Bizarre Patents
A banana protective device for storing and transporting a banana carefully.
PatentStorm News
Make the Most of Our Site
See this month's Top Inventors and Most Cited Patents.
Stay on top of the latest innovations by subscribing to an RSS feed.
Registered users: Manage your profile.
| Number | Title | Issue Date |
| 8182784 | Process for the time recovery of sulphate of potash (SOP) from sulphate rich bittern The present invention relates to a process for the recovery of sulphate of potash (SOP) from bittern. Kainite is obtained by fractional crystallization of the bittern. Kainite is converted into schoenite with simultaneous removal of NaCl and the filtrate (SEL) is us... | 05/22/2012 |
| 8178356 | Method for evaluation of performance of percolation tanks using environmental chloride as a tracer Naturally present chloride concentration in natural water is utilized for the development of the technique to gauge the performance of percolation tanks in space and time. The chloride mass balance technique is simple, sensitive, reliable and yet powerful enough to ... | 05/15/2012 |
| 8153627 | Quinazoline linked pyrrolo[2,1-][1, 4]benzodiazepine hybrids as potential anticancer agents and process for the preparation thereof The present invention provides a compound of general formula 5, useful as potential antitumour agents against human cancer cell lines. The present invention further provides a process for the preparation of pyrrolo[2,1-c][1,4]benzodiazepine hybrids of general formul... | 04/10/2012 |
| 8148118 | Method of inducing chirality to epoxides using 2,3:4,6 di-O-isopropylidene-2-keto-L-gulonic acid monohydrate The present invention relates to a recyclable method to prepare chirally pure epoxides directly from olefins using a novel chiral acid 2,3:4,6-di-O-isopropylidene-2-keto-L-gulonic acid monohydrate as chiral inducer and anhydrous hydrogen peroxide in the form of urea... | 04/03/2012 |
| 8097447 | Solid nutrient media useful for isolating and identifying alkaliphilic bacteria The present invention relates to a solid nutrient media composition having alkaline pH, useful for isolating and identifying alkaliphilic microorganisms in pure form. The media composition consists of 5-15 g of carbon source, 2.5-10 g of peptone, 2.5-10 g of yeast e... | 01/17/2012 |
| 8093004 | Method of detecting and predicting bronchodilatory response to beta agonist Present invention relates to a method for predicting an individual's bronchodilatory response to a β agonist. Present invention particularly relates to the detection of specific allelic variants of the β2AR gene and their use as pharmacogenetic markers towards res... | 01/10/2012 |
| 8063204 | Benzothiazole and benzoxazole linked pyrrolo[2,1-c] [1, 4] benzodiazepine hybrids as novel antitumour agents and process for the preparation thereof The present invention provides a compound of general formula (9), useful as potential antitumour agents against human cancer cell lines. The present invention further provides a process for the preparation of pyrrolo[2,1-c][1,4][benzodiazepine g hybrids of general f... | 11/22/2011 |
| 8021442 | Process for the preparation of common salt of high purity from brines in solar salt pans The process of the invention is an improvement over the existing process of producing salt of high purity from alum-treated brine disclosed recently in the prior art. More particularly, the invention rectifies the ratio of Ca2+ to Mg2+ from a v... | 09/20/2011 |
| 8012952 | Cationic 17 α-substituted-estradiol derivatives useful as anti-cancer agent The present invention provides a novel series of cationic, lipid-based, 17α-substituted-estradiol derivatives. The present invention further provides a process for the preparation of a novel series of 17α-substituted-estradiol derivatives. The invention also provi... | 09/06/2011 |
| 7960418 | 4β-amino podophyllotoxin congeners as potential anticancer agents and a process for the preparation thereof The present invention provides new class of 4β-[4″-(1″,3″-benzothiazole-2″-yl)anilino]podophyllotoxin analogues having the structural formula as follows (4). Where R═H or CH3; R1═H, halogen,... | 06/14/2011 |
| 7940601 | Method for computing an exact impulse response of a plane acoustic reflector at zero offset due to a point acoustic source Originating from a novel and an exact algebraic formula for the impulse response of a plane acoustic reflector at zero offset due to a point acoustic source the present invention provides a method for computing an exact impulse response of a plane acoustic reflector... | 05/10/2011 |
| 7912272 | Fake document including fake currency detector using integrated transmission and reflective spectral response A currency genuineness detection system using plurality of opto-electronic sensors with both transmission and reflective (including fluorescence) properties of security documents is developed. Both detection sensing strategies utilize integrated response of the wide... | 03/22/2011 |
