Bizarre Patents
A hand wearable body squeegee comprising a glove portion, a concave squeegee band, and a linear squeegee band.
PatentStorm News
Make the Most of Our Site
See this month's Top Inventors and Most Cited Patents.
Stay on top of the latest innovations by subscribing to an RSS feed.
Registered users: Manage your profile.
| Number | Title | Issue Date |
| 8182666 | Apparatus and methods for concentrating and separating particles such as molecules Particles of interest, such as DNA molecules, are injected into a medium by applying a first field. Once in the medium the particles are concentrated by applying one or more fields that cause mobilities of the particles in the medium to vary in a manner that is corr... | 05/22/2012 |
| 8168610 | Bispecific oligonucleotide for the treatment of CNS malignancies CNS malignancy is treated in a subject suffering from a CNS malignancy by administering to the subject an antisense oligonucleotide having a sequence of bases that is complementary to portions of both the gene encoding IGFBP-2 and the gene encoding IGFBP-5, and whic... | 05/01/2012 |
| 8156569 | Protective helmet with movable outer shell relative to inner shell A helmet is wearable on a user's head for mitigating neck injury. The helmet incorporates an outer member which defines a concavity; an inner member, at least a portion of which is located within the concavity; and a path-motion guide mechanism which couples the inn... | 04/17/2012 |
| 8133371 | Scodaphoresis and methods and apparatus for moving and concentrating particles Methods and apparatus for moving and concentrating particles apply an alternating driving field and an alternating field that alters mobility of the particles. The driving field and mobility-varying field are correlated with one another. The methods and apparatus ma... | 03/13/2012 |
| 8105788 | Mucopolysaccharidosis (MPS) diagnostic methods, systems, kits and assays associated therewith Methods, systems, kits and assays for diagnosing, monitoring or screening for mucopolysaccharidosis (MPS) and methods and systems for assaying test compounds for therapeutic activity are described, whereby MPS marker protein levels are assayed as an indication of MP... | 01/31/2012 |
| 8080640 | Recombinant transferrins, transferrin half-molecules and mutants thereof Recombinant transferrin, non-glycosylated recombinant transferrin, transferrin half-molecules and mutant transferrins having altered metal-binding or other properties are described. The recombinant transferrin molecules are expressed in functional form by stable euk... | 12/20/2011 |
| 8029445 | Method and apparatus for processing ultrasound image signals A method and apparatus for processing ultrasonic image signals is disclosed. The method involves receiving a plurality of input sample values representing reflected sound waves in a ultrasonic system, exponentiating each input sample to produce a plurality of respec... | 10/04/2011 |
| 8021686 | Lipid-encapsulated polyanionic nucleic acid Methods for the preparation of a lipid-nucleic acid composition are provided. According to the methods, a mixture of lipids containing a protonatable or deprotonatable lipid, for example an amino lipid and a lipid such as a PEG- or Polyamide oligomer-modified lipid ... | 09/20/2011 |
| 7973017 | Treatment of cancer by inhibition of IGFBP's and clusterin Agents that reduce the amount of IGFBP-2 and/or IGFBP-5 and that are known to be useful in the treatment of cancer result in increased expression of the protein clusterin. Since clusterin can provide protection against apoptosis, this secondary effect detracts from ... | 07/05/2011 |
| 7964717 | RNAi probes targeting cancer-related proteins RNAi sequences that are useful as therapeutics in the treatment of cancers of various types, including prostate cancer, sarcomas such as osteosarcoma, renal cell carcinoma, breast cancer, bladder cancer, lung cancer, colon cancer, ovarian cancer, anaplastic large ce... | 06/21/2011 |
| 7955865 | Reagent delivery apparatus and methods Apparatus for dispensing droplets of reagent onto samples includes a probe tip to which droplets of reagent can adhere. The apparatus advances the probe tip toward a sample until a droplet of reagent touches the sample and is pulled off from the probe tip. A sensor ... | 06/07/2011 |
| 7932234 | Bispecific oligonucleotide for the treatment of CNS malignancies CNS malignancy is treated in a subject suffering from a CNS malignancy by administering to the subject an antisense oligonucleotide having a sequence of bases that is complementary to portions of both the gene encoding IGFBP-2 and the gene encoding IGFBP-5, and whic... | 04/26/2011 |
