Bizarre Patents
Nicotine Containing Dental Floss
Keep away cavities and cancer at the same time.
PatentStorm News
Make the Most of Our Site
See this month's Top Inventors and Most Cited Patents.
Stay on top of the latest innovations by subscribing to an RSS feed.
Registered users: Manage your profile.
| Number | Title | Issue Date |
| 5986062 | Recombinant human serum albumin, process for producing the same and pharmaceutical preparation containing the same Human serum albumin obtained by gene manipulation techniques can be purified by a combination of specified steps in which a culture supernatant obtained from a human serum albumin-producing host is subjected to ultrafiltration, heat treatment, acid treatm... | 11/16/1999 |
| 5972367 | Infusion preparation Disclosed is an infusion preparation for nutrient supply use. It comprises a sugar, amino acids, electrolytes and a fat emulsion. It has an excellent shelf life without causing precipitation, denaturation and the like in spite of the simultaneous presence... | 10/26/1999 |
| 5948785 | Heterocyclic amide compounds and pharmaceutical use of the same Heterocyclic amide compounds of the formula (I) ##STR1## wherein each symbol is as defined in the specification, pharmacologically acceptable salts thereof, pharmaceutical compositions thereof and pharmaceutical use thereof. The heterocyclic amide co... | 09/07/1999 |
| 5945103 | Process for producing thrombin The present invention provides a production method of thrombin which can convert prothrombin into thrombin highly efficiently even in the absence of thromboplastin and blood plasma, easily obtain a starting material for use in the conversion of prothrombi... | 08/31/1999 |
| 5942249 | Composition for oral administration containing pyridazinone compounds A composition for oral administration which contains a pyridazinone compound of the formula (I) ##STR1## wherein R1, R2 and R3 are each independently a hydrogen atom or a lower alkyl, X is a halogen atom, a cyano or a... | 08/24/1999 |
| 5928661 | Controlled release composition containing volatile compound A controlled release composition comprising a volatile compound such as allyl isothiocyanate and a rosin in a proportion of 0.1 to 100 parts by weight of the compound per 100 parts by weight of the rosin, the controlled release composition further compris... | 07/27/1999 |
| 5888964 | Method for increasing placental blood flow A method for increasing the placental blood flow, which comprises administering a human-originated antithrombin-III. The human-originated antithrombin-III increases the placental blood flow in mammals and particularly improves intrauterine growth retardat... | 03/30/1999 |
| 5880150 | Antimicrobial agent containing allyl isothiocyanate and method for controlling release speed of allyl isothiocyanate An antimicrobial agent comprising allyl isothiocyanate (AIT) packaged in a packaging material having a structure wherein part of the pores of a porous packaging substrate is filled with, or said pores are partially or entirely narrowed by a resin impervio... | 03/09/1999 |
| 5874404 | Immunoglobulin E receptor -chain inhibits IgE production and secondary allergic responses Disclosed is an antiallergic composition comprising, as an active ingredient, a peptide which is capable of binding to human IgE, more specifically the high-affinity immunoglobulin E receptor -chain or a soluble fragment, which is capable of bindin... | 02/23/1999 |
| 5856337 | 2-arylquinolines and process for producing the same 2-Arylquinolines represented by formula (1): ##STR1## wherein R1, R3 to R9 each represents hydrogen, halogen, lower alkyl, cyclic lower alkyl, aryl, aralkyl, alkoxy or --Cm F2m+1 ; R2 ... | 01/05/1999 |
| 5856328 | Circulatory disorder improving agent A circulatory disorder improving agent comprising, as an active ingredient, a dihydropyridine derivative of the formula (I) ##STR1## or an acid addition salt thereof. Said circulatory disorder improving agent is particularly useful as an organ circul... | 01/05/1999 |
| 5798357 | Agent for prophylaxis and treatment of thromboxane A2 -mediated diseases An agent for the prophylaxis or treatment of TXA2 -mediated diseases, particularly, a TXA2 synthetase inhibitor, which comprises a pyridazinone compound of the formula (I) ##STR1## wherein each symbol is as defined in the specif... | 08/25/1998 |
| 5780634 | Process for producing 2-(carboxyphenyl)-4-quinolinecarboxylic acid compounds Quinolin-2-yl benzoic acid compounds which are useful as intermediates of quinoline compounds having angiotensin II antagonist activity prepared by decarboxylating 2-(carboxyphenyl)-4-quinolinecarboxylic acid compounds in which a carboxyl group bonded to ... | 07/14/1998 |