| 7879371 | Caffeine fraction obtained from tea leaves and a method for inducing -mediated genetic transformation in plants using said caffeine fraction The present invention relates to a thermolabile caffeine fraction useful for an efficient Agrobacterium-mediated genetic transformation in plant systems to develop desired traits in plant, and a method of preparing said fraction from tea leaves and also, an e... | 02/01/2011 |
| 7872160 | Single pot process for the regioselective synthesis of neolignan framework asarones The present invention provides a single pot process for the regioselective synthesis of neolignan framework [3(R)-Ethyl-2(S)-methyl-3-(2″,4″,5″-trimethoxyphenyl)-1-(2′,4′,5′-trimethoxyphenyl)propane from toxic β-isomer rich asarone using montmorillonite... | 01/18/2011 |
| 7871657 | Process for preparation of expanded millet The present invention relates to a process for preparation of expanded finger millet, a ready-to-eat product with versatile food uses. ... | 01/18/2011 |
| 7842653 | Process for the preparation of lubricants The present invention provides an improved process for the preparation of lubricants from vegetable oil or fat obtained from animal source. The present invention involves a reaction of vegetable oil or fat with an alcohol in the presence of a double metal cyanide ca... | 11/30/2010 |
| 7825230 | Human microRNA targets in HIV genome and a method of identification thereof The present invention relates to human microRNA targets in HIV genome and a method of identification thereof. Using multiple software targets to six human microRNAs [miRNAs] were discovered in the net, vpr, env, and I vif genes. The miRNAs were identified as hsa-miR... | 11/02/2010 |
| 7816119 | Chemoenzymatic process for the stereoselective preparation of (R)-γ-amino-β-hydroxybutyric acid or (R)-carnitine from 3,4-dihydroxybutanenitrile The present invention provides a chemoenzymatic process for the preparation of (R)-GABOB and (R)-carnitine employing lipase-mediated resolution of 3-hydroxy-4-tosyloxybutanenitrile as the key step. The drawing accompanying this specification represents the preparati... | 10/19/2010 |
| 7811535 | Process for the preparation of magnesia (MGO) The present invention provides an improved process for the preparation of MgO of high purity >99% from salt bitterns via intermediate formation of Mg(OH)2 obtained from the reaction of MgCl2 and lime, albeit indirectly, i.e., MgCl2 i... | 10/12/2010 |
| 7803526 | Development of diagnostic kit for the detection of B The present invention provides a method for detection of Chrysanthemum virus B in plants using desined primers of Sequence ID 1: Upstream primer TGCCTCCCAAACCGGCACCAGGTGAT Sequence ID 2: Downstream primer: TTTATAATGTCTTATTATTCGCAT It also relates to a diagnos... | 09/28/2010 |
| 7767798 | Loganin analogues and a process for the preparation thereof The present invention provides novel loganin analogues and a process for the preparation thereof. The present invention further provides the use of Iridoid glycoside loganin isolated from the fruit pulp of Strychnos nux-vomica and its bioactive semi-sy... | 08/03/2010 |
| 7763436 | Method for the diagnosis of rheumatoid arthritis The present invention relates to a novel diagnostic marker useful for the diagnosis of rheumatoid arthritis comprising the autoantibodies of mannose binding lectin protein and a process thereof. ... | 07/27/2010 |
| 7759527 | Microwave induced one pot process for the preparation of arylethenes The invention entitled “A Microwave Induced One Pot Process for The Preparation of Arylethenes” provides a method for the preparation of commercially important 2- or 4-hydroxy substituted arylethenes like styrenes or stilbenes in one pot utilizing cheaper substr... | 07/20/2010 |
| 7754694 | Pyrrolo[2, 1-C][1, 4]benzodiazepine-glycoside prodrug useful as a selective anti tumor agent The present invention provides pyrrolo[2,1-c][1,4]benzodiazepine-glycoside prodrug of general formula 1a-b, useful as selective anticancer agents. The present invention also provides a process for the preparation of pyrrolo[2,1-c][1,4]benzodiazepine-glycoside prodru... | 07/13/2010 |
| 7754643 | Transesterification catalyst and a process for the preparation thereof The present invention provides a novel transesterification catalyst having the general formula: Zn3M2(CN)n(ROH).xZnCl2.yH2O wherein R is tertiary-butyl and M is a transition metal ion selecte... | 07/13/2010 |
| 7741508 | Single step green process for the preparation of substituted cinnamic esters with -selectivity The invention provides a green process for direct oxidation of a large number of substituted or unsubstituted cinnamaldehydes or cinnamyl alcohols into the corresponding alkyl or aryl cinnamates in one step. The process of the present invention is a convenient and e... | 06/22/2010 |
| 7722918 | Process for the preparation of high temperature superconducting bulk current leads with improved properties and superconducting bulk current leads made thereby The present invention provides a process for the preparation of high temperature superconducting (HTS) bulk current leads capable of supplying a continuous current of more than 200 A at 77 K, at least for 2 to 4 hours without any substantial heat load to cryogen fre... | 05/25/2010 |