| 7928082 | Bispecific antisense oligonucleotides that inhibit IGFBP-2 and IGFBP-5 and methods of using same Bispecific antisense oligonucleotides which consist essentially of a sequence of bases that is complementary to portions of both the gene encoding human IGFBP-2 and the gene encoding human IGFBP-5 are useful in as antisense therapeutics in the treatment of endocrine... | 04/19/2011 |
| 7922897 | Fluidized bed wastewater treatment apparatus A fluidized bed reactor for removing phosphorus and nitrogen from wastewater has a column comprising a number of sections. The diameter of the column changes stepwise between the sections. A flow velocity in excess of 100 cm/min is maintained in a lowermost one of t... | 04/12/2011 |
| 7847091 | Compositions and methods for treatment of prostate and other cancers Therapeutic agents which target heat shock protein (hsp) 27 in vivo are used to provide treatment to individuals, particularly human individuals, suffering from prostate cancer and other cancers that overexpress hsp27. A therapeutic agent, for example an antisense o... | 12/07/2010 |
| 7846233 | Leaching process for copper concentrates A method of leaching copper from copper sulphide-containing concentrates, such as chalcopyrite, includes using pyrite as a catalyst for ferric reduction in order to eliminate passivation of the chalcopyrite surface, the process being carried out under conditions whe... | 12/07/2010 |
| 7820635 | RNAi probes targeting cancer-related proteins RNAi sequences that are useful as therapeutics in the treatment of cancers of various types, including prostate cancer, sarcomas such as osteosarcoma, renal cell carcinoma, breast cancer, bladder cancer, lung cancer, colon cancer, ovarian cancer, anaplastic large ce... | 10/26/2010 |
| 7732422 | TRPM-2 antisense therapy Antisense therapy which reduces the expression of TRPM-2 provides therapeutic benefits in the treatment of cancer. Seq ID No. 4 (cagcagcagagtcttcatcat) is an antisense oligonucleotide which inhibits expression of TRPM-2 by tumor cells, and which can be combined with... | 06/08/2010 |
| 7731661 | Method for imaging the mechanical properties of tissue An imaging system comprises a device to excite mechanical waves in elastic tissue, a device for measuring the resulting tissue motion at a plurality of locations interior to the tissue at a number of time instances, a computing device to calculate the mechanical pro... | 06/08/2010 |
| 7723312 | Compositions and methods for treatment of prostate and other cancers Therapeutic agents which target heat shock protein (hsp) 27 in vivo are used to provide treatment to individuals, particularly human individuals, suffering from prostate cancer and other cancers that overexpress hsp27. A therapeutic agent, for example an antisense o... | 05/25/2010 |
| 7709786 | Method of operating quadrupoles with added multipole fields to provide mass analysis in islands of stability A method of processing ions in a quadrupole rod set is provided, comprising a) establishing and maintaining a two-dimensional substantially quadrupole field having a quadrupole harmonic with amplitude A2 and a selected higher order harmonic with amplitude... | 05/04/2010 |
| 7622047 | Fluidized bed wastewater treatment A fluidized bed reactor (14) for removing phosphorus and nitrogen from wastewater has a column comprising a number of sections. (15A, 15B, 15C, 15D) The diameter of the column changes stepwise between the sections. A flow velocity ... | 11/24/2009 |
| 7592323 | TRPM-2 antisense therapy It has now been determined that antisense therapy which reduces the expression of TRPM-2 provides therapeutic benefits in the treatment of cancer. In particular, such antisense therapy can be applied in treatment of prostate cancer and renal cell cancer. Addition of... | 09/22/2009 |
| 7569551 | Chemo- and radiation-sensitization of cancer by antisense TRPM-2 oligodeoxynucleotides Administration of antisense oligodeoxynucleotides (ODN) targeted against the testosterone-repressed prostate message-2 (TRPM-2) gene can reduce the amount of TRPM-2 in renal cell cancer (RCC) cells and other cancer cells, and as a result enhance chemosensitivity of ... | 08/04/2009 |
| 7541579 | Linear quadrupoles with added hexapole fields and method of building and operating same A mass spectrometer and a method of operating and building same is provided in which a hexapole component is deliberately added to a substantially quadrupole field. This can result in unwanted octopole and dipole fields also being added to the substantially quadrupo... | 06/02/2009 |
| 7534773 | TRPM-2 antisense therapy Antisense therapy which reduces the expression of TRPM-2 provides therapeutic benefits in the treatment of cancer for example prostate cancer and renal cell cancer. Antisense TRPM-2 ODN treatment of prostatic tumor cells in vivo is effective for delaying the onset o... | 05/19/2009 |