| 5770233 | Container filled with infusion liquids and infusion preparation An object of the present invention is to provide an infusion preparation set (a container filled with infusion liquids) useful for preparation of an infusion liquid containing sugars, amino acids, electrolytes, a fat emulsion and vitamins. The present inv... | 06/23/1998 |
| 5759819 | Process for producing human serum albumin A process for producing recombinant human serum albumin (HSA) which comprises culturing an HSA producing host prepared by gene manipulation techniques at a temperature of from 21° to 29° C. Culturing the HSA producing host under such a specified tempera... | 06/02/1998 |
| 5756313 | Albumin gene-containing plasmid, transformant carrying same, production of such transformant and production of albumin A plasmid for a yeast host, the plasmid comprising in sequence: (1) a yeast derived promoter, (2) an albumin-encoding region placed under control of the yeast-derived promoter, (3) a transcription terminator and (4) a sequence homologous to a part of the ... | 05/26/1998 |
| 5753670 | Carboxylic acid compound having condensed ring, salt thereof and pharmaceutical use thereof A novel carboxylic acid compound having a condensed ring; which is represented by the formula (I) ##STR1## wherein each symbol is as defined in the specification, a pharmacologically acceptable salt thereof, a pharmaceutical composition thereof ... | 05/19/1998 |
| 5750545 | Triazole derivative and pharmaceutical use thereof An agent for the prophylaxis and treatment of immune-related diseases, in particular, immunosuppressant, an agent for the prophylaxis and treatment of allergic diseases, an agent for the prophylaxis and treatment of eosinophil-related diseases and an eosi... | 05/12/1998 |
| 5728681 | Infusion preparation and two compartment container containing the preparation A container filled with infusion liquids useful for preparation of an infusion liquid containing sugars, amino acids, electrolytes, a fat emulsion and vitamins. A container having two compartments which are separated from each other by a separation means,... | 03/17/1998 |
| 5710253 | Method for decoloring human serum albumin A method for decoloring a recombinant human serum albumin by treating the albumin with a reducing agent is disclosed. Also, a method for decoloring a recombinant human serum albumin by treating the albumin with a method removing free polysaccharides with ... | 01/20/1998 |
| 5707827 | Mutant AOX2 promoter, vector carrying same, transformant and production of heterologous protein A mutant AOX2 promoter wherein 1 to 3 oligonucleotide(s) GATAGGCTATTTTTGTCGCATAAAT (SEQUENCE ID NO: 2) is (are) added in the normal direction, the reverse direction or in both the normal and reverse directions at the 5' end side of a partial DNA fragment ... | 01/13/1998 |
| 5703124 | Composition containing allyl isothiocyanate and its use An antimicrobial composition comprising AIT and a polyhydric alcohol which may have aldehyde group or ketone group; an antimicrobial composition comprising a surfactant and said composition; a method for treating microorganisms; and a method for retaining... | 12/30/1997 |
| 5691451 | Method for sterilizing recombinant human serum albumin pharmaceutical preparation A recombinant human serum albumin (rHSA) pharmaceutical preparation is sterilized by subjecting a pharmaceutical preparation of rHSA obtained by gene manipulation techniques packed in a container in an administration unit to heat treatment at 50° to 80°... | 11/25/1997 |
| 5691339 | Circulatory disorder improving agent A circulatory disorder improving agent comprising, as an active ingredient, a dihydropyridine derivative of the formula (I) ##STR1## or an acid addition salt thereof. Said circulatory disorder improving agent is particularly useful as an organ circul... | 11/25/1997 |
| 5688818 | Succinamic acid compound, production method thereof and use thereof Provision of a succinamic acid compound of the formula (1) ##STR1## wherein R1 is an alkyl or a lower alkenyl and R2 is an optionally esterified carboxyl, a pharmaceutically acceptable salt thereof, an agent for the prophylaxis ... | 11/18/1997 |
| 5683893 | Mutant AOX2 promoter, vector carrying same, transformant, and production of heterlogous protein A mutant AOX2 promoter obtained by mutating a sequence of natural AOX2 promoter in a manner comprising at least one of the three mutation modes of (1) a region extending upstream from nucleotide 1187 inclusive and comprising at least nucleotides 845-960 i... | 11/04/1997 |