| 7709687 | Dicarbanionic initiator, a process for the preparation and use thereof The present invention provides a novel dicarbanionic initiator of formula (I). The present process further provides a process for the preparation of dicarbanionic initiator of formula (I) comprising reacting 1-bromo-4-(4′-b... | 05/04/2010 |
| 7684607 | Fake currency detector using visual and reflective spectral response A system for automatic detection of authenticity of security documents by measuring reflected components of incident energy in three or more optical wave bands. The system involves the use of UV-visible light source, an optional near infra red light source, photodet... | 03/23/2010 |
| 7678559 | Microbial composition and a process useful for the neutralization of alkaline waste-waters The invention relates to a microbial composition for the neutralization of alkaline waste waters by biological means and a method of neutralization of alkaline waste waters using a synergistic mixture of the bacterial strains of Bacillus alkalophilus and B... | 03/16/2010 |
| 7678413 | Monoclinic CeTiOthin film and sol-gel process for the preparation thereof A monoclinic CeTi2O6 thin film and a sol-gel process for the deposition of CeTi2O6 thin films, which has applications as passive counter electrodes in electrochromic devices, sensors and photocatalytic agent is presented. ... | 03/16/2010 |
| 7671182 | Gene variants of signal transducer and activator of transcription-6 (STAT 6) variants and process of detection the same The present invention relates to allelic variants of the human Signal Transducer and Activator of Transcription-6 (STAT6) gene and provides primers and methods suitable for the detection of these allelic variants for applications such as molecular diagnosis, predict... | 03/02/2010 |
| 7667022 | Promoter for high-throughput screening for inhibitors against Mycobacteria under low carbon conditions The present invention relates to a promoter for high-throughput screening for inhibitors against Mycobacteria under low carbon or starved conditions. Further, the use of this novel 200 bp promoter open new vistas and provides a new system that would enable the TB dr... | 02/23/2010 |
| 7658954 | Synergistic antipyretic formulation The present invention relates to a synergistic antipyretic formulation comprising extracts of plants Berberis aristata , Tinospora cordifolia , Alstonia scholaris, Andrographis paniculata and Hedychium spicatum , optionally along with pharmaceutically ... | 02/09/2010 |
| 7657378 | Computer based method for identifying peptides useful as drug targets The present invention relates to a novel computer based method for performing genome-wise comparison of several organisms, the said computational method involves creation of peptide libraries from protein sequences of several organisms and subsequent comparison lead... | 02/02/2010 |
| 7651705 | Herbal composition for the treatment of gastric ulcer Provided herein are synergistic herbal compositions for the treatment of gastric ulcer, said composition essentially comprising powdered plant parts of Asparagus racemosus, Glycyrrhiza glabra, Sesamum indicum, Musa sapientum and Trachyspermum roxburghianum... | 01/26/2010 |
| 7650027 | Fake document including fake currency detector using integrated transmission and reflective spectral response A currency genuineness detection system using plurality of opto-electronic sensors with both transmission and reflective (including fluorescence) properties of security documents is developed. Both detection sensing strategies utilise integrated response of the wide... | 01/19/2010 |
| 7645314 | Composition useful for making slow release nitrogen free phosphorous, potassium and sulfur oxide glass and a process of making glass therefrom Di-ammonium phosphate, murate of potash and gypsum are the conventional phosphorous, potassium and sulfur fertilizers respectively. Application of gypsum to soil can cause an increase calcium load on soil and polluted surface and underground water. The most successf... | 01/12/2010 |
| 7642329 | Oligomeric lactide macromer based copolymer and a process for the preparation thereof A macromer based novel copolymer comprising an acrylate or methacrylate ester of low molecular weight oligomeric lactide copolymerized with basic monomer is provided. These copolymers show unusual dissolution behavior in that they are soluble over a wide range of pH... | 01/05/2010 |
| 7642328 | pH sensitive macromer based copolymer and a process for the preparation thereof The present invention discloses a novel pH sensitive copolymer synthesized from lactide macromers and basic monomers. This composition comprises an acrylate or methacrylate ester of low molecular weight oligomeric lactide copolymerized with basic monomer. These copo... | 01/05/2010 |