| 7491816 | Antisense therapy for hormone-regulated tumors A method is provided for treating hormone-regulated tumors (for example, breast and prostatic tumors) in mammals, including humans, by administration of an antisense ODN which is complementary to a portion of the gene encoding IGFBP-5. Using the Shionogi tumor model... | 02/17/2009 |
| 7422902 | Lipid-nucleic acid particles prepared via a hydrophobic lipid-nucleic acid complex intermediate and use for gene transfer Novel lipid-nucleic acid particulate complexes which are useful for in vitro or in vivo gene transfer are described. The particles can be formed using either detergent dialysis methods or methods which utilize organic solvents. Upon removal of a solubilizing compone... | 09/09/2008 |
| 7410951 | Biologically active peptides and compositions, their use Derivatives of hemiasterlin or Geodiamolide G having anti-mitotic activities and useful in treating cancer. These derivatives are represented by formula I wherein Y, n, R1, R2, R3, R7 | 08/12/2008 |
| 7368436 | TRPM-2 antisense therapy It has been determined that antisense therapy which reduces the expression of TRPM-2 provides therapeutic benefits in the treatment of cancer, particularly prostate and renal cell cancers. Addition of antisense TRPM-2 ODN to prostatic tumor cells in vi... | 05/06/2008 |
| 7341738 | Lipid-encapsulated polyanionic nucleic acid Methods for the preparation of a lipid-nucleic acid composition are provided. According to the methods, a mixture of lipids containing a protonatable or deprotonatable lipid, for example an amino lipid and a lipid such as a PEG- or Polyamide oligomer-modified lipid ... | 03/11/2008 |
| 7297684 | Antisense therapy for hormone-regulated tumors A method is provided for treating hormone-regulated tumors (for example, breast and prostatic tumors) in mammals, including humans, by administration of an antisense ODN which is complementary to a portion of the gene encoding IGFBP-5. Using the Shionogi tumor model... | 11/20/2007 |
| 7285541 | Treatment of melanoma by reduction in clusterin levels Treatment of melanoma is achieved through reduction in the effective amount of clusterin in melanoma cells of in a mammalian subject, preferably a human. A therapeutic agent effective to reduce the effective amount of clusterin in the melanoma cells is administered ... | 10/23/2007 |
| 7282215 | Supports for photosensitizer formulations The invention is generally related to the field of formulating medicaments in association with a solid support. Such formulations comprising photosensitizers, and their use in photodynamic therapy, are also provided. Methods for the production of the medicament form... | 10/16/2007 |
| 7223887 | Multivalent cationic lipids and methods of using same in the production of lipid particles A multivalent cationic lipid having a positively-charged head group including two quaternary amine groups and a hydrophobic portion including four hydrocarbon chains, which may be the same or different and which are optionally substituted alkyl and alkenyl groups, t... | 05/29/2007 |
| 7205273 | Fusogenic liposomes The present invention relates to liposomes and virosomes and, more particularly, to liposomal and virosomal delivery systems for transporting materials such as drugs, nucleic acids and proteins. ... | 04/17/2007 |
| 7196067 | Antisense insulin-like growth factor binding protein (IGFBP)-2-oligodeoxynucleotides for prostate and other endocrine tumor therapy Compositions and a method are provided for the treatment of prostate and other endocrine tumors in mammals, including humans, by administration of an antisense oligodeoxynucleotide (ODN) which is complementary to a portion of the gene encoding IGFBP-2. Using the Shi... | 03/27/2007 |
| 7189705 | Methods of enhancing SPLP-mediated transfection using endosomal membrane destabilizers The present invention provides novel and surprisingly effective methods for delivering nucleic acids to cells. These methods are based upon the discovery that the presence of endosomal membrane destabilizers (e.g., calcium) leads to a dramatic increase in the transf... | 03/13/2007 |
| 7183094 | Bacterial mycothiol S-conjugate amidase family The present invention provides a family of bacterial acyl glucosaminylinositol amidases with amidase activity against S-conjugate amides, particularly mycothiol-derived S-conjugate amides. The invention amidases are characterized by a highly conserved 20 amino acid ... | 02/27/2007 |
| 7172297 | High dynamic range display devices A display has a screen which incorporates a light modulator. The screen may be a front projection screen or a rear-projection screen. Elements of the light modulator may be controlled to adjust the intensity of light emanating from corresponding areas on the screen.... | 02/06/2007 |