| 5677300 | Pyridothiazineacetic acid compound, production thereof and use thereof A pyridothiazineacetic acid compound of the formula (I) ##STR1## wherein each symbol is as defined in the specification, a pharmaceutically acceptable salt thereof, production thereof, and a pharmaceutical composition, an aldose reductase inhibitor a... | 10/14/1997 |
| 5674527 | Infusion preparation comprising phospholipid Disclosed is an infusion preparation for nutrient supply use. It comprises a sugar, amino acids, electrolytes and a fat emulsion. It has an excellent shelf life without causing precipitation, denaturation and the like in spite of the simultaneous presence... | 10/07/1997 |
| 5662931 | Process for preparing liposome composition The object of the present invention is to provide a process for preparing a drug-containing liposome composition in which (1) a drug to be included into liposomes, particularly a physiologically active protein having a molecular weight of from 500 to 100,... | 09/02/1997 |
| 5658924 | 1,8-naphthyridin-2-one derivative and use thereof The present invention relates to 1,8-naphthyridin-2-one derivatives, pharmaceutically acceptable acid addition salts and therapeutic agents comprising said compound as an active ingredient, which are used for the diseases such as circulatory diseases and ... | 08/19/1997 |
| 5656729 | Method for highly purifying human serum albumin A method for highly purifying human serum albumin (HSA), which comprises bringing a fraction containing HSA produced by genetic engineering into contact with a chelating chromatography carrier bound with copper ions, and eluting the HSA adsorbed by the ca... | 08/12/1997 |
| 5643792 | Mutant strain of Pichia pastoris which utilizes methanol in the presence of glucose A methylotrophic and glucotrophic mutant strain capable of producing a heterologous protein and a method for producing a heterologous protein, comprising culture of the mutant strain. The mutant strain of the present invention can be grown in a medium con... | 07/01/1997 |
| 5635527 | Carboxylic acid compound having condensed ring, salt thereof and pharmaceutical use thereof A novel carboxylic acid compound having a condensed ring, which is represented by the formula (I) ##STR1## wherein each symbol is as defined in the specification, a pharmacologically acceptable salt thereof, a pharmaceutical composition thereof ... | 06/03/1997 |
| 5635505 | 1,4-benzoxazine-2-acetic acid compound, method for production thereof and use thereof A 1,4-benzoxazine-2-acetic acid compound of the formula (I) ##STR1## wherein each symbol is as defined in the specification, a pharmaceutically acceptable salt thereof, a method for production thereof, and a pharmaceutical composition, an aldose redu... | 06/03/1997 |
| 5631145 | Process for producing human serum albumin A process for producing recombinant human serum albumin (HSA) which comprises culturing an HSA producing host prepared by gene manipulation techniques at a temperature of from 21° to 29° C. Culturing the HSA producing host under such a specified tempera... | 05/20/1997 |
| 5626880 | Infusion preparation Disclosed is an infusion preparation for nutrient supply use. It comprises a sugar, amino acids, electrolytes and a fat emulsion. It has an excellent shelf life without causing precipitation, denaturation and the like in spite of the simultaneous presence... | 05/06/1997 |
| 5616691 | Process for producing albumin preparation The process for producing the albumin preparation of the present invention comprises treating an aqueous albumin solution with an anion exchanger and a cation exchanger and subjecting the solution to heat treatment wherein a polyacrylamide type carrier ha... | 04/01/1997 |
| 5612197 | Process for producing recombinant human serum albumin A process for producing recombinant human serum albumin is disclosed, which comprises culturing a human serum albumin-producing host, prepared by gene manipulation techniques in a medium that contains an amino acid, preferably at least one amino acid sele... | 03/18/1997 |
| 5610169 | Pharmaceutical Composition containing slightly water-soluble drug The orally administrable pharmaceutical compositions containing a slightly water-soluble drug, characterized by improved stability and improved absorption of the drug from digestive tract into blood. The use of the compositions of the present invention en... | 03/11/1997 |
| 5610036 | Mutant AOX2 promoter, microorganism carrying same, method of preparation thereof and production of heterologous protein using such microorganism A mutant AOX2 (alcohol oxidase 2) promoter derived from the natural AOX2 promoter by base sequence deletion, insertion, or substitution is disclosed. A microbial strain carrying a gene under the control of such a mutant AOX2 promoter can be obtained by gr... | 03/11/1997 |
