced material having low weight is carried on the front of the lower leg, extending over the lateral ankle and preventing plantar flexion. The orthosis may be worn under ordinary clothes and shoes and pr... | 04/27/1999 |
| 5831687 | Color video signal processing method and apparatus for converting digital color difference component signals into digital RGB component signals by a digital conversion In a color video signal processing method, color difference component signals are converted into RGB component signals by a digital to digital conversion so as to reduce a size of a processing unit used for the conversion. An analog composite signal is co... | 11/03/1998 |
| 5778499 | Shoelace and method for easy tying This invention provides a binding for facilitating tying a bow, comprising a binding having two end portions wherein a multiplicity of hook-shaped filaments are positioned on a first region of each end portion; and a second region of each end portion is a... | 07/14/1998 |
| 5773256 | Methods for the production of esters of -glucosides and uses thereof Disclosed is a process of enzymatically preparing -glucoside esters. First, -glucosides are produced by placing an acyclic alcohol or a mixture of acyclic alcohols having a water solubility of at least 2.7% v/v at 20° C. in contact with sta... | 06/30/1998 |
| 5677025 | Optical information recording medium near infrared absorbing material therefor Disclosed are a phthalocyanine near infrared absorbing material having a phthalocyanine skeleton whose benzene rings contain a silyl group as a bulky substituent and an optical information recording medium containing the material. The phthalocyanine near ... | 10/14/1997 |
| 5605628 | Composite membranes A composite membrane comprises an inorganic support having interstices and porous inorganic films of sintered non-metallic particles carried by the support and bridging the interstices thereof. The support is preferably a woven metal mesh, with the films ... | 02/25/1997 |
| 5571521 | Composition containing silver ammonium phenytoin complex and a phenytoin and use of said composition Compositions containing silver ammonium phenytoin complex and a phenytoin are usefully employed, particularly when applied topically, for the treatment of animal or human tissue, for wound healing and are useful in wound dressing preparations for the prev... | 11/05/1996 |
| 5549732 | Production of granules of reactive metals, for example magnesium and magnesium alloy A process of producing granules of a reactive metal. The process comprises providing a source of molten reactive metal, forming discrete droplets of the molten metal, contacting the droplets while still substantially molten with a fluidized bed of particl... | 08/27/1996 |
| 5536589 | Magneto-optical recording medium A magneto-optical recording medium on which rewriting is possible is composed of a substrate and a recording layer exhibiting perpendicular anisotropy formed thereon. The recording layer consists of at least a transition-metal layer and a rare-earth-metal... | 07/16/1996 |
| 5537009 | Transition of a substance to a new state through use of energizer such as RF energy A material such as a gas at an initial pressure below atmospheric is treated with RF energy at a frequency greater than 1 MHz to transition to a glow discharge state and then at increased pressure to a new state at which the average internal temperature i... | 07/16/1996 |
| 5534974 | Printing apparatus performing bidirectional communication with a plurality of user terminals There is provided a printing apparatus in which a paper-supplying tray being used by one user is not allowed to be used by the other users. The printing apparatus is used by a plurality of users by means of bidirectional communication. One or more paper-s... | 07/09/1996 |
| 5530554 | Image forming system with common processor bus architecture An image forming apparatus which can perform a number of jobs usually performed by a host computer. The image forming apparatus has a printer and a scanner, and is used with a host computer having a standard bus line provided with an external connection. ... | 06/25/1996 |
| 5529901 | Method for determining the presence or amount of analyte using a stable colloidal carbon sol This invention relates to a method for determining the presence or amount of an analyte in a sample comprising contacting the sample with a labeled constituent consisting of an aqueous carbon sol which is stable in the absence of a stabilizing substance. ... | 06/25/1996 |
| 5527657 | One-component magnetic toner for use in electrophotography A one-component magnetic toner with high resistivity for use in electrophotography for developing latent electrostatic images to visible toner images by contact development, includes a coloring agent, a binder resin, and a magnetic material which contains... | 06/18/1996 |
| 5526969 | Convertible backpack A backpack is convertible between a backpack only mode and a backpack and protective outerwear mode. In the former mode, carrying straps and a second compartment are connected to the outside of a first compartment, and protective outerwear is connected to... | 06/18/1996 |
| 5527381 | Gas treatment of molten metals A method of and apparatus for treating molten metal to achieve effective removal of such unwanted inclusions as gases, alkali metals, entrained solids, and the like. The method comprises introducing molten metal into a trough, such as the trough provided ... | 06/18/1996 |
| 5523957 | Process for controlling rotary calcining kilns, and control system therefor A process and control system for controlling a rotary calcining kiln having a feed material inlet for material to be calcined, a calcined product outlet and a high temperature zone in which said material is calcined, the high temperature zone being movabl... | 06/04/1996 |
| 5521801 | Lamp with oblong lighting means and reflectors A lamp with at least one oblong means of lighting is mounted in a reflector cage which is attached beneath curved reflector surfaces. In order to attach the lamp directly to a ceiling, the reflector surfaces are given a roughly V-shaped front-view profile... | 05/28/1996 |
| 5521892 | Closed-loop control system and servo device of optical disk unit In a closed-loop control system and a servo device of an optical disk unit, a loop gain can be suitably corrected by a simplified structure. A signal is added to a closed loop and a value having a correlation with a gain of the closed loop is measured in ... | 05/28/1996 |
| 5520191 | Myocardial ischemia and infarction analysis and monitoring method and apparatus A cardiac monitoring method and system provides advanced ischemia and infarction analysis and monitoring. Advanced calculations are performed on ECG signals to obtain parameter values relating to myocardial ischemia and infarction. Dominant heart beats ar... | 05/28/1996 |
| 5519515 | Method of determining color signals for input signals at vertices in input color space A color signal determining method comprises steps of: dividing a three-dimensional input color space into a plurality of unit solid figures, each of the solid figures having a set of vertices; determining a plurality of color correction parameters based o... | 05/21/1996 |
| 5517898 | Pneumatic cylinder utilizing cushioning sleeves, quick exhaust valves and quick supply valves A pneumatic cylinder includes a cushioning device having a first cushioning sleeve gradually decreasingly communicating a first cushioning chamber with a first passage formed on a first cap and connected to a first fluid flowing ports as the first cushion... | 05/21/1996 |
